This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Du, C.
Right arrow Articles by Li, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Du, C.
Right arrow Articles by Li, D.

 Previous Article  |  Next Article 

Infection and Immunity, February 2005, p. 865-871, Vol. 73, No. 2
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.2.865-871.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Deletion of the SSK1 Response Regulator Gene in Candida albicans Contributes to Enhanced Killing by Human Polymorphonuclear Neutrophils

Chen Du, Richard Calderone,* John Richert, and Dongmei Li

Department of Microbiology and Immunology, Georgetown University Medical Center, Washington, D.C

Received 26 July 2004/ Returned for modification 1 September 2004/ Accepted 4 October 2004


arrow
ABSTRACT
 
The isolation and partial functional characterization of the two-component response regulator SSK1 gene of Candida albicans was previously reported. Compared to wild-type (CAF2-1) and gene-reconstituted (SSK23) strains, the ssk1 null strain (SSK21) was avirulent in a murine model of hematogenously disseminated candidiasis and less able to adhere to human esophageal cells. More recent data indicate that SSK21 is sensitive to 4 to 8 mM H2O2 in vitro than CAF2-1 and SSK23. Furthermore, microarray studies indicate that the regulation of two classes of genes, those encoding cell wall functions and stress adaptation, are altered in the ssk1 mutant. In the present study, the susceptibility of strains CAF2-1, SSK21, and SSK23 to killing by human polymorphonuclear neutrophils (PMNs) was assessed. Results are also described for a newly constructed ssk1 mutant (SSK24) in which the URA3 gene is integrated into its native locus. Our results indicate that killing of SSK21 and SSK24 was significantly greater than that of CAF2-1 and SSK23 (P < 0.01). In order to determine why Ssk1p at least partially protects the organism against the killing activity of human PMNs, we compared the signal transduction activity and the inflammatory response gene profiles of PMNs infected with either the wild type or the ssk1 mutant. Phosphorylation of the mitogen-activated protein kinases p42/44 and p38 from neutrophils infected with either CAF2-1 (wild type) or SSK21 (ssk1/ssk1) was similar, while expression and phosphorylation of the JNK mitogen-activated protein kinase was not observed following infection with either strain. On the other hand, we observed an upregulation of seven inflammatory response genes in PMNs infected with the SSK21 mutant only, while an increase in interleukin-10 expression was measured in PMNs infected with either strain. Downregulation of interleukin-2 was observed in PMNs infected with either strain. Verification of the transcriptional profiling was obtained by reverse transcription-PCR for three of the genes that were upregulated in neutrophils infected with the ssk1 mutant. Also, the sensitivity of strain SSK21 to human defensin-1, one of the nonoxidative, antimicrobial peptides of PMNs, was greater than that of CAF2-1, demonstrating that nonoxidative killing in PMNs may contribute to the increased susceptibility of the ssk1 mutant. Our results indicate that the Ssk1p response regulator protein may provide at least partial adaptive functions for the survival of C. albicans following its encounter with human neutrophils.


arrow
INTRODUCTION
 
Candida albicans is the most common opportunistic fungal pathogen of humans, causing cutaneous, mucocutaneous, and invasive disease in the setting of congenital, induced, or disease-related immune dysfunction. Invasive disease carries a high attributable mortality because of insensitive methods of detection and because of treatment failures (51). In patients with invasive disease, most often a reduction in the number or function of circulating neutrophils is observed (5, 22, 51). Thus, neutrophils represent the most prominent phagocytic leukocyte of the acute inflammatory response that protects against invasive candidiasis. However, an aggressive innate immune response by human polymorphonuclear neutrophils (PMNs) may be responsible for acute and recurrent vulvovaginal candidiasis in humans (19).

Previous studies of neutrophil interactions with C. albicans have demonstrated that killing requires adherence, phagocytosis, mitogen-activated protein (MAP) kinase signal transduction, and the coordinated stimulation of a respiratory burst and lysosomal degranulation (9, 10, 14-16, 33, 47-50, 53, 54, 56). MAP kinase signaling is a complex of several pathways that are critical to controlling microbial growth in human leukocytes. For example, the upstream GTPases Rac and Cdc42 are linked to MAP kinase pathways that regulate the level of lytic granule movement and phagocytosis within PMNs (9). More recently, Zhong et al. probed the intracellular signaling pathways which regulate neutrophil responses to C. albicans and found elevated levels of mitogen-activated protein kinase/extracellular regulatory kinase (MAP kinase/ERK) in human neutrophils incubated for as little as 5 min after infection with the organism (56). This pathway is independent of Ras/Rho activation but instead requires activation through a Rac/Cdc42-dependent p44/42 MAP kinase/ERK. Nonoxidative killing of C. albicans by neutrophil defensins is also well studied (21, 25, 29). The defensins comprise two groups of 29- to 42-amino-acid cationic peptides that are found in high concentrations within neutrophils.

Two-component signal transduction in fungi and bacteria regulates adaptation of cells to stress conditions, in some cases through a quorum-sensing mechanism (3, 28, 41). The two-component signal pathways include sensor, histidine kinase and response regulator proteins (41). In C. albicans there are three histidine kinase proteins (Sln1p, Chk1p, and Nik1p) and two response regulator proteins (Ssk1p and Skn7p) (1, 6-8, 35, 41, 44, 46, 55). A two-component histidine kinase (Fos1p) has also been identified in Aspergillus fumigatus, and strains deleted of the encoding gene are reduced in virulence (13, 37).

