IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fluckiger, U.
Right arrow Articles by Wolz, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fluckiger, U.
Right arrow Articles by Wolz, C.
Infection and Immunity, March 2005, p. 1811-1819, Vol. 73, No. 3
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.3.1811-1819.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Biofilm Formation, icaADBC Transcription, and Polysaccharide Intercellular Adhesin Synthesis by Staphylococci in a Device-Related Infection Model

Ursula Fluckiger,1 Martina Ulrich,2 Andrea Steinhuber,1 Gerd Döring,2 Dietrich Mack,3,{dagger} Regine Landmann,1 Christiane Goerke,2 and Christiane Wolz2*

Division of Infectious Diseases and Department of Research, University Hospital, Basel, Switzerland,1 Institute of Medical Microbiology and Hygiene, University of Tübingen, Tübingen,2 Institut für Infektionsmedizin, Universitätsklinikum, Hamburg-Eppendorf, Germany3

Received 20 April 2004/ Returned for modification 13 July 2004/ Accepted 4 November 2004


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Biofilm formation of Staphylococcus epidermidis and S. aureus is mediated by the polysaccharide intercellular adhesin (PIA) encoded by the ica operon. We used a device-related animal model to investigate biofilm formation, PIA expression (immunofluorescence), and ica transcription (quantitative transcript analysis) throughout the course of infection by using two prototypic S. aureus strains and one S. epidermidis strain as well as corresponding ica mutants. During infection, the ica mutants were growth attenuated when inoculated in competition with the corresponding wild-type strains but not when grown singly. A typical biofilm was observed at the late course of infection. Only in S. aureus RN6390, not in S. aureus Newman, were PIA and ica-specific transcripts detectable after anaerobic growth in vitro. However, both S. aureus strains were PIA positive in vivo by day 8 of infection. ica transcription preceded PIA expression and biofilm formation in vivo. In S. epidermidis, both PIA and ica expression levels were elevated compared to those in the S. aureus strains in vitro as well as in vivo and were detectable throughout the course of infection. In conclusion, in S. aureus, PIA expression is dependent on the genetic background of the strain as well as on strong inducing conditions, such as those dominating in vivo. In S. epidermidis, PIA expression is elevated and less vulnerable to environmental conditions.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The success of the increasing number of artificial-joint replacements and other implanted devices is hampered by device-related infections. Prosthetic-device infections are enormously costly for the community and disabling for the individual patient. Infections can occur during the surgical procedure or hematogenously, even years after the implantation. The staphylococci Staphylococcus epidermidis and S. aureus account for more than half of prosthetic-device-associated infections (51, 58). S. aureus adheres primarily to the device via cell wall-attached adhesins that recognize host proteins coating biomaterial surfaces soon after implantation (15). In contrast, adhesins of S. epidermidis are less well characterized, but initial adherence is probably multifactorial, involving, among other factors, the autolysins AtlE, Embp, and Fbe (26, 34). After initial adherence, biofilm formation occurs by bacterial accumulation mediated by extracellular polysaccharides.

Biofilm formation was first characterized in S. epidermidis on a molecular level. Biofilm development requires the polysaccharide intercellular adhesin (PIA), which is synthesized by enzymes encoded by the ica operon (27, 35-37). S. epidermidis forms biofilm on nearly all kinds of medical devices and implants (reviewed in reference 25). Furthermore, the relevance of PIA production in the pathogenesis of S. epidermidis in human infections is emphasized by several studies showing that infecting strains are significantly more ica positive than colonizing strains (3, 4, 9, 18, 19, 42, 57). In addition, the role of PIA as an important virulence factor for S. epidermidis was demonstrated in two different animal models (48-50).

Recently, it was found that the ica locus is conserved between S. epidermidis and S. aureus (7, 41). Interestingly, in contrast to S. epidermidis, PIA production and biofilm formation in vitro is less pronounced in most S. aureus strains and often observed only under stringent in vitro conditions, such as low oxygen (8). Analysis of clinical S. aureus isolates from prosthetic-joint infections, bacteremia, or catheter-related infections showed the presence of the ica locus in most isolates but a lack of PIA production in a varying percentages of these strains in vitro (1, 7, 8, 16, 30, 40, 44, 47). The circumstances leading to the formation of biofilm in S. aureus infections are not clearly understood and are difficult to derive from in vitro results. However, antibodies against PIA proved to be protective in mice, emphasizing a role of PIA for virulence also in S. aureus (41).

We aimed to analyze PIA expression from S. aureus and S. epidermidis during the course of infection by using a device-related animal model. Growth and adherence of the ica-deficient mutants from both species did not differ from that in the isogenic parental strains when the animals were grown in separate cages. However, in competition infection, the wild-type strains hindered the mutant strains from growing up to the same density. S. epidermidis was already PIA positive at the onset of infection. S. aureus strain RN6390 as well as the in vitro biofilm-negative strain Newman became PIA positive only in the later stages of infection.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial strains and growth conditions. The following strains were used for analysis: S. epidermidis strain 1457 and its isogenic ica mutant (36), S. aureus strain Newman (13) and S. aureus strain RN6390 (45) and their corresponding isogenic ica-deficient derivatives CW25 (Newman {Delta}ica::tet) and CW26 (RN6390 {Delta}ica::tet), and the agr mutant strains RN6911 (RN6390 {Delta}agr::tet) (45) and ALC355 (Newman {Delta}agr::tet) (55). For in vivo experiments, staphylococci were grown overnight in Casamino Acids-yeast extract-ß-glycerophosphate-glucose medium (CYPG) (43) with aeration, washed three times in sterile NaCl (0.9%), and diluted to the desired inoculum size of approximately 5 x 105 CFU/ml. For in vitro analysis, bacteria from an overnight culture were diluted to an initial optical density at 600 nm (OD600) of 0.05 and grown with shaking at 37°C to the mid-exponential phase (OD600 = 0.8 at time 1), to the post-exponential phase (OD600 = 8 at time 3), or for 24 h to the stationary phase. For analysis of PIA expression by immunofluorescence, bacteria were grown anaerobically on chamber slides in tryptic soy broth containing 1% glucose for up to 48 h (8). Biofilm formation in vitro was assessed in a microtiter plate assay as described previously (5).

