Previous Article | Next Article 
Infection and Immunity, February 2005, p. 1252-1255, Vol. 73, No. 2
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.2.1252-1255.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Mutagenesis of a Novel Gene in the prcA-prtP Protease Locus Affects Expression of Treponema denticola Membrane Complexes
Xue-lin Bian,1,
Hong-tao Wang,1
Yu Ning,1
Si Young Lee,1,2 and
J. Christopher Fenno1*
Department of Biologic and Materials Sciences, School of Dentistry, University of Michigan, Ann Arbor, Michigan,1
Department of Oral Microbiology, College of Dentistry, Kangnung National University, Kangnung, South Korea2
Received 27 July 2004/
Returned for modification 20 September 2004/
Accepted 30 October 2004

ABSTRACT
A novel gene was identified in the
Treponema denticola prcA-prtP protease operon. Strains with mutations in either the
prcA-prtP or the
msp region showed altered expression of a product(s)
of the other locus. Together, these results provide information
on the assembly of outer membrane complexes involved in
T. denticola interaction with host cells and tissue.

TEXT
Two
Treponema denticola surface components with a wide range
of cytopathic activities have been reported: the oligomeric
major surface protein (Msp) (
7,
13) and a protease complex (
20)
encoded by the
prcA-prtP locus (
17,
18). The Msp has functional
characteristics of an outer membrane porin (
6,
7). The protease
complex consists of the PrtP protease (dentilisin) and two proteins
(PrcA1 and PrcA2) that result from posttranslational processing
of the PrcA polypeptide (
18). Both Msp and PrcA-PrtP exhibit
adhesin-like binding activity and are cytotoxic to epithelial
cells (
7). Recent reports implicate Msp in the disruption of
fibroblast calcium responses and cytoskeletal assembly (
1,
3).
PrtP activity contributes to
T. denticola tissue penetration
(
4,
12) and modulation of inflammatory cytokine responses (
2,
5). PrtP is reported to either contribute to (
15) or interfere
with (
21)
T. denticola binding to
Porphyromonas gingivalis.
Using isogenic mutants, we showed that the production of native
Msp and PrtP are related (
10,
18) and that PrtP is required
for PrcA processing (
18). An
msp mutant producing a C-terminally
truncated Msp makes no detectable protease proteins, while an
Msp-deficient mutant produces wild-type PrcA-PrtP protease.
Strains mutated in the protease locus demonstrate reduced expression
and oligomerization of Msp. The complex phenotypes of mutant
strains must be taken into account when using mutants to study
T. denticola interaction with host cells and tissue. The present
study was undertaken to extend understanding of the relationship
between these membrane complexes. Here, we further characterize
the expression of the protease activity and Msp in isogenic
mutant strains and identify a novel open reading frame in the
protease operon whose expression is required for outer membrane
complex formation.
Growth behavior of T. denticola strains.
To investigate the role of PrtP activity in anaerobic growth in NOS medium (14), parent strain 35405 and isogenic strains with mutations in either the protease locus or the msp locus (Table 1) were monitored for 7 days following 1:20 dilution of actively growing cultures (optical density at 600 nm [OD600] of 0.35; triplicate samples; four replicates). The parent strain reached stationary phase within 100 h. All of the mutant strains tested had a slightly slower growth rate, reaching stationary phase at 120 to 140 h (data not shown). Final optical densities of protease-deficient strains, including strain MPE, were consistently lower than that of strain 35405, but differences were statistically insignificant. High-molecular-weight media constituents were not degraded by the protease-deficient strains (data not shown), consistent with the hypothesis that PrtP activity contributes to nutrient processing or acquisition. Interestingly, strain MHE, which produces no Msp but has wild-type levels of protease activity, also grew at a slower rate than 35405. This result supports the hypothesis that Msp is essential for proper outer membrane function and is suggestive of functional interactions between PrtP protease activity and Msp porin activity in nutrient acquisition and uptake.
Gene expression and protease activity.
PrtP protease activity and transcription of
prcA and
prtP in
parent and isogenic mutant strains were monitored throughout
growth by quantitative reverse transcription-PCR (QRT-PCR).