Previous studies with the C. albicans response regulator mutant strain SSK21 have demonstrated its avirulence and its sensitivity in vitro to H2O2, menadione, KO2, and t-butyl hydroperoxide (6, 11). Microarray transcriptional profiling of the ssk1 mutant revealed that the regulation of stress-related and cell wall-associated gene-encoded proteins was altered in the mutant (11). Als1p, a known adherence protein of C. albicans, was downregulated in the mutant, which may explain its reduced adherence to human esophageal tissues (4, 32).

To determine if oxidant sensitivity in vitro reflects its ability to survive following phagocytosis, the interaction of the ssk1 deletion mutant (SSK21) with human PMNs was examined.


arrow
MATERIALS AND METHODS
 
Strains and growth conditions. C. albicans strains CAF2-1, SSK21, and SSK23 have been described previously and are listed in Table 1 (6, 20). The ssk1 deletion mutant (strain SSK21) and gene-reconstituted strain (SSK23) were constructed following the Urablaster protocol (20). In addition, strain SSK24, an ssk1/ssk1 mutant but with URA3 integrated into the URA3 locus, was used in some experiments. All strains were maintained by subculture for 2 to 3 weeks on YPD agar medium (1% yeast extract, 2% peptone [BD, Bacto], 2% glucose, 1.5% agar) from frozen stocks and propagated as yeast cells in YPD broth medium at room temperature overnight with shaking.


View this table:
[in this window]
[in a new window]
 
TABLE 1. C. albicans strains used in this study

Reagents. Human defensin-1 (HNP-1), obtained from the American Peptide Co, Inc., Sunnyvale, Calif., was dissolved in water prior to experiments. The anti-MAP kinase rabbit polyclonal antibodies anti-p44/42 and anti-phospho-p42/44 MAP kinase antibody (Thr202/Tyr204); anti-p38 MAP kinase antibody; and anti-phospho-p38 MAP kinase, anti-SAPK/JNK, and a secondary antibody (donkey anti-rabbit immunoglobulin G-alkaline phosphatase conjugate) were obtained from Cell Signaling Tech, Inc., Beverly, Mass.

Construction of SSK24. A PstI/BglII fragment was isolated from plasmid pLUBP. This fragment includes both the C. albicans URA3 and IRO1 genes. Transformation of C. albicans strain SSK22 (ssk1/ssk1 ura3/ura3) with the PstI/BglII fragment was carried out with lithium acetate as described previously (6). URA3-positive clones were selected on YNB medium lacking uridine, and integration of URA3 was confirmed by Southern hybridization (Fig. 1). The probe that was used in the Southern analyses was a 592-bp PCR product (including the 5' URA3 sequence) that was amplified with primer set ura5' TATCCCAGCTACTTCGATTG and ura3' CATCAGTGGGATCATTAG. Genomic DNA from positive clones was digested with EcoRI or BclI and, following electrophoresis, hybridized with the PCR probe mentioned above. Hybridizing bands of 2.0 kb and 3.1 kb were observed as expected with EcoRI and BclI, respectively (Fig. 1).



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 1. Construction of strain SSK24. Strain SSK22 (ssk1/ssk1 ura3/ura3) was transformed with the IRO1-URA3 cassette. Ura+ transformants (ssk1{Delta}/ssk1{Delta}, IRO1-URA3/iro1-ura3{Delta}) were isolated and confirmed by Southern blot hybridization. Top. A restriction map of the URA3-IRO1 gene cassette. The vertical arrows indicate the full-length URA3-IRO1 gene cassette, while the probe used for the Southern hybridizations is indicated by a horizontal arrow beneath the URA3 gene. Bottom. Southern hybridization of SSK22 and SSK24 restricted with either BclI or EcoRI. The probe for the Southerns is as indicated above. The 3-kb (BclI) and 2-kb (EcoRI) fragments are observed in strain SSK24 but not in strain SSK22.

Isolation of human PMNs. Human PMNs were isolated from the peripheral blood of healthy volunteers by dextran sedimentation and centrifugation through lymphocyte separation medium (1.078 ± 0.002 g/ml; Mediatech Cellgro). PMNs were enriched in number by a brief hypotonic lysis of erythrocytes (0.2% NaCl, 30 s). Cells were suspended in RPMI 1640 medium plus 10% fetal bovine serum. These cells were >99% viable as judged by trypan blue dye exclusion.

Fungicidal assays with PMNs. All assays were performed in 14-ml round-bottomed tubes. Strains CAF2-1, SSK21, SSK23, and SSK24 were grown in YPD broth, as described above, and washed twice with phosphate-buffered saline (pH 7.4). For neutrophil killing assays, yeast cells were opsonized with 50% normal human serum (37°C, 30 min). Freshly isolated human PMNs and opsonized Candida cells suspended in RPMI 1640 medium plus 10% fetal bovine serum were mixed at an effector-to-target cell ratio of 50:1 (PMNs/Candida). All cultures were incubated for 2 h at 37°C with gentle shaking. Cell suspensions were then centrifuged, water was added to lyse the neutrophils, and serial dilutions of all strains were performed; 100 µl of each dilution was added to YPD agar plates, and samples were spread over the agar for determinations of CFU after incubation for 24 h at 30°C. The fungicidal assays were done a total of three times, and the percent killing of each strain was calculated by the formula [(CFU without PMNs) – (CFU with PMNs)/(CFU without PMNs)] x 100.

To determine the phagocytosis of each strain, we followed published methods (40). Briefly, microscopic smears of each mixture of PMNs and Candida cells were prepared and stained, and 100 neutrophils were counted per strain. The phagocytosed yeasts of each strain were determined. A total of three phagocytosis experiments were done.

