This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Green, C. B.
Right arrow Articles by Hoyer, L. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Green, C. B.
Right arrow Articles by Hoyer, L. L.

 Previous Article  |  Next Article 

Infection and Immunity, March 2005, p. 1852-1855, Vol. 73, No. 3
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.3.1852-1855.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Use of Green Fluorescent Protein and Reverse Transcription-PCR To Monitor Candida albicans Agglutinin-Like Sequence Gene Expression in a Murine Model of Disseminated Candidiasis

Clayton B. Green,1 Xiaomin Zhao, and Lois L. Hoyer*

Department of Veterinary Pathobiology, University of Illinois, Urbana, Illinois1

Received 30 July 2004/ Returned for modification 1 September 2004/ Accepted 28 October 2004


arrow
ABSTRACT
 
Candida albicans PALS-green fluorescent protein (GFP) reporter strains were inoculated into mice in a disseminated candidiasis model, and GFP production was monitored by immunohistochemistry and reverse transcription-PCR (RT-PCR). GFP production from the ALS1 and ALS3 promoters was detected immunohistochemically. ALS1, ALS2, ALS3, ALS4, and ALS9 transcription was detected by RT-PCR, further identifying ALS genes expressed in this model.


arrow
TEXT
 
Disseminated candidiasis is a life-threatening disease manifestation with mortality rates as high as 40% (1, 14). Candida albicans is the fourth most commonly isolated organism from bloodstream infections in hospitalized patients (13). As a resident of normal intestinal flora, C. albicans can enter the bloodstream across the intestinal wall. Alternatively, contaminated central venous catheters can serve as a nidus for disseminated infections (5). One of the most commonly used animal models of disseminated candidiasis is the murine tail vein model (12). After injection of yeast into the lateral tail vein of a mouse, C. albicans leaves the circulatory system and is capable of invading essentially every parenchymal organ. Death generally occurs from renal failure, but fungal elements have been observed in the spleen, liver, heart, lungs, and central nervous system (12). Therefore, in the progression of disseminated candidiasis, the fungus is exposed to multiple microenvironments that can influence expression of genes involved in host-pathogen interactions.

ALS genes are large open reading frames that encode proteins with features of cell-surface glycoproteins (8). The cell surface localization of some of these proteins is known (6, 9, 10) and assumed to be the same for the remaining proteins in the family. In an initial study, an antiserum raised against four 10-mer peptide sequences from Als1p was used for immunohistochemical analysis of tissue sections from C. albicans-infected mice (10). This antiserum recognized several different Als proteins on Western blots (10). Als proteins were distributed uniformly on the cell wall of fungal elements within parenchymal organs of mice inoculated via lateral tail vein injection. In this study, all fungal cells in each tissue section were detected using the antiserum, suggesting the widespread presence of Als proteins within the host. This staining pattern was found for all C. albicans strains tested and over the time course of infection. Although this work demonstrated the production of Als proteins in vivo, it was limited by the lack of availability of specific antisera for each of the Als proteins. The goal of this study was to detect expression of individual ALS genes to learn which Als proteins may be produced during disseminated infection in the mouse model.

Key to the approach taken here is a set of C. albicans strains in which the green fluorescent protein (GFP) reporter gene is under control of different ALS promoters. Construction and validation of these strains was described previously (7a). In each strain, GFP is integrated downstream of the ALS promoter at the native ALS locus. Strains 2225 (PALS1-GFP), 2185 (PALS3-GFP), 2227 (PALS5-GFP), 2223 (PALS6-GFP), 2224 (PALS7-GFP), and 2337 (PALS9-GFP) were used in this study. A C. albicans strain that produces GFP under the control of the strong, constitutive TPI1 promoter was constructed as a positive control for these analyses. For the control strain, GFP was cloned into a modified version of CIp10 (11), called plasmid 1105. To create plasmid 1105, the BglII site of CIp10 was destroyed by digestion, filling in with Klenow fragment, and religation of the blunt ends. The resulting construct was digested with KpnI-MluI to remove the polylinker region. The vector was modified to include a C. albicans TPI1 promoter and terminator with a polylinker between the sequences for high-level constitutive expression of C. albicans genes. The DNA sequence of TPI1 is deposited in the GenBank database under accession number AF124845.