Protease activity in 35405, as measured by cleavage of succinyl-
L-alanyl-
L-alanyl-
L-prolyl-
L-phenylalanine-
p-nitroanilide
(SAAPFNA) (
8), increasedduring active growth and persisted at
high levels in stationary phase (Fig.
1A). Transcription of
prcA and
prtP increased during active growth but was greatly
reduced at stationary phase (Fig.
1B). We detected no significant
differences in
prcA or
prtP transcription during active growth
between the parent strain and the
msp mutants MHE and MPE (data
not shown). This result is of particular interest due to the
distinctly different Msp and PrcA-PrtP phenotypes of these strains
(Table
1). The lack of PrcA-PrtP proteins and activity in strain
MPE, but not MHE, is therefore due to posttranscriptional events
and may be related to the presence of a defective, truncated
Msp in MPE.
Expression of msp in prcA and prtP mutants.
Total Msp and especially Msp oligomers were greatly reduced
in strains with defined mutations in either
prcA or
prtP or
both (
10,
18). To determine whether this result was reflected
in
msp transcription, QRT-PCR assays were performed on parent
and mutant strains. As shown in Fig.
2,
msp transcription in
isogenic
prcA and
prtP mutants was reduced by greater that 50%
during active growth. This result is consistent with Msp protein
expression results (
10,
18) and suggests that protease gene
expression might contribute to the regulation of
msp transcription.
However, reduced
msp transcription does not account for the
absence of Msp oligomers in protease mutants.
The prcA-prtP transcript includes an additional upstream gene.
Expression of PrcA, which is encoded directly upstream of the
gene encoding PrtP, is required for PrtP expression and activity
(
16,
18). A recent study reported that the
prtP transcript is
at least 5 kb, large enough to include both
prcA and
prtP (
16).
RT-PCR using primer pair CX361 and CX362 (Fig.
3A, lane 3) demonstrated
that
prcA and
prtP are cotranscribed. Transcription of
prtP was not detected in
prcA mutant strain PNE (data not shown),
and a typical rho-independent transcription termination sequence
is found directly downstream of
prtP. Taken together, these
data demonstrate that
prcA and
prtP are cotranscribed. Because
prcA and
prtP together comprise only 4.2 kb, we examined the
sequence upstream of
prcA by RT-PCR and demonstrated that the
prcA-prtP transcript extends upstream through the 5' end of
TDE0760 (Fig.
3B, lanes 1 and 4). TDE0760 encodes a conserved
hypothetical protein of 18 or 21 kDa, depending on whether the
translation initiates at nucleotide 799483 (ATG) or at 799576
(GTG), as indicated by the
T. denticola genome annotation. Sequence
analysis using PSORT (
http://psort.nibb.ac.jp/) predicts that
the TDE0760 protein, including the additional N-terminal region,
is membrane associated and may be acylated.
Construction of a TDE0760 mutant.
To characterize the relationship between TDE0760 and the protease
complex, we constructed a TDE0760 isogenic mutant by allelic
replacement mutagenesis. A 1,475-bp PCR product containing all
but the 3' end of TDE0760 that was generated by using standard
PCR conditions (
9) with CX412 (GAGCTTTGTCTTCTACATTG) and CX413
(CAAATTGATGATCTTCCCTG) was cloned in pSTBlue-1 (Novagen). The
ermF/ermB cassette (
11) was inserted in opposite transcriptional
orientation to TDE0760 at a
pshA1 site 43 nucleotides 3' to
the putative ATG initiation codon at nucleotide 799483, yielding
pCF353. Plasmid pCF353 was then digested with PvuII, releasing
the vector sequences.
T. denticola was electroporated with the
resulting linear DNA, and transformants were selected for erythromycin
resistance (
10,
19). Genomic DNA from Em
r colonies was screened
by PCR for the presence of the
ermF/ermB cassette in TDE0760
by using combinations of oligonucleotide primers specific for
TDE0760,
prcA, and
ermF/ermB (data not shown). A single validated
isolate was designated
T. denticola P0760.
Protein expression in mutant strain P0760.
As shown in Fig. 4, mutagenesis of TDE0760 resulted in the loss of expression of both PrcA2 and PrtP. RT-PCR products of prtP, prcA, and the 3' region of TDE0760 were present in 35405 but not in P0760 (data not shown). SAAPFNA activity was absent in P0760, essentially identical to that of CKE, PNE, CCE, and MPE (data not shown). While total Msp was considerably reduced in P0760 (Fig. 4, Msp-H), Msp oligomers (Fig. 4, Msp-U) were barely detectable in P0760 compared with 35405.