Western blots. CAF2-1 and SSK21 strain C. albicans yeast cells were mixed with human PMNs at an effector-to-target cell ratio of 1:10 (56). As a control, a suspension of C. albicans yeast cells was also prepared and treated as described below. The cell mixtures were pelleted rapidly at 1000 rpm in a microcentrifuge followed by incubation for 5 min, then suspended in 1X sodium dodecyl sulfate sample buffer (0.125 M Tris-HCl, 10% glycerol, 1% sodium dodecyl sulfate, 0.1 M dithiothreitol) at 100°C for 10 min. Cell lysates were centrifuged at 12,000 rpm for 5 min to remove cell debris. Denatured proteins were separated by sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis and transferred to nitrocellulose (100 V; 1 h). Immediately following transfer, the membranes were stained with Ponceau S (0.1% in 5% acetic acid) to confirm equal loading of all lanes. The membranes were blocked with 5% nonfat milk in Tris-buffered saline-0.01% Tween 20 for 1 h, blotted with the specific primary antibody (phosphorylated or nonphosphorylated MAP kinases, p44/42, p38, and JNK) for 2 h, and then reacted with an alkaline phosphatase-conjugated secondary antibody for 1 h. Bands were visualized by incubation with CDP-Star substrate (Bio-Rad) and exposed to Kodak film. These experiments were performed a total of three times each with different cell suspensions and extracts.

Inflammatory response gene expression profiles in infected PMNs. At 30 min after coculture at an effector-to-target cell ratio of 1:10, suspensions of PMNs and C. albicans CAF2-1 or SSK21 were centrifuged and processed as described below. The gene profile of uninfected PMNs was also evaluated to compare responses with and without the fungal strains. Tri-reagent (Sigma) was used to extract total RNA from cells. Microarray analysis of cytokine gene expression was performed according to the manufacturer's instructions (Superarray, Fredrick, Md., S-series). Briefly, 2 µg of total RNA was used as the template for biotin-labeled cDNA probe synthesis. The denatured cDNA probe was used to hybridize a GEArray S series membrane overnight with continuous agitation at 60°C. After washing, the membrane was incubated with alkaline phosphatase-conjugated streptavidin, and then the CDP-Star chemiluminescent substrate was added. Finally, the membrane was exposed to Kodak X-ray film to visualize signals.

To perform data analysis, we used the GE Array Analyzer software, developed by SuperArray Biosciences, to perform pairwise comparisons between the processed arrays. The data from replicate spots per array were subtracted from background (blanks) and normalized with the ACT1 housekeeping gene for all combinations of cell mixtures. Array experiments were done two times, each with different RNA preparations. Data are presented as the increase or decrease in arrays compared to PMNs incubated without C. albicans. Upregulation was considered to be at a ratio of 1.5, while downregulation was ≤0.5.

Reverse transcription-PCR was performed with the reverse transcription-PCR kits (Superarray Inc., Frederick, Md.). RNA was isolated as described above for each cell mixture. First-strand cDNA synthesis was accomplished with 2 µg of total RNA. PCR was performed according to the manufacturer's recommendations (SingleGene PCR kit, Superarray Inc.) in order to determine mRNA levels of interleukin (IL)-8, CDC25A, and CX3CR1. The optical density of each amplicon was determined for semiquantitative analysis and compared to ß-actin, which was used as an internal control. Data are expressed relative to uninfected PMNs.

Superoxide production in infected neutrophils. We followed methods previously described for human monocytes and neutrophils (27, 40). In 96-well microtiter dishes, C. albicans yeast cells (106 per 50 µl) were mixed with neutrophils (105 per 50 µl), each prepared in Hanks' balanced salt solution. In other wells, neutrophils or C. albicans yeast cells were incubated alone. All cell suspensions were incubated for 1 to 2 h at 37°C. Absorbancy units in cocultures of yeasts and neutrophils were corrected for neutrophil- or C. albicans-only controls. O2 was assayed spectrophotometrically by the cytochrome c reduction method as described by Roilides et al. (40). The cell mixtures were incubated at 37°C with 50 µM cytochrome c for 1 h. Subsequently, absorbance was measured at 550 nm, and superoxide anion was then calculated with the extinction coefficient for reduced cytochrome c.

Fungicidal assays with HNP-1. All fungicidal assays were performed in 96-well microtiter plates. For assays with HNP-1, a final concentration of either 4.15 or 8.3 µM was used with yeast cells (105 cells in a total volume of 100 µl of phosphate-buffered saline). All cell suspensions were incubated for 90 min in triplicate at 37°C with gentle shaking. Following incubation, 40 µl was removed from each well, diluted in water, and plated on YPD agar for determinations of viability. The candidacidal activity of HNP-1 for each strain was determined by counting colonies of the organism following incubation on YPD agar for 24 h at 30°C. Results are expressed as killing of each strain with the formula [(CFU without HNP-1) – (CFU with HNP-1)]/(CFU without HNP-1) x 100.

Statistical analysis. One-way analysis of variance and Dunnett's modification for multiple comparisons were used. Differences were considered significant when P was < 0.05.


arrow
RESULTS
 
Killing of C. albicans strains by human PMNs. These experiments were predicated by our observation that the ssk1 mutant of C. albicans is more sensitive than wild-type cells and a gene-reconstituted strain in vitro to hydrogen peroxide, menadione, t-butyl hydroperoxide, and KNO2 (11). Therefore, killing of the ssk1 mutant (SSK21), a gene-reconstituted strain (SSK23), the SSK21 strain reconstituted with URA3 at its locus (SSK24) (Fig. 1), and wild-type cells (CAF2-1) by human PMNs was determined (Fig. 2). We found that that the killing of SSK21 and SSK24 was approximately 43.9 and 42.9%, respectively, compared to the reduced killing of CAF2-1 and SSK23, 18.8 and 22.1%, respectively (P < 0.01 for SSK21 and SSK24 versus CAF2-1 and SSK21 and SSK24 versus SSK23; CAF2-1 = SSK23). The data presented in Fig. 2 represent an average of three experiments with standard deviations indicated.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 2. Killing of C albicans strains CAF2-1 (parental, bar 1), SSK21 (bar 2), SSK24 (bar 3), and SSK23 (bar 4) by human neutrophils. See Table 1 for the genotypes of each strain. SSK21 and SSK24 versus CAF2-1, P < 0.01; SSK21 and SSK24 versus SSK23, P < 0.01; CAF2-1 = SSK23. Data represent averages for three experiments.