Construction of ica mutant strains. A {Phi}11 lysate of the ica deletion mutant ATCC 35556 {Delta}ica::tet (7) was used to transduce strain Newman and strain RN6390. Tetracycline-resistant transductants were selected, and the ica gene replacement was verified by PCR. Oligonucleotides were chosen to allow amplification of the following fragments in the transductants and the original ica deletion mutants corresponding to the tet insertion site within the ica operon: CTTCGATGTCGAAAATAAACTC based on ica and GCTTCTGGAATGAGTTTGCT based on tet. Southern hybridization was performed on SmaI-digested chromosomal DNA after pulsed-field gel electrophoresis using ica-specific probes.

Animal model of device-related infection. The well-established guinea pig and mouse models of implant infection were used (31, 32, 59). Four perforated Teflon tubes filled with eight pieces of plastic catheter were inserted in the flanks of the animals. Two weeks after implantation, approximately 2 x 105 to 3 x 105 CFU of the test strain was inoculated into the tissue cages.

Before inoculation, the interstitial fluid, which had accumulated in the tissue cages, was checked for sterility. Animals infected with S. epidermidis were sacrificed 2, 4, 6, 8, 12, or 16 days after bacterial challenge. Those animals infected with S. aureus were sacrificed at days 2, 4, 6, and 8 only because increasing inflammation and abscess formation around the tissue cages limited the duration of the experiment. Every second day after bacterial challenge, 1 aliquot of aspirated exudate was taken and immediately stored in liquid nitrogen for subsequent RNA preparation. A second aliquot was used for quantitative bacteriology. The tissue cages were removed from sacrificed animals, and three pieces of catheter were used to count the adherent bacteria (see following paragraph). Two pieces were fixed with 2.5% glutaraldehyde for microscopy. Each strain was tested in at least three independent animal experiments performed on different days.

For competition experiments, wild-type and ica mutant strains were inoculated into implanted tissue cages in mice at a ratio of 1:1 or 1:100. The coinfection was maintained for 8 days with CFU determinations of the exudates at days 2 and 8, as described above.

Bacterial quantification in vitro and in vivo. Serial dilutions of broth culture and of aspirated exudates from the infected-animal cages were plated onto blood agar plates (tryptic soy agar containing 5% sheep blood). For CFU determinations of the competition experiments, serial dilutions of bacteria were plated in parallel on tryptic soy agar with or without the appropriate selective antibiotic, erythromycin (10 µg/ml) for S. epidermidis and tetracycline (3 µg/ml) for S. aureus, to determine the ratio of mutant (Ermr to Tetr, respectively) to wild-type (Erms to Tets, respectively) bacteria. In addition, we subcultivated 100 randomized colonies of each exudate sample from nonselective plates on erythromycin and tetracycline plates, respectively, to verify the ratios of wild-type to ica mutant CFU in the mixed infections. The number of bacteria adhering to the plastic catheters was determined as described previously (54). Briefly, for each time point, three pieces of catheter were washed twice with saline and each catheter was placed in a tube with 1 ml of 0.9% NaCl containing EDTA (0.15%) and Triton X-100 (0.1%). The tubes were vigorously vortexed three times for 15 s. The tubes were then placed in an ultrasonic bath and sonicated for 3 min at 120 W. After an additional mixing step, 100 µl of the liquid was diluted for quantitative bacterial culture on blood agar plates. Stability of the mutant strains was confirmed by subculturing of the strains on plates containing tetracycline (3 µg/ml) or erythromycin (10 µg/ml).

PIA detection by indirect immunofluorescence in vivo and in vitro. PIA production in vivo was determined in exudates which were mixed with the same volume of 8% paraformaldehyde immediately after aspiration, diluted 1:10 with phosphate-buffered saline (PBS) for S. aureus, concentrated 10 times for S. epidermidis, and spotted on poly-L-lysine-coated slides. PIA production in vitro was determined in planktonic bacteria and in bacteria forming a biofilm on poly-L-lysine coated chamber slides after anaerobic growth for 48 h. For PIA-specific immunofluorescence, the bacteria were fixed with 4% formaldehyde for 10 min at room temperature. The slides were washed three times with PBS-Tween and incubated with human serum (1:10 in PBS) for 30 min to prevent unspecific binding of immunoglobulin G by cell wall-associated protein A. The slides were incubated with a PIA-specific polyclonal antiserum from rabbit (1:100 in PBS-Tween) for 1 h, followed by incubation of Cy3-conjugated anti-rabbit F(ab)2 fragment (1:100 in PBS-Tween; Dianova) for 1 h. Bacteria were also stained with 4',6'-diamidino-2-phenylindole (DAPI; 2 µg/ml) for 5 min, washed three times with water, and air dried. The slides were then mounted with fluorescent mounting medium (Dako), and positively stained bacteria were detected using fluorescence microscopy. Experiments were repeated three times at different time intervals.

Scanning electron microscopy (SEM). Pieces of catheter material were fixed with 2.5% glutaraldehyde, dried, and sputtered with gold to analyze adherence and biofilm formation by electron microscopy.

RNA isolation. For RNA isolation from culture, bacteria were grown in CYPG to the desired growth phase. A pellet of approximately 5 x 109 bacteria was then resuspended in 1 ml of Trizol reagent (Gibco BRL, Life Technologies), and the mixture was disrupted with 0.5 ml of zirconia-silica beads in a high-speed homogenizer (Savant Instrument, Farmingdale, N.Y.). Total RNA was isolated as directed in the instructions provided by the manufacturer of Trizol. For RNA preparation from exudates, the frozen samples were thawed rapidly and 200-µl aliquots were used. RNA was isolated and purified as described previously (24). Contaminating DNA was degraded by digesting RNA samples with DNase as described previously (23).