While it has not yet been possible to determine the mechanism
for the connection between the expression of Msp and the PrcA-PrtP
protease complex, the present study further explored this relationship.
We have presented new information on growth and transcription
in
T. denticola strains with mutations in genes encoding periodontal
virulence factors. Transcriptional analysis supports the hypothesis
that the production of active protease complex and Msp oligomers
are closely related. While its function is not yet known, initial
characterization of TDE0760 contributes to our understanding
of protease complex expression. This report should help to provide
a context for interpretation of studies using these and similar
defined mutant strains to assay biological activities of Msp
and PrtP.

ACKNOWLEDGMENTS
This work was supported by Public Health Service grant DE13565
from the National Institute of Dental and Craniofacial Research
(J.C.F.).

FOOTNOTES
* Corresponding author. Mailing address: Department of Biologic and Materials Sciences, School of Dentistry, University of Michigan, Ann Arbor, MI 48109-1078. Phone: (734) 763-3331. Fax: (734) 647-2110. E-mail:
fenno{at}umich.edu.

Editor: J. T. Barbieri
Present address: Department of Medical Microbiology and Immunology, Texas A&M University System Health Science Center, College Station, TX 77843-1114. 

REFERENCES
1 - Amin, M., A. C. S. Ho, J. Y. Lin, A. P. Batista da Silva, M. Glogauer, and R. P. Ellen. 2004. Induction of de novo subcortical actin filament assembly by Treponema denticola major outer sheath protein. Infect. Immun. 72:3650-3654.[Abstract/Free Full Text]
2 - Asai, Y., T. Jinno, and T. Ogawa. 2003. Oral treponemes and their outer membrane extracts activate human gingival epithelial cells through Toll-like receptor 2. Infect. Immun. 71:717-725.[Abstract/Free Full Text]
3 - Batista da Silva, A. P., W. Lee, E. Bajenova, C. A. McCulloch, and R. P. Ellen. 2004. The major outer sheath protein of Treponema denticola inhibits the binding step of collagen phagocytosis in fibroblasts. Cell. Microbiol. 6:485-498.[CrossRef][Medline]
4 - Chi, B., M. Qi, and H. K. Kuramitsu. 2003. Role of dentilisin in Treponema denticola epithelial cell layer penetration. Res. Microbiol. 154:637-643.[Medline]
5 - Deng, Q. D., Y. Han, X. Xia, and H. K. Kuramitsu. 2001. Effects of the oral spirochete Treponema denticola on interleukin-8 expression from epithelial cells. Oral Microbiol. Immunol. 16:185-187.[CrossRef][Medline]
6 - Egli, C., W. K. Leung, K. H. Müller, R. E. Hancock, and B. C. McBride. 1993. Pore-forming properties of the major 53-kilodalton surface antigen from the outer sheath of Treponema denticola. Infect. Immun. 61:1694-1699.[Abstract/Free Full Text]
7 - Fenno, J. C., P. M. Hannam, W. K. Leung, M. Tamura, B. C. McBride, and V.-J. Uitto. 1998. Cytopathic effects of the major surface protein and the chymotrypsinlike protease of Treponema denticola. Infect. Immun. 66:1869-1877.[Abstract/Free Full Text]
8 - Fenno, J. C., S. Y. Lee, C. H. Bayer, and Y. Ning. 2001. The opdB locus encodes the trypsin-like peptidase activity of Treponema denticola. Infect. Immun. 69:6193-6200.[Abstract/Free Full Text]
9 - Fenno, J. C., K.-H. Müller, and B. C. McBride. 1996. Sequence analysis, expression and binding activity of recombinant major outer sheath protein (Msp) of Treponema denticola. J. Bacteriol. 178:2489-2497.[Abstract/Free Full Text]