The killing by PMNs was not due to differences in the phagocytosis of each strain since approximately 30% of CAF2-1, SSK24, and SSK21 cells were phagocytosed (data not shown). While significantly greater killing was observed in neutrophils infected with the ssk1 mutant (strain SSK21), total superoxide production by neutrophils was similar when infected with either CAF2-1 or SSK21 (Fig. 3).



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 3. Production of O2 by neutrophils infected with CAF2-1 or SSK21. P = neutrophils only; P+C = neutrophils infected with CAF2-1; P+21 = neutrophils infected with SSK21.

MAP kinase signaling in infected neutrophils. Phosphorylation of the MAP kinases p44/42 and p38 was evaluated in PMNs infected with either CAF2-1 or SSK21 in order to determine if the increased killing of SSK21 was associated with signaling events. Unphosphorylated p44/42 and p38 (a loading control) were measured from each sample with a polyclonal antibody to each protein (Fig. 4, lower set of Western blots). Then, the blots were stripped and reacted with polyclonal antibodies to each phosphorylated protein (Fig. 4, upper set of Western blots). Our results indicated that these proteins were not phosphorylated in uninfected PMNs (Fig. 4). When PMNs were infected, phosphorylation of p44/42 and p38 MAP kinases was observed, although there were no apparent differences in signal intensity in PMNs infected with either strain (Fig. 4, upper set of Western blots, compare P+C and P+21). Similar studies were done to measure phosphorylation of the JNK MAP kinase, but we could not detect a signal in any of the cell mixtures (data not shown). As a control, we performed Western blots with C. albicans cells incubated alone with the antibodies described above, but no phosphorylation signal was detected with proteins of each strain (data not shown).



View larger version (56K):
[in this window]
[in a new window]
 
FIG. 4. MAP kinase activation of PMNs cultured with strains of C albicans. Human neutrophils (P) were cocultured with yeast cells of strain CAF2-1 (P+C) or SSK21 (P+21) for 5 min; proteins were extracted, separated by SDS-PAGE, and transferred for Western blotting with polyclonal antibodies to the unphosphorylated MAP kinases p38 and p44/42 (lower Western blot profiles). Then, the blots were stripped and reacted with monoclonal antibodies (anti-phospho-p44/42 or anti-phospho-p38) to each MAP kinase (upper Western blot profiles). Both proteins were phosphorylated in neutrophils infected with either strain of C. albicans (P+C and P+21) but not in uninfected neutrophils. Phosphorylated proteins also were not detected in extracts of C. albicans cells incubated without neutrophils (not shown). These experiments were done three times with similar results.

Inflammatory gene expression profiles in infected neutrophils. The expression of approximately 385 inflammatory response genes was compared in PMNs infected with either CAF2-1 (wild type) or SSK21 (ssk1 mutant) cells relative to PMNs incubated without the Candida strains. Five categories of genes were examined, including those that encoded cell surface factors, transcription factors, response genes, signal transduction, and chemokines and chemokine receptors. The increase in expression of genes for each cell suspension was calculated as [(CAF2-1 + PMN)/PMN] or [(SSK21 + PMN)/PMN]. Data were normalized to ACT1 for each cell suspension, including PMNs incubated without Candida. The changes that occurred in expression were consistent for both array analyses, but of the total genes measured, only seven were upregulated in the SSK21 mutant compared to wild-type-infected PMNs (Table 2).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Microarray analysis of inflammatory gene response from PMNs infected with CAF2-1 or SSK21

Expression of the cell surface receptors E-selectin and L-selectin, the signal transduction protein CDC25A, the chemokines MIP-2a and CX3CR1, and the cytokines IL-8 and 4-1BB increased in PMNs infected with strain SSK21 compared to PMNs infected with CAF2-1 cells, while an increase in the cytokine IL-10 was observed in PMNs infected with both strains. Microarray data for the top three genes that were upregulated in neutrophils infected with SSK21 were verified by reverse transcription-PCR (Fig. 5). We observed increases in mRNA amounts in neutrophils infected with strain SSK21 of approximately 3.5-fold (IL-8), 2.5-fold (CX3CR1), and 3-fold (CDC25A) compared to neutrophils infected with CAF2-1.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 5. Reverse transcription-PCR analysis of IL-8, CX3CR1, and CDC25A transcription. Transcription was performed with the Superarray reverse transcription-PCR kit. Expression was normalized by establishing the luminosity of ß-actin as a standard for each sample. Data are expressed relative to uninfected neutrophils (relative value of 1.0). P = neutrophils only; P+C = neutrophils infected with CAF2-1; P+21 = neutrophils infected with SSK21.