Quantification of specific transcripts with LightCycler RT-PCR. Specific RNA standards for the quantification of gyr and ica were engineered as described elsewhere (22). LightCycler reverse transcription (RT)-PCR was carried out using the LightCycler RNA amplification kit for hybridization probes (Roche Biochemicals, Basel, Switzerland). Master mixes were prepared following the manufacturer's instructions by using the oligonucleotides specific for gyr and ica (Table 1). After RT for 20 min at 50°C, the following temperature profile was utilized for amplification: denaturation for 1 cycle at 95°C for 30 s and for 45 cycles at 95°C for 1 s (temperature transition of 20°C/s), at 55 to 50°C (step size of 1°C, step delay of 1 cycle) for 15 s (temperature transition 20°C/s), and at 72°C for 15 s (temperature transition of 2°C/s) and fluorescence acquisition at 55 to 50°C in single mode. Melting curve analysis was performed at 45 to 90°C (temperature transition of 0.2°C/s) with stepwise fluorescence acquisition. Sequence-specific standard curves were generated using 10-fold serial dilutions (104 to 108 copies/µl) of the specific RNA standards. The number of copies of each sample transcript was then determined with the aid of the LightCycler software. The specificity of the PCR was verified by size determination of the amplicons by agarose gel electrophoresis.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Oligonucleotide primers and LightCycler hybridization probes

 
Statistics. The results are expressed as mean values ± standard deviations. Statistical analysis was performed by Student's two-tailed test. A P value of <0.05 was considered significant.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Biofilm formation in the animal model. S. aureus strains RN6390 and Newman were inoculated after sterile implantation of the tissue cages containing pieces of catheters. To evaluate biofilm formation on the catheter pieces in vivo, the tissue cages were explanted 8 days after inoculation. Pieces of catheters were washed with sterile saline and prepared for SEM analysis (Fig. 1). SEM showed bacterial clusters attached to the catheter in close contact to host cells and cellular debris. Additionally, uptake of bacteria by surface-attached phagocytes could be observed (Fig. 1B). These images demonstrate S. aureus biofilm formation in the animal model of device-related infections. There were no obvious differences between cages infected with either strain Newman or strain RN6390. Due to the lower bacterial number of S. epidermidis cells in vivo, biofilm could not be visualized using SEM.



View larger version (97K):
[in this window]
[in a new window]
 
FIG. 1. SEM micrographs of S. aureus RN6390 (A) and S. aureus Newman (B) adhering to catheter pieces explanted into tissue cages. Microcolonies (arrows) of staphylococci were found attached to the catheters. Engulfment of staphylococci by a phagocytic cell was observed (panel B, arrow). Original magnification, x10,560.

 
Biofilm formation and PIA expression in vitro. Prototypic S. epidermidis as well as S. aureus strains were grown anaerobically on chamber slides for 48 h in tryptic soy broth with 1% glucose to get maximum PIA expression (8), reflecting the in vivo situation where low oxygen might be present in a late stage of localized infection. Accordingly, S. epidermidis and S. aureus strain RN6390 were clearly PIA positive by immunofluorescence using PIA-specific antiserum (Fig. 2C and E). In contrast, in S. aureus strain Newman, no PIA production could be detected. Additionally, in a microtiter plate assay, no biofilm formation could be observed in strain Newman. To analyze whether this was due to the proposed inhibitory action of the agr operon (53), isogenic agr-deficient mutants were also analyzed. As expected, biofilm formation was increased in the agr-deficient derivative of strain RN6390 (RN6911). However, deletion of agr in strain Newman did not enhance biofilm formation or PIA expression (data not shown). These results indicate that, in strain Newman, PIA expression is severely down-regulated in vitro. Since both S. aureus strains tested (RN6390 and Newman) were able to form biofilms in the tissue cage model (Fig. 1), we aimed to analyze the PIA expression of these two strains in vivo in more detail.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 2. S. aureus Newman, S. aureus RN6390, S. epidermidis 1457, and their ica mutants were grown anaerobically in chamber slides for 48 h. In panels A through F, culture broth was stained by indirect immunofluorescence to detect PIA. PIA was not detected in S. aureus strain Newman (panel A). In contrast, PIA was strongly marked by immunofluorescence in strain S. aureus RN6390 (panel C) and S. epidermidis 1457 (panel E) under anaerobic in vitro growth. All three ica mutants (panels B, D, and F) were PIA negative. WT, wild type. Original magnification, x1,000.

 
Construction of ica mutants of strain RN6390 and Newman. In order to obtain PIA-negative control strains, we first constructed ica mutants of the two S. aureus strains RN6390 and Newman. The replacement of the ica operon by tet in the transductants was confirmed by PCR. From the ica mutants, a PCR amplicon corresponding to the tet insertion site within ica could be amplified. The restriction fragment patterns obtained by pulsed-field gel electrophoresis differed between the mutants and the corresponding parental strains only in one fragment, which could be shown to encompass the ica locus. By Southern blotting, the fragments in the mutant strains did not react with a DNA probe specific for icaA. Additionally, both mutants were shown to be PIA negative in vitro as well as in vivo using PIA-specific antibodies (Fig. 2 and 4).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 4. In vivo growth curves of S. epidermidis 1457 (A and B) and S. aureus RN 6390 (C and D) and their respective ica mutants injected together into the tissue cages of mice at ratios of 1:1 (left panels) and 1:100 (right panels). Numbers of viable counts (CFU/ml) at the time point of infection, at day 2 (2d), and at 8d postinfection are shown. Solid lines represent the wild-type strains, and dotted lines represent the ica mutants. Data from three to eight mice from two experiments were pooled. At 2d, CFU counts of the ica-deficient S. aureus strains were lower than those of the wild-type strains, but this was not the case for S. epidermidis. At 8d, the ica mutants of both S. epidermidis and S. aureus reached significantly lower CFU counts than the corresponding wild-type strains (P < 0.05).

 
Bacterial growth curves and adherence in vivo. First, the growth and adherence capabilities of S. aureus and S. epidermidis strains and their ica mutants in the animal model were assessed. Implanted tissue cages containing catheters were inoculated with approximately 5 x 105 CFU/cage (Fig. 3A). S. aureus strains RN6390 and Newman and their ica mutants grew up to 1.4 x 108 to 4.5 x 108 CFU/ml in tissue cages 8 days after infection. At 2, 6, and 8 days after inoculation, wild-type strains and their ica-deficient mutants reached similar CFU counts. At day 6, the numbers of both S. aureus wild-type and ica mutant strains reached a maximum of about 108 CFU/ml (range, 8 x 107 to 2 x 108 CFU/ml) and remained stable up to day 8. No significant differences in growth for wild-type strains and their ica mutants was observed at day 8 (P = 0.92 for S. aureus RN6390, P = 0.73 for S. aureus Newman; Student's t test).



