Previous Article | Next Article ![]()
Infection and Immunity, March 2005, p. 1771-1778, Vol. 73, No. 3
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.3.1771-1778.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Unité de Pathogénie Microbienne Moléculaire,1 Unité de Biologie Cellulaire du Parasitisme, INSERM U389,5 Unité d'Histotechnologie et Pathologie,3 Plateforme d'Imagerie Dynamique, Institut Pasteur, Paris,4 Laboratoire de Biologie et Contrôle des Organismes Parasites, UPRES 398-IFR 75, Faculté de Pharmacie, Université Paris-Sud, Chatênay-Malabry, France2
Received 21 June 2004/ Returned for modification 12 August 2004/ Accepted 11 November 2004
|
|
|---|
|
|
|---|
Entamoeba histolytica, the etiological agent of human amoebiasis, colonizes the large bowel. Parasite invasion of the intestinal epithelium is characterized by extensive degradation of the extracellular matrix by amoebic secreted proteases, human cell cytolysis, and phagocytosis. Highly motile trophozoites gain access to the bloodstream in the region of ulcer formation and eventually disseminate to other organs, causing most commonly amoebic liver abscesses (ALA) (22). A central contributor in E. histolytica pathogenesis is the highly effective actomyosin cytoskeleton, which allows fast morphological changes associated with amoebic motility and spatial reorganization of cellular components (6). Production of the light meromyosin (LMM) moiety of the myosin II heavy chain in genetically engineered trophozoites (strain LMM) was shown to strongly reduce cell motility in vitro and in vivo, to affect the retrograde motion of amoebic surface molecules, and to abolish cytotoxicity when organisms were incubated in the presence of epithelial cells (2, 4).
The coordinated action of the E. histolytica cytoskeleton and surface adhesion molecules is essential for pathogenesis (25). The major adhesion molecule of the parasite is the immunodominant galactose/N-acetylgalactosamine (Gal/GalNAc) inhibitable lectin (17, 21). The Gal/GalNAc lectin plays a central role in adhesion of the trophozoite to intestinal mucins and to enterocytes (27) and has been shown to be a major virulence factor (21). This lectin is a 260-kDa heterodimeric complex composed of a light subunit (Lgl) and a heavy subunit (Hgl) bound by disulfide bonds (20). The two known isoforms of Lgl (31 and 35 kDa) are extracellular and undergo different posttranslational modifications; the 31-kDa subunit has a carboxyl-terminal acyl-glycosylphosphatidylinositol anchor that probably attaches it to the plasma membrane, while the 35-kDa subunit does not have the glycolipid but undergoes more extensive glycosylation (17, 18). Studies with genetically engineered trophozoites showed that Lgl is required for E. histolytica virulence and plays a role in parasite adhesion and killing of host cells (1, 10). The various Hgl isoforms are integral membrane proteins with a short cytoplasmic domain (Fig. 1) (15, 24). Production of the lectin heavy-chain cytoplasmic domain from either the Hgl2 (strain HGL-2) or Hgl3 (strain HGL-3) isoform that is anchored to the membrane through the transmembrane segment has a dominant negative effect and reduces significantly the adhesion of amoebae to epithelial cells (29; this study). Furthermore, strain HGL-2 has normal motility in vitro but is immobile when it is injected into the liver (4).
![]() View larger version (18K): [in a new window] |
FIG. 1. pHgl2SP-TM-COO. (a) Schematic representation of Hgl2SP-TM-COO aligned with the hgl2 nucleotide sequence. The amino acid sequence of Hgl2SP-TM-COO is represented by black (signal peptide [SP]) and grey thick lines at the top. The deleted region of Hgl-2 (dotted line) was replaced by a FLAG tag. The central bar represents hgl2. The patterns identify distinct features based on analysis of the translated sequence (C-W, cysteine and tryptophan rich; C-free, low cysteine content; C-rich, high cysteine content; TM, transmembrane; CD, cytoplasmic domain) (15, 24). Restriction sites relevant for the cloning procedure (4) are indicated below the sequence (B, BamHI; E, EcoRI; K, KpnI; N, NcoI); the BamHI and KpnI sites in parentheses were generated by the sequence of the oligonucleotides used for PCR of the hgl2 coding region to allow directed cloning into identical sites of the vector pExEhNeo (4). (b) Sequence of the Hgl2 putative transmembrane region and cytoplasmic domain. Amino acid differences between the Hgl2 (24) and Hgl3 (15) isoforms are indicated, and four residues implicated in adhesion to epithelial cells are enclosed in boxes (29).