Killing of C. albicans strains by HNP-1. The increased killing of strain SSK21 by human PMNs could be due in part to nonoxidative mechanisms. To test this, we compared the killing of the same strains used in the neutrophil experiments by HNP-1 (Table 3). The ssk1 mutant (SSK21) was killed to a significantly greater extent than CAF2-1 or SSK23 at a concentration of 8.3 µM of HNP-1 (defensin-1). Even at a concentration of 4.15 µM, the mutant was killed more than CAF2-1 (Table 3). The killing of strain SSK23 was similar to CAF2-1 at each concentration of HNP-1. The sensitivity of the mutant to HNP-1 does not indicate a general change in uptake of compounds by the SSK23, since this strain has the same sensitivity as wild-type cells to a number of antifungal drugs and other inhibitors (11).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Effect of HNP-1 on killing of C. albicansa


arrow
DISCUSSION
 
We show that SSK1 of C. albicans, which encodes a putative two-component signal transduction response regulator protein, is important to the survival of C. albicans in human PMNs. Most likely, this protein regulates adaptation of the organism to oxidative stress through the HOG1 (hypersomotic glycerol) MAP kinase signal transduction pathway, as in previous studies we showed that Ssk1p phosphorylates Hog1p during oxidant stress (11). The role of Ssk1p in the adaptation to oxidant stress has also been demonstrated by microarray analysis, since an upregulation of genes associated with oxidant adaptation in the mutant occurred (11). Furthermore, the mutant is less adherent to human esophageal tissue in vitro, and, interestingly, transcriptional profiling indicates that genes encoding cell wall functions (ALS1, CHK1, MNN4, and FLO1) are altered compared to CAF2 (11). Als1p, a cell surface glycoprotein that provides an adherence function for C. albicans (26), is downregulated in the mutant; that observation may explain the decreased levels of adherence by this strain (4, 32). The apparent multiple functions (adherence and oxidant and nonoxidant adaptation) are not unexpected given the cross-talk that occurs among signal transduction systems (30). For example, Ssk1p negatively regulates the histidine kinase Chk1p, which may not be a protein of the HOG1 MAP kinase pathway (31).

Importantly, the current studies also demonstrate that the phenotype of the ssk1 mutant (increased killing by human PMNs) is due to the ssk1 gene deletion and not a consequence of a URA3 positional effect, since strain SSK24, an ssk1 mutant but with URA3 integrated at its own locus, is phenotypically similar to strain SSK21 which is an ssk1 mutant with the URA3 gene located in the SSK1 locus (6). Phenotypic changes associated with URA3 positional effects have been described in C. albicans following construction of deletion mutants with the Urablaster procedure (12).

We attempted to determine the mechanism(s) by which the ssk1 mutant is killed more significantly by human PMNs than wild-type cells. Along with the sensitivity of the mutant to H2O2, menadione, and defensin HNP-1, transcriptional profiling of PMNs infected with the ssk1 mutant indicated an upregulation of several inflammatory response genes compared to PMNs infected with wild-type cells. Of the genes that were upregulated, IL-8 (or its receptor) has been shown to play an important role in protection against some forms of candidiasis (2, 17, 18, 42, 43). IL-8 also plays an important role in neutrophil phagocytosis of Aspergillus fumigatus in vitro and protection against paracoccidioidomycosis (36, 39, 52). Similarly, the L- and E-selectin genes have also been shown to be important in immunity to systemic candidiasis (34). Expression data of other investigations did not always correlate with our PMN array analysis. For example, both IL-17 and IL-2 are thought to be required for protection against systemic candidiasis, but the expression of these gene products was unchanged in our studies (23, 38, 45). IL-10 has been shown to inhibit phagocytosis and hyphal killing of human neutrophils, while in our study IL-10 levels were similar in wild-type- and mutant-infected PMNs (40).

While the killing of C. albicans SSK21 compared to CAF2-1 is associated with several PMN inflammatory gene products, phosphorylation of PMN MAP kinase proteins and superoxide production by neutrophils was similar for both the wild-type and mutant strains. Data by other groups indicate that p44/42 but not p38 MAP kinase activity is required for phagocytosis and is associated with PMN killing of C. albicans (56). Interestingly, a mouse macrophage cell line that was ineffective in killing C. albicans did not process signal transduction events via the p38 MAP kinase (24). Perhaps the lack of killing in macrophages in comparison to PMNs which are more candidacidal is in part due to differences in signaling among the two phagocytes. In our experiments, we detected phosphorylated p44/42 and p38 but failed to detect a signal with the JNK/MAP kinase. Thus, it is possible the JNK pathway plays a minor role in the candidacidal activity of PMNs. In conclusion, our data establish a role for the Ssk1p response regulator protein in the survival of C. albicans confronted with human PMNs.


arrow
ACKNOWLEDGMENTS
 
Public Heath Service grant NIH-NIAID-43465 to R.C. supported this research.

We thank William Fonzi of Georgetown University for providing plasmid pLUBP.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, Georgetown University Medical Center, 312 SE Med Dent Building, 3900 Reservoir Rd., NW, Washington, DC 20057-2197. Phone: (202) 687-1137. Fax: (202) 687-1800. E-mail: calderor{at}georgetown.edu. Back