10 - Fenno, J. C., G. W. K. Wong, P. M. Hannam, and B. C. McBride. 1998. Mutagenesis of outer membrane virulence determinants of the oral spirochete Treponema denticola. FEMS Microbiol. Lett. 163:209-215.[CrossRef][Medline]
11 - Fletcher, H. M., H. A. Schenkein, R. M. Morgan, K. A. Bailey, C. R. Berry, and F. L. Macrina. 1995. Virulence of a Porphyromonas gingivalis W83 mutant defective in the prtH gene. Infect. Immun. 63:1521-1528.[Abstract]
12 - Grenier, D., V.-J. Uitto, and B. C. McBride. 1990. Cellular location of a Treponema denticola chymotrypsinlike protease and importance of the protease in migration through the basement membrane. Infect. Immun. 58:347-351.[Abstract/Free Full Text]
13 - Haapasalo, M., K.-H. Müller, V.-J. Uitto, W. K. Leung, and B. C. McBride. 1992. Characterization, cloning, and binding properties of the major 53-kilodalton Treponema denticola surface antigen. Infect. Immun. 60:2058-2065.[Abstract/Free Full Text]
14 - Haapasalo, M., U. Singh, B. C. McBride, and V.-J. Uitto. 1991. Sulfhydryl-dependent attachment of Treponema denticola to laminin and other proteins. Infect. Immun. 59:4230-4237.[Abstract/Free Full Text]
15 - Hashimoto, M., S. Ogawa, Y. Asai, Y. Takai, and T. Ogawa. 2003. Binding of Porphyromonas gingivalis fimbriae to Treponema denticola dentilisin. FEMS Microbiol. Lett. 226:267-271.[CrossRef][Medline]
16 - Ishihara, K., H. K. Kuramitsu, and K. Okuda. 2004. A 43-kDa protein of Treponema denticola is essential for dentilisin activity. FEMS Microbiol. Lett. 232:181-188.[CrossRef][Medline]
17 - Ishihara, K., T. Miura, H. K. Kuramitsu, and K. Okuda. 1996. Characterization of the Treponema denticola prtP gene encoding a prolyl-phenylalanine-specific protease (dentilisin). Infect. Immun. 64:5178-5186.[Abstract]
18 - Lee, S. Y., X.-L. Bian, G. W. K. Wong, P. M. Hannam, B. C. McBride, and J. C. Fenno. 2002. Cleavage of Treponema denticola PrcA polypeptide to yield protease complex-associated proteins PrcA1 and PrcA2 is dependent on PrtP. J. Bacteriol. 184:3864-3870.[Abstract/Free Full Text]
19 - Li, H., J. Ruby, N. Charon, and H. Kuramitsu. 1996. Gene inactivation in the oral spirochete Treponema denticola: construction of an flgE mutant. J. Bacteriol. 178:3664-3667.[Abstract/Free Full Text]
20 - Uitto, V.-J., D. Grenier, E. C. S. Chan, and B. C. McBride. 1988. Isolation of a chymotrypsinlike enzyme from Treponema denticola. Infect. Immun. 56:2717-2722.[Abstract/Free Full Text]
21 - Vesey, P. M., and H. K. Kuramitsu. 2004. Genetic analysis of Treponema denticola ATCC 35405 biofilm formation. Microbiology 150:2401-2407.[Abstract/Free Full Text]
Infection and Immunity, February 2005, p. 1252-1255, Vol. 73, No. 2
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.2.1252-1255.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
McDowell, J. V., Huang, B., Fenno, J. C., Marconi, R. T.
(2009). Analysis of a Unique Interaction between the Complement Regulatory Protein Factor H and the Periodontal Pathogen Treponema denticola. Infect. Immun.
77: 1417-1425
[Abstract]
[Full Text]
-
Bamford, C. V., Fenno, J. C., Jenkinson, H. F., Dymock, D.
(2007). The Chymotrypsin-Like Protease Complex of Treponema denticola ATCC 35405 Mediates Fibrinogen Adherence and Degradation. Infect. Immun.
75: 4364-4372
[Abstract]
[Full Text]
-
McDowell, J. V., Lankford, J., Stamm, L., Sadlon, T., Gordon, D. L., Marconi, R. T.
(2005). Demonstration of Factor H-Like Protein 1 Binding to Treponema denticola, a Pathogen Associated with Periodontal Disease in Humans. Infect. Immun.
73: 7126-7132
[Abstract]
[Full Text]