|
|
|
|---|
and BL21DE3(pLysS) were used for cloning procedures and overproduction of the His6-Hgl3TM-COO fusion peptide, respectively. E. histolytica strain HM1:IMSS was cultivated axenically in TYI-S-33 (5). Virulent HM1:IMSS trophozoites (referred to as strain HM1 or the wild-type strain below) derived from a single culture that was axenized after passage through hamster liver (23) were transfected by electroporation with the control vector pExEhNeo (7), and its derived constructs were used for production of LMM (2) and Hgl2SP-TM-COO (Fig. 1) (4). The engineered strains designated LMM and HGL-2 were maintained in the presence of 10 µg of G418 (Gibco-BRL) per ml and were frozen at 80°C for long-term storage. Before each experiment the concentration of drug was increased to 30 µg/ml for 48 h. Production of LMM and of the Hgl carboxyl-terminal region was checked by Western blotting of trophozoite extracts after transfection and regularly thereafter. New transfections were carried out before each series of hamster infestations. Adhesion of trophozoites to monolayers of polarized Caco-2 cells grown to confluence for 14 days and fixed with 5% formaldehyde was quantified as described previously (19). Adhesion tests were carried out in the presence of 200 mM glucose or 200 mM galactose.
Production and purification of the cytoplasmic tail of the Gal/GalNAc lectin in E. coli. The DNA fragment coding for the putative transmembrane segment and cytoplasmic tail of Hgl3 (coordinates 3736 to 3940 in GenBank accession no. L14815) (15) was amplified by PCR by using oligonucleotides 5'CGCGGATCCGTTGGAGCTATTGCAGCGG (coding strand) and 5'CGGGATCCCTGCAGCTTATCCATTGAATGTTGCTGC (noncoding strand) (the sequence homologous to hgl3 is indicated by boldface type; the BamHI and PstI sites are underlined). The purified PCR fragment (approximately 310 bp) was cleaved with BamHI/PstI and ligated to vector pRSET A (Invitrogen) digested with the same endonucleases. The correctness of the construction was checked by restriction analysis, and the recombinant plasmid was inserted by transformation into E. coli BL21DE3(pLysS) for overproduction of the His6-Hg13TM-COO fusion peptide.
A 1-liter culture of the strain overproducing His6-Hgl3TM-COO was grown at 37°C to a density of approximately 108 CFU/ml and induced with 5 mM isopropyl-ß-D-thiogalactopyranoside (IPTG). After 2 h the cells were sedimented, washed with cold medium, and resuspended in 20 ml of lysis buffer (20 mM HEPES-KOH [pH 7.6], 500 mM KCl, 1.5% [wt/vol] Sarkosyl) freshly supplemented with 0.5 mg of lysozyme per ml, 1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride (Sigma), and 10 mM leupeptin (Sigma). All subsequent manipulations were carried out at 4°C. Cells were lysed by sonication (four 15-s pulses with 15-s intervals between pulses), and cell debris was eliminated by centrifugation at 18,000 x g for 1 h. The supernatant was added to 3 ml of cobalt affinity matrix (Talon; Clontech), which was previously equilibrated with lysis buffer, and mixed for 1 h in a rotating wheel. The resin was allowed to settle by gravity and washed twice with lysis buffer (15 min each), and this was followed by two stringent washes (30 min each) with lysis buffer containing 10 mM imidazole. His6-Hgl3TM-COO was eluted with 500 mM imidazole in lysis buffer, which yielded a peptide that was more than 90% pure (data not shown). The fusion peptide was used to immunize rabbits for production of polyclonal antibodies. The serum obtained recognized the carboxyl terminus of both Hgl2 and Hgl3.