Editor: T. R. Kozel


arrow
REFERENCES
 
    1
  1. Alex, L. A., C. Korch, C. P. Selitrennikof, and M. I. Simon. 1998. COS1, a two-component histidine kinase that is involved in hyphal development in the opportunistic pathogen Candida albicans. Proc. Natl. Acad. Sci. USA 95:7069-7073.[Abstract/Free Full Text]
  2. 2
  3. Balish, E., R. D. Wagner, A. Vazquez-Torres, J. Jones-Carson, C. Pierson, and T. Warner. 1999. Mucosal and systemic candidiasis in IL-8Rh-/- BALB/c mice. J. Leukoc. Biol. 66:144-150.[Abstract]
  4. 3
  5. Barrett, J. F., and J. A. Hoch. 1998. Two-component signal transduction as a target for microbial anti-infective therapy. Antimicrob. Agents Chemother. 42:1529-1536.[Free Full Text]
  6. 4
  7. Bernhardt, J., D. Herman, M. Sheridan, and R. Calderone. 2001. Adherence and invasion studies of Candida albicans strains utilizing in vitro models of esophageal candidiasis. J. Infect. Dis. 184:1170-1175.[CrossRef][Medline]
  8. 5
  9. Calderone, R. 2002. The biology of Candida species, p. 15-28. In R. Calderone (ed.), Candida and candidiasis. ASM Press, Washington, D.C.
  10. 6
  11. Calera, J. A., X-J. Zhao, and R. Calderone. 2000. Defective hyphal development and avirulence caused by a deletion of the SSK1 response regulator gene in Candida albicans. Infect. Immun. 68:518-525.[Abstract/Free Full Text]
  12. 7
  13. Calera, J. A., G. Cho, and R. A. Calderone. 1998. Identification of a putative histidine kinase two-component phosphorelay gene (CaCHK1) in Candida albicans. Yeast 14:665-674.[CrossRef][Medline]
  14. 8
  15. Calera, J. A., and R. A. Calderone. 1999. Identification of a putative response regulator, two-component phosphorelay gene (CaSSK1) from Candida albicans. Yeast 15:1243-1254.[CrossRef][Medline]
  16. 9
  17. Caron, E., and A. Hall. 1998. Identification of two distinct mechanisms of phagocytosis controlled by different Rho GTPases. Science 282:1717-1721.[Abstract/Free Full Text]
  18. 10
  19. Charles, S. T. H., S. Kathryn, M. Nahid, W. Andrew, and F. Antonio. 1999. Role of the extracellular signal-regulated protein kinase cascade in human neutrophil killing of Staphylococcus aureus and Candida albicans and in migration. Infect. Immun. 67:1297-1302.[Abstract/Free Full Text]
  20. 11
  21. Chauhan, N., D. Inglis, E. Roman, J. Pla, D. Li, J. A. Calera, and R. Calderone. 2003. Candida albicans response regulator gene SSK1 regulates a subset of genes whose functions are associated with cell wall biosynthesis and adaptation to oxidative stress. Eukaryot. Cell 2:1018-1024.[Abstract/Free Full Text]
  22. 12
  23. Cheng, S., M. H. Nguyen, Z. Zhang, H. Jia, M. Handfield, and C. J. Clancy. 2003. Evaluation of the roles of four Candida albicans genes in virulence by using gene disruption strains that express URA3 from the native locus. Infect. Immun. 71:6101-6103.[Abstract/Free Full Text]
  24. 13
  25. Clemons, K., T. K. Miller, C. Selitrennikoff, and D. Stevens. 2002. fos-1, a putative histidine kinase as a virulence factor for systemic aspergillosis. Med. Mycol. 40:259-263.[Medline]
  26. 14
  27. Cockayne, A., and F. C. Odds. 1984. Interactions of Candida albicans yeast cells, germ tubes and hyphae with human polymorphonuclear leukocytes in vitro. J. Gen. Microbiol. 130:465-471.[Abstract/Free Full Text]
  28. 15
  29. Cohen, M. S. 1994. Molecular events in the activation of human neutrophils for microbial killing. Clin. Infect. Dis. 18(Suppl. 2):S170-S179.
  30. 16
  31. Cox, D., P. Chang, Q. Zhang, P. G. Reddy, G. M. Bokoch, and S. Greenberg. 1997. Requirements for both Rac1 and Cdc42 in membrane ruffling and phagocytosis in leukocytes. J. Exp. Med. 186:1487-1494.[Abstract/Free Full Text]
  32. 17
  33. Dongari-Bagtzoglou, A., and H. Kashleva. 2003. Candida albicans triggers interleukin-8 secretion by oral epithelial cells. Microb. Pathog. 34:169-177.[CrossRef][Medline]
  34. 18
  35. Dongari-Bagtzoglou, A., K. Wen, and I. B. Lamster. 1999. Candida albicans triggers interleukin-6 and interleukin-8 responses by oral fibroblasts in vitro. Oral Microbiol. Immunol. 14:364-370.[CrossRef][Medline]
  36. 19
  37. Fidel, P. L., M. Barousse, T. Espinosa, M. Ficarra, J. Sturtevant, D. martin, A. J. Quayle, and K. Dunlap. 2004. An intravaginal live Candida challenge in humans leads to new hypotheses for the immunopathogenesis of vulvovaginal candidiasis. Infect. Immun. 72:2939-2946.[Abstract/Free Full Text]
  38. 20
  39. Fonzi, W. A., and M. Y. Irwin. 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717-728.[Abstract]
  40. 21
  41. Ganz, T., M. Selsted, and R. I. Lehrer. 1990. Defensins. Eur. J. Haematol. 44:1-8.[Medline]
  42. 22
  43. Glauser, M. P. 2000. Neutropenia: clinical implications and modulation. Intensive Care Med. 26:S103-110.
  44. 23
  45. Huang, W., L. Na, P. Fidel, and P. Schwarzenberger. 2004. Requirement of interleukin-17A for systemic anti-Candida albicans host defense in mice. J. Infect. Dis. 190:624-631.[CrossRef][Medline]
  46. 24
  47. Ibata-Ombetta, S., T. Jouault, P-A Trinel, and D. Poulain. 2001. Role of extracellular signal-regulated protein kinase cascade in macrophage killing of Candida albicans. J. Leukoc. Biol. 70:149-154.[Abstract/Free Full Text]
  48. 25
  49. Kagan, B. L. T. Ganz, and R. I. Lehrer. 1994. Defensins: a family of antimicrobial and cytotoxic peptides. Toxicology 87:131-141.[CrossRef][Medline]
  50. 26
  51. Kapteyn, J. C., L. L. Hoyer, J. E. Hecht, W. H. Muller, A. Andel, A. J. Verkleij, M. Makarow, H. Van. Den Ende, and F. M. Klis. 2000. The cell wall architecture of Candida albicans wild-type cells and cell wall-deficient mutants. Mol. Microbiol. 35:601-611.[CrossRef][Medline]
  52. 27
  53. Katsifa, H., S. Tsaparidou, E. Diza, C. Gil-Lamaignere, T. J. Walsh, and T. J. Roilides. 2001. Effects of interleukin-13 on antifungal activity of human monoctes against Candida albicans. FEMS Immunol. Med. Microbiol. 31:211-217.[Medline]
  54. 28
  55. Koretke, K. K. A. N. Lupas, P. V. Warren, M. Rosenberg, and J. R. Brown. 2000. Evolution of two-component signal transduction. Mol. Biol. Evol. 17:1956-1970.[Abstract/Free Full Text]
  56. 29
  57. Lehrer, R. I., T. Ganz, D. Szklarek, and M. E. Selsted. 1988. Modulation of the in vitro candidacidal activity of human neutrophil defensins by target cell metabolism and divalent cations. J. Clin. Investig. 81:1829-1833.
  58. 30
  59. Lengeler, K. B., R. C. Davidson, C. D'Souza, T. Harashima, W.-C. Shen, P. Wang, X. Pan, M. Waugh, and J. Heitman. 2000. Signal transduction cascades regulating fungal development and virulence. Microbiol. Mol. Biol. Rev. 64:746-785.[Abstract/Free Full Text]