The TPI1 promoter-terminator construct was originally made for plasmid pRC2312 (2) by amplification of the TPI1 promoter from strain 1161 genomic DNA by the use of primers Exp2 (5' CCC GCG GCC GCA ACC CGG GAA CTC GAG TGT TTC TAA AAT TGT ATA AAT GTA TTA ATT G 3') and Exp5 (5' CCA AGC TTG AAG TGG TTC AAG TGG AGT TAC GAA G 3'). The TPI1 terminator was amplified from strain 1161 genomic DNA by the use of primers Exp3 (5' CCC GCG GCC GCA AAG ATC TTA GCT AAG TGA ACA GTA TAT TAA AAA CTA TAT GCC TAT AG 3') and Exp6 (5' CCC CTG CAG CTG CTT GTA GAG TTG ATA TTA ATC ATC 3'). The promoter-containing fragment was digested with HindIII-NotI, and the terminator was digested with NotI-PstI and ligated into HindIII-PstI-cut pRC2312 in a three-part ligation.

Amplification with these primers created the promoter-terminator fragment with a polylinker between them that included the following sites (5' to 3'): XhoI-SmaI-NotI-BglII. DNA sequencing of the construct ensured accurate amplification and the presence of all expected restriction sites. This entire fragment was amplified from the pRC2312-based construct by the use of primers Exp7 (5' CCC GGT ACC GAA GTG GTT CAA GTG GAG TTA CGA AGA G 3') and Exp8 (5' CCC ACG CGT CTG CTT GTA GAG TTG ATA TTA ATC ATC 3'), digested with KpnI-MluI, and cloned into KpnI-MluI-digested BglII-less CIp10 to form plasmid 1105. GFP was amplified from plasmid pYGFP3, which was a generous gift from Brendan Cormack (Johns Hopkins University) (4), by the use of primers GFPXhoI (5' CCCTCGAGTATTAAAATGTCTAAAGGTGAAGAATTATTCACT 3') and GFPBglII (5' CCCACGCGTCTGCTTGTAGAGTTGATAGGAATCATC 3'). The GFP PCR product was digested with XhoI and BglII and cloned into plasmid 1105, which had been digested with the same enzymes. The resulting plasmid (called 1110) was linearized with StuI to direct integration to the RP10 locus and transformed into C. albicans CAI4 by use of the methods described above. The resulting strain, 1143, was verified by BglII restriction mapping and Southern blotting with probes for TPI1, the ß-lactamase-encoding gene, and GFP as described elsewhere (7a). Strain 1143 exhibited the expected high-level, constitutive production of GFP as visualized by fluorescence microscopy, further validating the construct.

Female BALB/cByJ mice (7 weeks old) were purchased from Jackson Laboratories. C. albicans strains were grown in YPD liquid medium (10 g of yeast extract/liter, 20 g of peptone/liter, 20 g of dextrose/liter) as described previously for growth rate analysis (15). Cells were washed three times in phosphate-buffered saline, diluted, and counted in triplicate using a hemacytometer. A total of 2 million yeast cells in a volume of 0.1 ml were injected into the lateral tail vein of each mouse. Each C. albicans strain was injected into six mice, two of which were euthanized at each time point (12, 24, and 48 h) after infection. All animal protocols were conducted under approval by the University of Illinois Institutional Animal Care and Use Committee. Mice were dissected to remove the kidneys, heart, liver, spleen, and lungs. One kidney was diced with a fresh razor blade, flash frozen in liquid nitrogen, and stored at –80°C for subsequent RNA isolation and reverse transcription-PCR (RT-PCR) analysis (see below). The remainder of the tissues were fixed in 10% neutral buffered formalin for approximately 48 h, trimmed, embedded in paraffin, and sectioned. Sections were stained with hematoxylin-eosin and Gomori methenamine silver (GMS) for histopathology analysis. Unstained sections were used for immunohistochemical analysis that followed the method of Hoyer et al. (10) with two exceptions. First, formalin fixation masked GFP epitopes, requiring an antigen retrieval process. Slides were immersed in pH 6.0 citrate buffer (18 ml of 0.1 M monobasic citric acid/liter, 82 ml of 0.1 M sodium citrate/liter), brought to boiling for 4 min in a microwave, and maintained at an intermittent boil for 10 min. Slides were cooled at room temperature for approximately 30 min and then washed three times (5 min each) with phosphate-buffered saline (pH 7.2) before quenching of endogenous peroxidase activity with 0.5% hydrogen peroxide in methanol. Second, a polyclonal anti-GFP preparation was used in this study (catalog number NB 600-308; Novus) at a 1:100 dilution and incubated on slides overnight at 4°C.