Parasite immunostaining and confocal microscopy. Trophozoites grown to approximately 80% saturation in 25-cm2 bottles were washed and resuspended in 6 ml of Dulbecco modified Eagle medium (DMEM) prewarmed to 37°C by gentle tapping in the bottle. The trophozoite suspension was divided into aliquots and mixed with DMEM containing glucose (or galactose in control experiments, as specified below) at a final concentration of 200 mM. Trophozoites were counted, and 1 x 105 to 2 amoebae were added to Caco-2 cells grown for 14 days in coverslips previously washed twice with DMEM lacking serum. Cocultures were incubated for 30 min at 37°C under 10% CO2. The medium was carefully decanted, and the coculture was fixed for 30 min at 37°C with 3.7% paraformaldehyde prepared in phosphate-buffered saline. Cells were permeabilized for 3 min with 0.1% Triton X-100 in phosphate-buffered saline. Immunolabeling with the anti-lectin monoclonal antibody CD6 (12) visualized with the secondary anti-monoclonal antibody coupled to Cy3 (Molecular Probes) and staining of filamentous actin with phalloidin-fluorescein isothiocyanate (1:25 dilution; Sigma) were carried out as described previously (2, 16, 26). Fluorescent samples were observed with a confocal laser scanning microscope (16, 26). Optical sections were acquired on serial planes (0.5 µm) starting from top of the epithelial cell monolayer that contacted the amoebae to at least two-thirds of the trophozoite height.
Animal model experiments. Intraportal infestation of male Syrian golden hamsters (Mesocricetus auratus) with wild-type or engineered strains of E. histolytica, animal dissection, histological analysis, and quantitative analysis of inflammatory foci were carried out as described previously (23). The significance of statistical differences was assessed by using the method of Fisher. The production of LMM and of the Hgl C-terminal region in trophozoites recovered from liver abscesses was checked by Western blotting by using a monoclonal antibody against the vesicular stomatitis virus epitope (2) and the rabbit polyclonal serum against His6-Hgl3TM-COO (this study).
|
|
|---|
Production of the carboxyl-terminal domain of myosin II (LMM fragment), which is involved in association of this mechanochemical enzyme, has a dominant negative effect on the activity of the cell actomyosin cytoskeleton (2, 3). E. histolytica trophozoites transfected with a construct express the LMM coding region so that the ratio of LMM protein fragment to myosin II is
4:1 (strain LMM) (2). The amoebae have low motility, are not cytotoxic for Caco-2 cells, and exhibit a reduction in the multiplication rate compared to trophozoites transfected with vector pExEhNeo (mock strain) when they are grown at high drug concentrations (>20 µg of G418 per ml) (2). The adhesion of the LMM strain to monolayers of Caco-2 cells is 53.9% ± 8.7% (n = 3) compared to the adhesion of the mock strain.
Production of the cytoplasmic tail from the Hgl3 isoform of the E. histolytica Gal/GalNAc lectin (Fig. 1) inhibits parasite adhesion to epithelial cells (29). We constructed plasmid pEhC-Hgl2, in which the extracellular region of hgl2 (24) was replaced by a FLAG epitope directing production of a
21-kDa peptide that contained the signal peptide, the transmembrane segment, and the cytoplasmic tail of Hgl2 (Hgl2SP-TM-COO) (Fig. 1a). The peptide was detected in trophozoites transfected with pEhC-Hgl2 by using anti-FLAG and by using serum against His6-Hgl3TM-COO (data not shown). The cytoplasmic tail of Hgl2 differed from Hgl3 at two positions; at one of these positions Ile1270 in Hgl3 was replaced by a threonine in Hgl2 in the sequence Thr-Ile-Thr that Vines et al. (29) showed to be important for trophozoite adhesion to epithelial cells (Fig. 1b). However, trophozoites transfected with pEhC-Hgl2 (strain HGL-2) also exhibited a reduction in adhesion to Caco-2 monolayers (46.8% ± 16.6% adhesion; n = 3), demonstrating that the cytoplasmic tail of Hgl2 cross talks with intracellular factors involved in parasite adhesion. The HGL-2 strain remained cytotoxic, as evaluated by inspection of cocultures with Caco-2 monolayers, and its growth was normal compared to the growth of the mock strain (data not shown).