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 3. In vivo growth curves of S. aureus RN6390, S. aureus Newman, S. epidermidis 1457, and their isogenic ica mutants in the guinea pig model. (A) Number of viable counts (CFU/ml) in exudates of tissue cages at the time of bacterial challenge at 0 days (0d), 2d, 6d, and 8d after S. aureus inoculation and 2d, 6d, 8d, 10d, 12d, and 16d after S. epidermidis inoculation. Each value is the mean ± standard deviation for six to eight cages from three or four independent experiments. (B) Number of bacteria attached to the catheters in the tissue cages at 2d and 8d after inoculation with S. aureus RN6390 or S. aureus Newman and additionally at 16d after S. epidermidis 1457 inoculation. Each value is the mean ± standard deviation for six to eight cages from three independent experiments.

 
CFU counts of S. epidermidis strains were maintained at about 5 x 105 CFU/ml throughout the course of infection up to 12 days. Thereafter, wild-type S. epidermidis and the ica mutant decreased 1 log to 2 x 104 to 4 x 104 CFU/ml.

Figure 3B shows the bacterial counts on the catheters within the tissue cages. As for the exudates, the bacterial counts of S. epidermidis were lower than those of S. aureus. The 2-day CFU counts of the adherent bacteria differed between the wild-type strains and the corresponding ica mutants. However, at 8 days, there was no significant difference between the wild-type strains and their ica mutants. The average CFU counts were between 2 x 104 and 3 x105/piece of catheter for adhering S. aureus Newman and 4 x 104 to 5 x 104/piece of catheter for S. aureus RN6390; for S. epidermidis 1457, the count varied between 3 x 104 and 6 x 104 CFU/piece of catheter. According to the decreasing CFU in exudate, the adhering bacteria of S. epidermidis and its ica mutant decreased to very low numbers of 100 to 500 CFU/piece of catheter at 16 days.

To determine whether ica-positive and ica-deficient strains inoculated together in the same cage exhibit the same growth capabilities, we performed competition experiments (Fig. 4). The ratios of wild type to mutant were 1:1 (Fig. 4A and C) and 1:100 (Fig. 4B and D), respectively. As observed in growth curves for single-strain infections, the CFU of mixed S. epidermidis infections declined during the first 2 days independent of the inoculum ratio. Thereafter, the S. epidermidis strain lacking the ica locus grew slower than the wild type; however, the mutant was not completely cleared. In cages infected with S. aureus wild type and ica mutants at a ratio of 1:1, the mutant strain grew slower than the wild type at 2 and 8 days (Fig. 4C). However, an inoculum of the ica mutant which was 100 times higher than that of the wild-type S. aureus resulted in a similar CFU count after 8 days (Fig. 4D).

PIA expression in vivo determined using immunofluorescence microscopy. Next, we examined aspirated exudates from tissue cages by indirect immunofluorescence in order to investigate the production of PIA during the course of infection. There was a marked difference of PIA production between S. aureus and S. epidermidis. Figure 5 illustrates the three tested parental strains and their respective ica mutants. For each time point, two pictures are shown. In the upper panels, the exudates are stained by immunofluorescence to detect PIA, whereas the lower panels show pictures of the corresponding exudates stained with DAPI to identify the bacteria. In both S. aureus strains, PIA was negative in aspirated exudates 2 days after inoculation but clearly positive at day 8 (Fig. 5A through C and E through G). Exudates of the ica mutants of both S. aureus strains and S. epidermidis were PIA negative at each of the tested time points (shown only at day 8 [Fig. 5D, H, and M]). In contrast, in S. epidermidis 1457, PIA was detected by immunofluorescence already at the second day after bacterial inoculation (Fig. 5I). Bacteria were detected as pairs in the early course of infection and as large cell clusters at day 16 (Fig. 5I and L, respectively).



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 5. Micrographs of S. aureus strains RN6390 (A through C) and Newman (E through G) in exudates aspirated at day 2 (2d), 4d, and 8d; S. epidermidis 1457 (I through L) aspirated at 2d, 4d, 8d, and 16d; and their respective ica mutants (D, H, and M) aspirated at 8d from in vivo tissue cages. Bacteria were stained by indirect immunofluorescence for the detection of PIA (upper panels for each locant, arrows) and with DAPI to show the presence of all bacteria (lower panels for each locant). Immunofluorescence micrographs of exudates for the detection of PIA were negative at 2d and 4d after inoculation. However, both S. aureus strains were clearly positive at 8d (panels C, G, and K). Aspirated exudates from infected tissue cages with S. epidermidis were PIA positive already 2d after infection (panel I). Both species appeared in clusters at 8d (panels C, G, and L). The ica mutants of all three tested strains remained PIA negative (panels D, H, and M). WT, wild type. Original magnification, x1,000.

 
Transcription of ica in vitro and in vivo. In order to investigate whether PIA expression correlates with transcription of the ica operon, quantitative RT-PCR was performed using bacteria from in vitro cultures and directly from the exudates without subculturing (Fig. 6). In vitro S. aureus RN6390 and S. aureus Newman showed similar patterns, with increasing transcription levels at time 3 (late-exponential-growth phase) compared to those at time 1 (mid-exponential-growth phase) and decreasing levels at 24 h. At all three time points, the ratio of copy numbers of ica relative to those of the reference transcript gyr (y axis; copies of ica per copy of gyr) was lower in strain Newman than in strain RN6390. This finding is in close agreement with the immunofluorescence data, where PIA was detectable in vitro only in strain RN6390, not in strain Newman.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 6. Quantitative transcript analysis of S. aureus RN6390 and S. aureus Newman by LightCycler RT-PCR in vitro and in vivo. ica transcripts were quantified in relation to the number of gyr transcripts in each sample. Transcription of ica was determined in the mid-exponential phase (time 1 [t1]) and in the late-exponential phase (t3), as well as after 24 h of growth in CYPG (gray columns) and in exudates from infected devices in guinea pigs 2 days (2d) and 8d after bacterial inoculation (black columns). Values from three separate RNA preparations were used to calculate the mean values ± standard deviations.

 
In contrast to the in vitro situation, the ica transcript levels of S. aureus RN6390 and S. aureus Newman were similar in vivo at days 2 and 8, with 0.012 and 0.015 copy per copy of gyr at 2 days and 0.007 and 0.009 copy per copy of gyr at 8 days, respectively. In strain Newman, the ica/gyr mRNA ratios were higher in vivo than in vitro.