  60. 31
  61. Li, D, V. Gurkovska, M. Sheridan, R. Calderone, and N. Chauhan. Studies on the regulation of the two component histidine kinase gene CHK1 in Candida albicans using the heterologous lacZ-reporter gene. Microbiology 150:3305-3313.
  62. 32
  63. Li, D., J. Bernhardt, and R. Calderone. 2002. Temporal expression of the Candida albicans genes CHK1 and CSSK1, adherence, and morphogenesis in a model of reconstituted human esophageal epithelial candidiasis. Infect Immun. 70:1558-1565.[Abstract/Free Full Text]
  64. 33
  65. Mocsai, A., Jakus, Z., Vantus, T., Berton, G., Lowell, C. A., and E. Ligeti. 2000. Kinase pathways in chemoattractant-induced degranulation of neutrophils: the role of p38 mitogen-activated protein kinase activated by Src family kinases. J. Immunol. 164:4321-4331.[Abstract/Free Full Text]
  66. 34
  67. Moroll, S., M. Goodchild, N. Salmon, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, N. Bumstead, and Y. Boyd. 2001. The genes encoding E-selectin (SELE) and lymphotactin (SCYC1) lie on separate chicken chromosomes although they are closely linked in human and mouse. Immunogenetics 53:477-482.[CrossRef][Medline]
  68. 35
  69. Nagahashi, S., T. Mio, N. Ono, T. Yamada-Okabe, M. Arisawa, H. Bussey, and H. Yamada-Okabe. 1998. Isolation of CaSLN1 and CaNIK1, the genes for osmosensing histidine kinase homologues, from the pathogenic fungus Candida albicans. Microbiology 144:425-432.[Abstract/Free Full Text]
  70. 36
  71. Peracoli, M. T., C. S. Kurokawa, S. A. Calvi, R. P. Mendes, P. C. Perrira, S. A. Marques, and A. M. Soares. 2003. Production of pro- and anti-inflammatory cytokines by monocytes from patients with paracoccidioidomycosis. Microbes Infect. 5:413-418.[CrossRef][Medline]
  72. 37
  73. Pott, G. B., T. K. Miller, J. A. Bartlett, J. S. Palas, and C. P Selitrennikoff. 2000. The isolation of FOS-1, a gene encoding a putative histidine kinase from Aspergillus fumigatus. Fungal Genet. Biol. 31:55-67.[CrossRef][Medline]
  74. 38
  75. Punzon, C., S. Resino, J. Bellon, M. Munoz-Fernandez, and M. Fresno. 2002. Analysis of the systemic response in HIV-1-infected patients suffering from opportunistic Candida infection. Eur. Cytokine Netw. 13:215-223.[Medline]
  76. 39
  77. Richardson, M. D., and M. Patel. 1995. Stimulation of neutrophil phagocytosis of Aspergillus fumigatus conidia by interleukin-8 and N-formylmethionyl-leucylphenylalanine. J. Med. Vet. Mycol. 33:99-104.[Medline]
  78. 40
  79. Roilides, E., H. Katsifa, S. Tsaparidou, T. Sterigiopoulou, C. Panteliadis, and T. Walsh. Interleukin 10 suppresses phagocytic and anti-hyphal activities of human neutrophils. Cytokine 12:379-387.
  80. 41
  81. Santos, J. L., and K. Shiozaki. 2001. Fungal histidine kinases. Sci. STKE 98:1-14.
  82. 42
  83. Schaller, M., R. Mailhammer, and H. C. Korting. 2002. Cytokine expression induced by Candida albicans in a model of cutaneous candidosis on reconstituted human epidermis. J. Med. Microbiol. 51:672-676.[Abstract/Free Full Text]
  84. 43
  85. Schaller. M., R. Mailhammer, G. Grassl, C. A. Sander, B. Hube, and H. C. Korting. 2002. Infection of human oral epithelia with Candida species induces cytokine expression correlated to the degree if virulence. J. Investig. Dermatol. 118:652-657.[CrossRef][Medline]
  86. 44
  87. Selitrennikoff, C. P., L. Alex, T. K. Miller, K. V. Clemons, M. I. Simon, and D. A. Stevens. 2001. COS-1, a putative two-component histidine kinase of Candida albicans, is an in vivo virulence factor. Med. Mycol. 39:69-75.[Medline]
  88. 45
  89. Spaccapelo, R., G. Del Sero, P. Mosci, F. Bistoni, and L. Romani. 1997. Early T cell unresponsiveness in mice with candidiasis and reversal by IL-2; effect of T helper cell development. J. Immunol. 158:2294-2302.[Abstract]
  90. 46
  91. Srikantha, T., L. Tsai, K. Daniels, L. Enger, K. Highley, and D. R. Soll. 1998. The two-component hybrid kinase regulator CaNIK1 of Candida albicans. Microbiology 144:2715-2729.[Abstract/Free Full Text]
  92. 47
  93. Subrahmanyam, V. V. B. K., S. Yamaga, Y. Prashar, H. H. Lee, N. P. Hoe, Y. Kluger, M. Gerstein, J. D. Goguen, P. E. Newburger, and S. M. Weissman. 2001. RNA expression patterns change dramatically in human neutrophils exposed to bacteria. Blood 97:2457-2468.[Abstract/Free Full Text]
  94. 48
  95. Sweeney, J. F., A. S. Rosemurgy, S. Wei, and J. Y. Djeu. Impaired polymorphonuclear leukocyte anticandidal function in injured adults with elevated Candida antigen titers. Arch. Surg. 128:40-45.
  96. 49
  97. Vasquez-Torres, A., J. Jones-Carson, and E. Balish. 1996. Peroxynitrite contributes to the candidicidal activity of nitric oxide-producing macrophages. Infect. Immun. 64:3127-3133.[Abstract]
  98. 50
  99. Vecchiarelli, A., C. Monari, F. Baldelli, D. Pietrella, C. Retini, C. Tascini, D. Francisci, and F. Bistoni. 1995. Beneficial effect of recombinant human granulocyte colony-stimulating factor on fungicidal activity of polymorphonuclear leukocytes from patients with AIDS. J. Infect. Dis. 171:1448-1454.[Medline]
  100. 51
  101. Wenzel, R. P. 1995. Nosocomial candidiasis: risk factors and attributable mortality. Clin. Infect. Dis. 20:1531-1534.[Medline]
  102. 52
  103. Winn, R. M., C. Gil-Lamaignere, E. Roilides, M. Simitsopoulou, C. A. Lyman, A. Maloukou, and T. J. Walsh. Selective effects of interleukin (IL)-15 on antifungal activity and IL-8 release by polymorphonucelar leukocytes in response to hyphae of Aspergillus sp. J. Infect. Dis. 188:585-590.
  104. 53
  105. Wright, C. D., J. U. Bowie, G. R. Gray, and R. D. Nelson. 1983. Candidicidal activity of myeloperoxidase: mechanisms of inhibitory influence of soluble cell wall mannan. Infect. Immun. 42:76-80.[Abstract/Free Full Text]
  106. 54
  107. Wysong, D. R., C. A. Lyman, and R. D. Diamond. 1989. Independence of neutrophil respiratory burst oxidant generation from the early cytosolic calcium response after stimulation with unopsonized Candida albicans hyphae. Infect. Immun. 57:1499-1505.[Abstract/Free Full Text]
  108. 55
  109. Yamada-Okabe, T., T. Mio, T. Ono, Y. Kashima, M. Arisawa, and Y. Yamada-Okabe. 1999. Roles of three histidine kinase genes in hyphal development and virulence of the pathogenic fungus Candida albicans. J. Bacteriol. 181:7243-7247.[Abstract/Free Full Text]
  110. 56
  111. Zhong, B., K. Jiang, L. Danielle, et al. 2003. Human neutrophils utilize a Rac/Cdc42-dependent MAP kinase pathway to direct intracellular granule mobilization toward ingested microbial pathogens. Blood 101:3240-3248.[Abstract/Free Full Text]