Inhibition of adhesion in engineered trophozoites correlates with a reduced surface of contact with epithelial cell monolayers. The adhesion of E. histolytica to epithelial cells is strongly inhibited by millimolar amounts of galactose or N-acetylgalactosamine (14), a feature explained to a significant extent by the Gal/GalNAc lectin adhesion activity (references 17, 21, and 25 and references therein). Immunofluorescence labeling of the trophozoites for the Gal/GalNAc lectin in cocultures with Caco-2 cell monolayers showed that in the presence of galactose the lectin was distributed homogeneously around the surface of the few amoebae that remained in contact with the monolayer (Fig. 2a). When adhesion was not inhibited (in the presence of glucose instead of galactose), the trophozoites exhibited an extended surface of interaction with the monolayer, where focal clusters of surface Gal/GalNAc lectin made intimate contact with the epithelial cells (Fig. 2b) (8). The interaction sites likely represented focal adhesion points assembled at the trophozoite surface that were functional analogues of structures found in adhesive animal cells (9, 30). The human cells in the monolayer, in turn, showed a significant increase in subcortical actin filaments underneath the region of contact with the parasite (data not shown) (3).
![]() View larger version (88K): [in a new window] |
FIG. 2. Trophozoite adhesion to monolayers of Caco-2 cells. Trophozoites preincubated with 200 mM galactose (a) or glucose (b to e) were cocultured with Caco-2 confluent monolayers and fixed. The Gal/GalNAc lectin and actin filaments were labeled red and green, respectively. Confocal microscopy images obtained from z projections of cocultures with wild-type trophozoites are shown in panels a and b. The rectangle in panel b delimits the region magnified in the panel on the right to better show the focal adhesion structures. Panels c to e are confocal images of cocultures of trophozoite strains transfected with the control vector pExEhNeo, LMM, and HGL-2. The central images in these panels are a plane along the center of the trophozoite(s) in the coculture, while the image sections below and on the right show projections along the xz and yz axes represented by the green and red lines in the central panel, respectively. The arrowheads indicate clusters of Gal/GalNAc.
|
Nonmotile E. histolytica is avirulent, while the adhesion-deficient strain exhibits exacerbated virulence and a distinct histopathology in hamster liver abscesses. The distinct behavior of the LMM and HGL-2 strains in cocultures with enterocytes prompted us to correlate the cell biology results with the pathogenicity of the strains in vivo, as assayed in the hamster liver abscess model (28). Young adult hamsters were inoculated by the intraportal route with wild-type (nontransfected strain HM1), control, LMM, and HGL-2 trophozoites. Macroscopic abscesses, increases of 30 to 40% in weight due to edema, and extended inflammation were observed in livers of animals sacrificed 5 days after infestation except in the case of hamsters infected with the LMM strain (Fig. 3). In the latter case the appearance of the liver remained normal, and histology studies showed that the hepatic tissue was intact (Fig. 3).