S. epidermidis showed a remarkable expression of ica transcripts in vitro, which were 3 logs above those found in the S. aureus strains grown under the same conditions. In vivo, we could detect ica-specific transcripts in the exudates of S. epidermidis-infected animals at copy numbers 2 logs higher than those of S. aureus after 2 days of infection, indicating a particularly high expression of ica already early in the infection course. The copy numbers remained 2 logs higher than those of S. aureus throughout the infection course.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We could show that the device-related infection model is well suited to study biofilm formation during infection. Bacterial biofilms of S. aureus on pieces of catheter could be confirmed by SEM. These electron micrographs closely resemble those presented for biofilm-coated devices explanted from humans infected with staphylococci (11, 12). Additionally, PIA expression of S. aureus and S. epidermidis and formation of bacterial clusters probably reflecting biofilm formation could be demonstrated in the later course of infection by immunofluorescence.

Comparison of the ica transcription and PIA synthesis levels of S. aureus strains revealed marked strain-dependent differences under in vitro but not in vivo conditions. In the in vitro experiments, S. aureus strain RN6390 produced PIA under an anaerobic condition after 48 h of inoculation whereas in S. aureus Newman, no PIA production was detectable. In contrast, under the in vivo condition, both S. aureus strains produced PIA late in the infection course, suggesting that PIA production is strongly induced in vivo. This confirms previous data showing that S. aureus bacteria are PIA positive during lung infection in patients suffering from cystic fibrosis (41). The signals resulting in PIA expression in S. aureus during the course of infection remain unknown. Numerous recent publications report on factors influencing PIA or biofilm production, such as glucose and other sugars, high osmolarity, and anaerobiosis (8, 21, 29, 30, 39, 46). It is conceivable that oxygen tension decreases in abscesses, as observed in S. aureus-infected cages, and this may trigger PIA formation in S. aureus. However, additional signals are obviously required, since we were unable to induce PIA formation in strain Newman under anaerobic conditions in vitro.

The regulatory circuits resulting in PIA expression are obviously different between the two species. The overall amount of PIA as well as of the ica-specific transcripts in S. epidermidis is elevated compared to that in the S. aureus strains. S. epidermidis was PIA positive under all conditions examined, whereas in S. aureus, PIA expression was dependent on the genetic background as well as on growth conditions. Regulatory loci which are known to be involved in PIA synthesis, such as sarA, sigB, and icaR, are conserved between S. aureus and S. epidermidis (2, 6, 14, 28, 38, 46, 52). However, one may assume that there are species-specific differences in their activity and function leading to the differences in the observed PIA expression.

We aimed to correlate the ica transcript levels detected by quantitative RT-PCR with PIA expression analyzed by immunofluorescence in vitro and in vivo. The ica transcription as well as PIA synthesis was markedly higher in S. epidermidis than in the S. aureus strains in vitro as well as in vivo. With both assays, it could be demonstrated that in vitro ica or PIA is expressed mainly during the stationary phase in S. aureus strain RN6390 but is repressed in strain Newman. Interestingly, the ica transcripts preceded the detected PIA production in vivo. This suggests a delay between the transcription and the biosynthesis of PIA. The synthesis of this ß-1,6-linked N-acetylglucosamine polysaccharide is dependent on the supply of precursor molecules, which are processed by the enzymes encoded by the ica operon. Thus, besides the ica-encoded enzymes, the concentration of these precursor molecules is probably also crucial for overall PIA production. This hypothesis is supported by the ica or PIA expression analysis performed with S. epidermidis grown with and without glucose (10).

In the case of separate inoculation of wild-type and mutant strains, growth and adherence to catheters by S. aureus and S. epidermidis in vivo were not dependent on PIA expression. This observation is in agreement with previous observations by us and others (17, 31). Nevertheless, the role of PIA as a virulence factor of S. epidermidis has been demonstrated in two other animal models. In a central venous catheter-related infection model, the PIA-positive S. epidermidis strains adhered better to the implanted catheter and caused metastatic diseases more often than did the PIA-negative mutants (48, 50). In a foreign-body infection mouse model, subcutaneously implanted catheters infected with S. epidermidis 1457 formed abscesses more often and the number of recovered bacteria adhering on the plastic catheters was higher than that with the PIA-negative mutant (49). In this model, attachment of S. epidermidis occurred on the native implants. In contrast, in the animal model used here and by Francois et al. (17), tissue cages with catheter pieces were precoated with host proteins before bacterial inoculation. These coating proteins may impair the adherence of S. epidermidis since it was shown in vitro that plasma proteins, fibrinogen, and fibronectin decrease the binding of S. epidermidis to artificial surfaces (20, 25, 56). In contrast, S. aureus adherence to implants coated by host proteins is promoted by cell wall adhesins (15). This could explain the clinical observation that prosthetic implant infections due to S. epidermidis occur mainly during the surgical procedures, whereas S. aureus infections can occur hematogenously even years after the procedure.

Growth of wild-type strains and ica mutants was equal when the strains were injected separately. In contrast, in competition experiments where wild-type strains and ica mutants were injected together in a ratio of 1:1 into the same cages, the ica mutant strain reached lower bacterial numbers than the wild type. This observation suggests an attenuated virulence of the ica mutant compared to that of wild-type strains in the foreign-body model. In a recently published report, it was shown that in a mouse model of Yersinia pseudotuberculosis, the presence of wild-type bacteria severely hindered the ability of mutant strains to persist and colonize different tissues (33).

In conclusion, we show that the device-related animal mode l is suitable for studying the time course of biofilm formation in S. aureus and S. epidermidis. We demonstrated that in S. epidermidis infection, PIA is detectable early in the infection course and that PIA production is induced in S. aureus infection during the course of a device-related infection. PIA production and biofilm formation are present in both species late in infection. Taken together, our results show that the ica locus and biofilm formation are crucial parameters for staphylococcal colonization and survival on implants.


    ACKNOWLEDGMENTS
 
We thank Z. Rajacic for his expert technical assistance with the animal model and Heinz Schwarz for his excellent support with electron microscopy. We are grateful to Sarah Cramton and Fritz Götz for the ica gene replacement mutant of strain ATCC 35556.