Infection and Immunity, February 2005, p. 865-871, Vol. 73, No. 2
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.2.865-871.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Chauhan, N., Calderone, R. (2008). Two-Component Signal Transduction Proteins as Potential Drug Targets in Medically Important Fungi. Infect. Immun. 76: 4795-4803 [Full Text]  
  • Jones, C. A., Greer-Phillips, S. E., Borkovich, K. A. (2007). The Response Regulator RRG-1 Functions Upstream of a Mitogen-activated Protein Kinase Pathway Impacting Asexual Development, Female Fertility, Osmotic Stress, and Fungicide Resistance in Neurospora crassa. Mol. Biol. Cell 18: 2123-2136 [Abstract] [Full Text]  
  • Monge, R. A., Roman, E., Nombela, C., Pla, J. (2006). The MAP kinase signal transduction network in Candida albicans.. Microbiology 152: 905-912 [Abstract] [Full Text]  
  • Roman, E., Nombela, C., Pla, J. (2005). The Sho1 Adaptor Protein Links Oxidative Stress to Morphogenesis and Cell Wall Biosynthesis in the Fungal Pathogen Candida albicans. Mol. Cell. Biol. 25: 10611-10627 [Abstract] [Full Text]  
  • Barousse, M. M., Espinosa, T., Dunlap, K., Fidel, P. L. Jr (2005). Vaginal Epithelial Cell Anti-Candida albicans Activity Is Associated with Protection against Symptomatic Vaginal Candidiasis. Infect. Immun. 73: 7765-7767 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Du, C.
Right arrow Articles by Li, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Du, C.
Right arrow Articles by Li, D.