![]() View larger version (129K): [in a new window] |
FIG. 3. Morphology and histopathology of the livers of hamsters after intraportal inoculation of the trophozoite strains indicated on the left. The left column contains dorsal photos of the livers from animals sacrificed 5 days after infestation (10-fold magnification). Lobe numbers are indicated in the liver challenged with the LMM strain. The histology of ALA progression in animals after 6 h and 5 days of infestation is shown in the center and right columns, respectively. Hamster cells were stained with hematoxylin (blue), and trophozoites were immunolabeled with a human anti-E. histolytica antibody (red) (23). The bars in the histological sections represent 50 µm. Note the healthy liver tissue after 5 days of infection with the LMM strain, as well as the nonconfluent disperse abscesses during infection with the HGL-2 strain.
|
70%), the majority of which lacked trophozoites (23). The number of foci increased, and the size increased progressively. The foci were characterized by the presence of numerous polymorphonuclear cells (PMN), most of which were necrotic. Similar results were observed after infestation of animals with the wild-type and control strains (Fig. 4). LMM infection yielded a significantly lower number of foci, and amoebae were found only in very rare cases (Fig. 4). The small foci present at 6 h postinfestation did not lead to detectable lesions after 5 days, showing that the amoebic infection was eradicated (Fig. 3). In contrast, infection with HGL-2 revealed a high capacity for successful liver invasion with a unique histopathology. A high number of small inflammatory foci were detected at 6 h postinfection (Fig. 4). The majority of the foci contained parasites at this stage of infection, a situation opposite the situation found in animals challenged with wild-type amoebae (Fig. 4). Thus, HGL-2 had an increased capacity to survive the host immune response that was most likely responsible for the high number of abscesses disseminated throughout the liver at 5 days postinfection (Fig. 3). Parasites were distributed with a relatively disorganized pattern in the interior of the abscess necrotic area and close to its periphery. This observation was also distinct from the observation made for normal abscesses of E. histolytica, in which a peripheral layer of trophozoites was surrounded by inflammatory cells, mostly PMN, delimiting the border between the area of necrosis and the hepatic parenchyma (Fig. 3) (23, 28).
![]() View larger version (20K): [in a new window] |
FIG. 4. Quantitative analysis of inflammatory foci in the livers of hamsters at 6 h after intraportal inoculation with different E. histolytica strains. Foci with amoebae (+Eh) and without amoebae were scored for five tissue sections of two lobes from the livers (L1 and L2; see the liver challenged with LMM in Fig. 3 for numbering) of three hamsters for each E. histolytica strain. The tissue sections were 25 µm from each other to ensure that the counts corresponded to independent foci (23). The values that are statistically different from the values obtained for the strain transfected with vector pExEhNeo indicated by one asterisk (P < 0.05) and two asterisks (P < 0.01) above the error bars. Statistical significance was determined by using the method of Fisher.
|
![]() View larger version (109K): [in a new window] |
FIG. 5. Diameters and positions of inflammatory foci relative to blood vessels after intraportal inoculation of the E. histolytica wild-type and HGL-2 strains. (a) Histopathology of liver tissue sections (panels 1 and 2, wild-type strain; panels 3 and 4, strain HGL-2). Inflammation in the walls of the blood vessel is indicated by arrows in panel 4. Bars = 50 µm. (b) Histogram of the diameters of foci measured in liver sections of hamsters sacrificed 6 h (n = 45 for the E. histolytica wild-type strain and n = 56 for HGL-2) and 24 h (n = 42 for the wild-type strain and n = 69 for HGL-2) after intraportal inoculation. (c) Percentages of foci contiguous to blood vessels (e.g., inflammatory focus on the right of panel 4 in panel a) relative to the total number of foci scored. Counts (66 total foci for the wild-type strain and 395 foci for HGL-2) were determined for sections of lobes 1 and 2 from three different hamsters at 24 h postinoculation for each parasite strain. The difference in counts between the wild-type strain and HGL-2 reflects the lower number of foci per histological section found in wild-type infections.
|
|
|
|---|
Other studies and our studies showed that disruption of myosin II (strain LMM) and Gal/GalNAc (strains HGL-2 and HGL-3) activities have a major effect on trophozoite adhesion and motility (2, 4, 21, 29; this study). Interestingly, the phenotypes observed in vitro may not be directly applied to the complex situation of parasite invasion in vivo. This is exemplified by strain HGL-2, which has normal motility in monolayers of enterocytes but is immobile when it is injected into the liver tissue (4). Thus, we studied the physiopathology of ALA development to correlate our cell biology studies on parasite adhesion with the invasion of the liver parenchyma by the adhesion-deficient strains LMM and HGL-2. Administration of parasites by the portal vein route implies that the trophozoites are transported by the bloodstream to the liver network of irrigation vessels. Successful invasion of the liver parenchyma requires (i) that the trophozoite binds strongly enough to the endothelium to counteract the pressure imposed by the bloodstream, (ii) extravasation, and (iii) migration through the three-dimensional structure of the hepatic tissue. The trophozoite has to survive the host inflammatory response at each of these steps.