This work was supported by grants from the Deutsche Forschungsgemeinschaft (Wo578/3-3 and Ma1522/4-3) and from the Stiftung für Infektionskrankheiten beider Basel.

The animals used in this study were kept in the Animal House of the Department of Research, University Hospital, Basel, Switzerland, and animal experimentation guidelines were followed according to the regulations of Swiss veterinary law.


    FOOTNOTES
 
* Corresponding author. Mailing address: Institut für Medizinische Mikrobiologie und Hygiene, Wilhemstr. 31, 72074 Tübingen, Germany. Phone: 49 7071 2980187. Fax: 49 7071 293011. E-mail: Christiane.Wolz{at}uni-tuebingen.de. Back

Editor: A. D. O'Brien

{dagger} Present address: Medical Microbiology and Infectious Diseases, The Clinical School, University of Wales Swansea, Swansea, United Kingdom. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Arciola, C. R., L. Baldassarri, and L. Montanaro. 2001. Presence of icaA and icaD genes and slime production in a collection of staphylococcal strains from catheter-associated infections. J. Clin. Microbiol. 39:2151-2156.[Abstract/Free Full Text]
2. Cheung, A. L., J. M. Koomey, C. A. Butler, S. J. Projan, and V. A. Fischetti. 1992. Regulation of exoprotein expression in Staphylococcus aureus by a locus (sar) distinct from agr. Proc. Natl. Acad. Sci. USA 89:6462-6466.[Abstract/Free Full Text]
3. Christensen, G. D., J. T. Parisi, A. L. Bisno, W. A. Simpson, and E. H. Beachey. 1983. Characterization of clinically significant strains of coagulase-negative staphylococci. J. Clin. Microbiol. 18:258-269.[Abstract/Free Full Text]
4. Christensen, G. D., W. A. Simpson, A. L. Bisno, and E. H. Beachey. 1982. Adherence of slime-producing strains of Staphylococcus epidermidis to smooth surfaces. Infect. Immun. 37:318-326.[Abstract/Free Full Text]
5. Christensen, G. D., W. A. Simpson, J. J. Younger, L. M. Baddour, F. F. Barrett, D. M. Melton, and E. H. Beachey. 1985. Adherence of coagulase-negative staphylococci to plastic tissue culture plates: a quantitative model for the adherence of staphylococci to medical devices. J. Clin. Microbiol. 22:996-1006.[Abstract/Free Full Text]
6. Conlon, K. M., H. Humphreys, and J. P. O'Gara. 2002. icaR encodes a transcriptional repressor involved in environmental regulation of ica operon expression and biofilm formation in Staphylococcus epidermidis. J. Bacteriol. 184:4400-4408.[Abstract/Free Full Text]
7. Cramton, S. E., C. Gerke, N. F. Schnell, W. W. Nichols, and F. Götz. 1999. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect. Immun. 67:5427-5433.[Abstract/Free Full Text]
8. Cramton, S. E., M. Ulrich, F. Götz, and G. Döring. 2001. Anaerobic conditions induce expression of polysaccharide intercellular adhesin in Staphylococcus aureus and Staphylococcus epidermidis. Infect. Immun. 69:4079-4085.[Abstract/Free Full Text]
9. de Silva, G. D. I., M. Kantzanou, A. Justice, R. C. Massey, A. R. Wilkinson, N. P. J. Day, and S. J. Peacock. 2002. The ica operon and biofilm production in coagulase-negative staphylococci associated with carriage and disease in a neonatal intensive care unit. J. Clin. Microbiol. 40:382-388.[Abstract/Free Full Text]
10. Dobinsky, S., K. Kiel, H. Rohde, K. Bartscht, J. K.-M. Knobloch, M. A. Horstkotte, and D. Mack. 2003. Glucose-related dissociation between icaADBC transcription and biofilm expression by Staphylococcus epidermidis: evidence for an additional factor required for polysaccharide intercellular adhesin synthesis. J. Bacteriol. 185:2879-2886.[Abstract/Free Full Text]
11. Donlan, R. M. 2001. Biofilm formation: a clinically relevant microbiological process. Clin. Infect. Dis. 33:1387-1392.[CrossRef][Medline]
12. Donlan, R. M. 2002. Biofilms: microbial life on surfaces. Emerg. Infect. Dis. 8:881-890.[Medline]
13. Duthie, E., and L. L. Lorenz. 1952. Staphylococcal coagulase: mode of action and antigenicity. J. Gen. Microbiol. 6:95-107.[Medline]
14. Fluckiger, U., C. Wolz, and A. L. Cheung. 1998. Characterization of a sar homolog of Staphylococcus epidermidis. Infect. Immun. 66:2871-2878.[Abstract/Free Full Text]
15. Foster, T. J., and M. Hook. 1998. Surface protein adhesins of Staphylococcus aureus. Trends Microbiol. 6:484-488.[CrossRef][Medline]
16. Fowler, V. G., Jr., P. D. Fey, L. B. Reller, A. L. Chamis, G. R. Corey, and M. E. Rupp. 2001. The intercellular adhesin locus ica is present in clinical isolates of Staphylococcus aureus from bacteremic patients with infected and uninfected prosthetic joints. Med. Microbiol. Immunol. (Berlin) 189:127-131.[CrossRef][Medline]
17. Francois, P., P. H. Tu Quoc, C. Bisognano, W. L. Kelley, D. P. Lew, J. Schrenzel, S. E. Cramton, F. Gotz, and P. Vaudaux. 2003. Lack of biofilm contribution to bacterial colonisation in an experimental model of foreign body infection by Staphylococcus aureus and Staphylococcus epidermidis. FEMS Immunol. Med. Microbiol. 35:135-140.[CrossRef][Medline]
18. Frebourg, N. B., S. Lefebvre, S. Baert, and J.-F. Lemeland. 2000. PCR-based assay for discrimination between invasive and contaminating Staphylococcus epidermidis strains. J. Clin. Microbiol. 38:877-880.[Abstract/Free Full Text]
19. Galdbart, J. O., J. Allignet, H. S. Tung, C. Ryden, and N. El Solh. 2000. Screening for Staphylococcus epidermidis markers discriminating between skin-flora strains and those responsible for infections of joint prostheses. J. Infect. Dis. 182:351-355.[CrossRef][Medline]
20. Galliani, S., A. Cremieux, P. van der Auwera, and M. Viot. 1996. Influence of strain, biomaterial, proteins, and oncostatic chemotherapy on Staphylococcus epidermidis adhesion to intravascular catheters in vitro. J. Lab. Clin. Med. 127:71-80.[CrossRef][Medline]
21. Gerke, C., A. Kraft, R. Sussmuth, O. Schweitzer, and F. Gotz. 1998. Characterization of the N-acetylglucosaminyltransferase activity involved in the biosynthesis of the Staphylococcus epidermidis polysaccharide intercellular adhesin. J. Biol. Chem. 273:18586-18593.[Abstract/Free Full Text]
22. Goerke, C., M. G. Bayer, and C. Wolz. 2001. Quantification of bacterial transcripts during infection using competitive reverse transcription-PCR (RT-PCR) and LightCycler RT-PCR. Clin. Diagn. Lab. Immunol. 8:279-282.[Abstract/Free Full Text]
23. Goerke, C., S. Campana, M. G. Bayer, G. Döring, K. Botzenhart, and C. Wolz. 2000. Direct quantitative transcript analysis of the agr regulon of Staphylococcus aureus during human infection in comparison to the expression profile in vitro. Infect. Immun. 68:1304-1311.[Abstract/Free Full Text]
24. Goerke, C., U. Fluckiger, A. Steinhuber, W. Zimmerli, and C. Wolz. 2001. Impact of the regulatory loci agr, sarA and sae of Staphylococcus aureus on the induction of alpha-toxin during device-related infection resolved by direct quantitative transcript analysis. Mol. Microbiol. 40:1439-1447.[CrossRef][Medline]
25. Gotz, F., and G. Peters. 2000. Colonization of medical devices by coagulase-negative staphylococci, p. 55-88. In F. A. Waldvogel and A. L. Bisno (ed.), Infections associated with indwelling medical devices, 3rd ed. American Society for Microbiology, Washington, D.C.
26. Heilmann, C., M. Hussain, G. Peters, and F. Gotz. 1997. Evidence for autolysin-mediated primary attachment of Staphylococcus epidermidis to a polystyrene surface. Mol. Microbiol. 24:1013-1024.[CrossRef][Medline]
27. Heilmann, C., O. Schweitzer, C. Gerke, N. Vanittanakom, D. Mack, and F. Gotz. 1996. Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis. Mol. Microbiol. 20:1083-1091.[Medline]
28. Jefferson, K. K., S. E. Cramton, F. Gotz, and G. B. Pier. 2003. Identification of a 5-nucleotide sequence that controls expression of the ica locus in Staphylococcus aureus and characterization of the DNA-binding properties of IcaR. Mol. Microbiol. 48:889-899.[CrossRef][Medline]
29. Knobloch, J. K.-M., K. Bartscht, A. Sabottke, H. Rohde, H.-H. Feucht, and D. Mack. 2001. Biofilm formation by Staphylococcus epidermidis depends on functional RsbU, an activator of the sigB operon: differential activation mechanisms due to ethanol and salt stress. J. Bacteriol. 183:2624-2633.[Abstract/Free Full Text]
30. Knobloch, J. K.-M., M. A. Horstkotte, H. Rohde, and D. Mack. 2002. Evaluation of different detection methods of biofilm formation in Staphylococcus aureus. Med. Microbiol. Immunol. (Berlin) 191:101-106.[CrossRef][Medline]
31. Kristian, S. A., T. Golda, F. Ferracin, S. E. Cramton, B. Neumeister, A. Peschel, F. Gotz, and R. Landmann. 2004. The ability of biofilm formation does not influence virulence of Staphylococcus aureus and host response in a mouse tissue cage infection model. Microb. Pathog. 36:237-245.[CrossRef][Medline]
32. Kristian, S. A., X. Lauth, V. Nizet, F. Goetz, B. Neumeister, A. Peschel, and R. Landmann. 2003. Alanylation of teichoic acids protects Staphylococcus aureus against Toll-like receptor 2-dependent host defense in a mouse tissue cage infection model. J. Infect. Dis. 188:414-423.[CrossRef][Medline]
33. Logsdon, L. K., and J. Mecsas. 2003. Requirement of the Yersinia pseudotuberculosis effectors YopH and YopE in colonization and persistence in intestinal and lymph tissues. Infect. Immun. 71:4595-4607.[Abstract/Free Full Text]
34. Mack, D., K. Bartscht, S. Dobinsky, M. A. Horstkotte, K. Kiel, J. K. Knobloch, and P. Schäfer. 2000. Staphylococcal factors involved in adhesion and biofilm formation on biomaterials, p. 307-330. In Y. H. An and R. J. Friedman (ed.), Handbook for studying bacterial adhesion: principles, methods, and applications. Humana Press Inc., Totowa, N.J.
35. Mack, D., W. Fischer, A. Krokotsch, K. Leopold, R. Hartmann, H. Egge, and R. Laufs. 1996. The intercellular adhesin involved in biofilm accumulation of Staphylococcus epidermidis is a linear ß-1,6-linked glucosaminoglycan: purification and structural analysis. J. Bacteriol. 178:175-183.[Abstract/Free Full Text]
36. Mack, D., M. Nedelmann, A. Krokotsch, A. Schwarzkopf, J. Heesemann, and R. Laufs. 1994. Characterization of transposon mutants of biofilm-producing Staphylococcus epidermidis impaired in the accumulative phase of biofilm production: genetic identification of a hexosamine-containing polysaccharide intercellular adhesin. Infect. Immun. 62:3244-3253.[Abstract/Free Full Text]
37. Mack, D., J. Riedewald, H. Rohde, T. Magnus, H. H. Feucht, H.-A. Elsner, R. Laufs, and M. E. Rupp. 1999. Essential functional role of the polysaccharide intercellular adhesin of Staphylococcus epidermidis in hemagglutination. Infect. Immun. 67:1004-1008.[Abstract/Free Full Text]
38. Mack, D., H. Rohde, S. Dobinsky, J. Riedewald, M. Nedelmann, J. K.-M. Knobloch, H.-A. Elsner, and H. H. Feucht. 2000. Identification of three essential regulatory gene loci governing expression of Staphylococcus epidermidis polysaccharide intercellular adhesin and biofilm formation. Infect. Immun. 68:3799-3807.[Abstract/Free Full Text]