Intraportal injection of wild-type and control strains caused ALA progression with the histopathology described previously (references 23 and 28 and references therein). Examination of liver sections from animals infected with strain LMM showed the presence of very few trophozoites, and no inflammation was observed at 24 h. The normal tissue architecture was recovered at 5 days postinfection (Fig. 3). The LMM strain thus displays a low efficiency of tissue penetration and is unable to survive in the liver. This phenotype correlates with the inability of the trophozoites to penetrate Caco-2 cell monolayers and with a lack of cytotoxicity in vitro (2). Both of these features probably contribute to preventing migration of the LMM parasites in the liver tissue and to facilitating killing of the parasites by the host immune response. The properties of strain LMM indicate that it is a good candidate for vaccination studies to elicit a host immune response against amoebiasis.
HGL-2 trophozoites injected by the portal route infect all lobes of the hamster liver, causing a large number of infection foci. The foci differ from those found in wild-type infections by their smaller size, by their disorganized structure, and by their preferential localization close to blood vessels with normal endothelial cells (Fig. 3 and 5). The destruction of vessels is an early event in ALA caused by wild-type E. histolytica. The only difference detected in vitro between the two strains was the reduced adhesion of HGL-2 to monolayers of enterocytes, while the cytotoxicities and motilities were identical. However, HGL-2 trophozoites injected intrahepatically remained immobile, showing that the Gal/GalNAc lectin is essential for migration of E . histolytica in the three-dimensional structure of the liver parenchyma (4). This is most likely due to the role of this lectin in adhesion to host cells. The HGL-2 strain might also have a defect in the contact-dependent transfer of the Gal/GalNAc lectin to the host cell (12), a process that was proposed to contribute to invasion of the host tissue (12, 25). The data suggest that during infection the HGL-2 trophozoites brought by the portal vein are spread throughout the liver by the blood vessel network. The reduced adhesion of the trophozoites might limit binding to the vessel wall and extravasation to the hepatic tissue, therefore facilitating dissemination in the organ through the bloodstream. When trophozoites penetrate the liver parenchyma, their very low mobility leads to the establishment of infection foci that are concentrated in regions adjacent to the blood vessels (Fig. 5). These foci progress into small abscesses, in which the amoebae are distributed both at the periphery, as in wild-type ALA, and in the necrotic region. In spite of the difficulty that they have penetrating the liver tissue, the HGL-2 trophozoites resist very well the host immune response. How this feature relates to their low-adhesion phenotype remains to be established. The histopathology associated with HGL-2 infection reveals the complex effect of reduced trophozoite adhesion in host-pathogen interactions resulting in enhanced spread of the parasite and in exacerbated virulence.
This work was supported in part by grants from the French Ministry of National Education through the PRFMMIP program. P.T. was supported by EMBO and FCT postdoctoral fellowships.
* Corresponding author. Present address for Paulo Tavares: Unité de Virologie Moléculaire Structurale, BÂtiment 14B, CNRS, Avenue de la Terrasse, 91198 Gif-sur-Yvette Cedex, France. Phone: 331 69823860. . Fax: 331 69824308. E-mail: tavares{at}vms.cnrs-gif.fr. Mailing address for Nancy Guillén: Unité de Biologie Cellulaire du Parasitisme, INSERM U389, Institut Pasteur, 28 rue du Dr Roux, 75724 Paris Cedex 15, France. Phone: 331 45688675. Fax: 331 45688674. E-mail: nguillen{at}pasteur.fr. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»