39. Mack, D., N. Siemssen, and R. Laufs. 1992. Parallel induction by glucose of adherence and a polysaccharide antigen specific for plastic-adherent Staphylococcus epidermidis: evidence for functional relation to intercellular adhesion. Infect. Immun. 60:2048-2057.[Abstract/Free Full Text]
40. Martín-López, J. V., E. Pérez-Roth, F. Claverie-Martín, O. Díez Gil, N. Batista, M. Morales, and S. Méndez-Álvarez. 2002. Detection of Staphylococcus aureus clinical isolates harboring the ica gene cluster needed for biofilm establishment. J. Clin. Microbiol. 40:1569-1570.[Free Full Text]
41. McKenney, D., K. L. Pouliot, Y. Wang, V. Murthy, M. Ulrich, G. Doring, J. C. Lee, D. A. Goldmann, and G. B. Pier. 1999. Broadly protective vaccine for Staphylococcus aureus based on an in vivo-expressed antigen. Science 284:1523-1527.[Abstract/Free Full Text]
42. Muller, E., S. Takeda, H. Shiro, D. Goldmann, and G. B. Pier. 1993. Occurrence of capsular polysaccharide/adhesin among clinical isolates of coagulase-negative staphylococci. J. Infect. Dis. 168:1211-1218.[Medline]
43. Novick, R. 1991. Genetic systems in staphylococci. Methods Enzymol. 204:587-636.[Medline]
44. Peacock, S. J., C. E. Moore, A. Justice, M. Kantzanou, L. Story, K. Mackie, G. O'Neill, and N. P. J. Day. 2002. Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect. Immun. 70:4987-4996.[Abstract/Free Full Text]
45. Peng, H. L., R. P. Novick, B. Kreiswirth, J. Kornblum, and P. Schlievert. 1988. Cloning, characterization, and sequencing of an accessory gene regulator (agr) in Staphylococcus aureus. J. Bacteriol. 170:4365-4372.[Abstract/Free Full Text]
46. Rachid, S., K. Ohlsen, U. Wallner, J. Hacker, M. Hecker, and W. Ziebuhr. 2000. Alternative transcription factor {sigma}B is involved in regulation of biofilm expression in a Staphylococcus aureus mucosal isolate. J. Bacteriol. 182:6824-6826.[Abstract/Free Full Text]
47. Rohde, H., J. K. Knobloch, M. A. Horstkotte, D. Mack, C. R. Arciola, L. Montanaro, and L. Baldassarri. 2001. Correlation of Staphylococcus aureus icaADBC genotype and biofilm expression phenotype. J. Clin. Microbiol. 39:4595-4596.[Free Full Text]
48. Rupp, M. E., P. D. Fey, C. Heilmann, and F. Gotz. 2001. Characterization of the importance of Staphylococcus epidermidis autolysin and polysaccharide intercellular adhesin in the pathogenesis of intravascular catheter-associated infection in a rat model. J. Infect. Dis. 183:1038-1042.[CrossRef][Medline]
49. Rupp, M. E., J. S. Ulphani, P. D. Fey, K. Bartscht, and D. Mack. 1999. Characterization of the importance of polysaccharide intercellular adhesin/hemagglutinin of Staphylococcus epidermidis in the pathogenesis of biomaterial-based infection in a mouse foreign body infection model. Infect. Immun. 67:2627-2632.[Abstract/Free Full Text]
50. Rupp, M. E., J. S. Ulphani, P. D. Fey, and D. Mack. 1999. Characterization of Staphylococcus epidermidis polysaccharide intercellular adhesin/hemagglutinin in the pathogenesis of intravascular catheter-associated infection in a rat model. Infect. Immun. 67:2656-2659.[Abstract/Free Full Text]
51. Tsukayama, D. T., R. Estrada, and R. B. Gustilo. 1996. Infection after total hip arthroplasty. A study of the treatment of one hundred and six infections. J. Bone Joint Surg. Am. 78:512-523.[Abstract/Free Full Text]
52. Valle, J., A. Toledo-Arana, C. Berasain, J. M. Ghigo, B. Amorena, J. R. Penades, and I. Lasa. 2003. SarA and not sigmaB is essential for biofilm development by Staphylococcus aureus. Mol. Microbiol. 48:1075-1087.[CrossRef][Medline]
53. Vuong, C., C. Gerke, G. A. Somerville, E. R. Fischer, and M. Otto. 2003. Quorum-sensing control of biofilm factors in Staphylococcus epidermidis. J. Infect. Dis. 188:706-718.[CrossRef][Medline]
54. Wolz, C., C. Goerke, R. Landmann, W. Zimmerli, and U. Fluckiger. 2002. Transcription of clumping factor A in attached and unattached Staphylococcus aureus in vitro and during device-related infection. Infect. Immun. 70:2758-2762.[Abstract/Free Full Text]
55. Wolz, C., D. McDevitt, T. J. Foster, and A. L. Cheung. 1996. Influence of agr on fibrinogen binding in Staphylococcus aureus Newman. Infect. Immun. 64:3142-3147.[Abstract]
56. Zdanowski, Z., E. Ribbe, and C. Schalen. 1993. Influence of some plasma proteins on in vitro bacterial adherence to PTFE and Dacron vascular prostheses. APMIS 101:926-932.[Medline]
57. Ziebuhr, W., C. Heilmann, F. Götz, P. Meyer, K. Wilms, E. Straube, and J. Hacker. 1997. Detection of the intercellular adhesion gene cluster (ica) and phase variation in Staphylococcus epidermidis blood culture strains and mucosal isolates. Infect. Immun. 65:890-896.[Abstract]
58. Zimmerli, W., and P. E. Ochsner. 2003. Management of infection associated with prosthetic joints. Infection 31:99-108.[CrossRef][Medline]
59. Zimmerli, W., F. A. Waldvogel, P. Vaudaux, and U. E. Nydegger. 1982. Pathogenesis of foreign body infection: description and characteristics of an animal model. J. Infect. Dis. 146:487-497.[Medline]


Infection and Immunity, March 2005, p. 1811-1819, Vol. 73, No. 3
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.3.1811-1819.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fluckiger, U.
Right arrow Articles by Wolz, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fluckiger, U.
Right arrow Articles by Wolz, C.


Home