Total RNA was recovered from mouse kidneys by homogenizing tissue in Tris-EDTA-sodium dodecyl sulfate and following an acid-phenol extraction protocol (3). RNA yield was determined spectrophotometrically, and approximately 100 µg of total RNA was further purified using an RNeasy kit (QIAGEN) according to instructions. Samples were then DNase treated (Ambion) at 37°C overnight, and 200 ng of RNA was screened by PCR with the ALS9 RT-PCR primers to check for genomic DNA as previously described (7). A parallel reaction that included C. albicans genomic DNA was run as a positive control for the PCR. DNA-free RNA was precipitated for 30 min at –80°C with ethanol, 5 M ammonium acetate, and linear acrylamide (Ambion) and then pelleted. RNA pellets were resuspended in 20 µl of RNase-free water, and the yield was determined spectrophotometrically. An additional control reaction for the absence of genomic DNA was run after RNA precipitation by the use of a quantity of RNA equal to that used in the RT-PCRs. RT-PCR followed the protocol of Green et al. (7); 2 µg of RNA were added to each cDNA synthesis, and 1/10 of the final cDNA product was added to PCRs specific for each ALS gene. GFP RT-PCRs used the primers GFPRTF (5' TCTGTCTCCGGTGAAGGTGAAG 3') and GFPRTR (5' GGCATGGCAGACTTGAAAAAG 3').

Tissue sections recovered from each mouse were GMS stained to visualize fungal elements. The extent of fungal burden in each organ was determined by microscopic examination. The time course of infection for these mice matched that described by Hoyer et al. (10), which showed a hierarchy of organ infection (Table 1). In both cases, the kidneys had the most extensive fungal burden, followed by the heart. The liver and spleen in each animal were lightly infected with fungal elements mainly restricted to the phagocytic cells. Fungal elements were not observed in lung tissue in any of the mice. Tissue sections were also immunostained with an anti-GFP polyclonal antiserum. Examination of sections containing the PTPI1-GFP positive control strain and strain CAI12 (non-GFP-producing negative control strain) validated the assay (Fig. 1; Table 1). For each mouse in which fungal elements were detected in the kidneys and heart by GMS staining, GFP production from the ALS1 and ALS3 promoters was also observed by immunostaining (Table 1). Representative images from mice inoculated with the PALS1-GFP and PALS3-GFP strains are shown in Fig. 1. Although GMS-stained fungal cells were present in mice inoculated with the other reporter strains, fungi did not stain immunohistochemically with the anti-GFP serum. These results could be due to lack of transcriptional activity from the other ALS promoters in this model or to transcriptional activity that was below the detection limit for this assay.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Observations from GMS- and immunohistochemically stained C. albicans-inoculated mouse tissue sectionsa



View larger version (77K):
[in this window]
[in a new window]
 
FIG. 1. GMS-stained (upper panels) and anti-GFP immunohistochemically stained (lower panels) tissue sections from C. albicans-infected mice. The strains used for inoculation are listed above each pair of panels. The left three panels (strains PTPI1-GFP, CAI12, and PALS1-GFP) show kidney tissue 48 h after infection. The right two panels (PALS1-GFP and PALS3-GFP) show heart tissue 24 h after infection. Inoculation of mice with the PTPI1-GFP strain produced strong, constitutive GFP production and obvious immunohistochemical staining. Staining of tissues infected with strain CAI12, which does not produce GFP, was performed as a negative control. Anti-GFP staining of strains producing GFP under the control of the ALS1 or ALS3 promoter was obvious in all kidney and heart sections in which GMS-stained fungal cells were present. Images were taken at x400 magnification.

To distinguish between these possibilities, total RNA extracted from C. albicans-infected kidneys was analyzed by RT-PCR. In previous work, RT-PCR analysis of cultured C. albicans cells was sensitive enough to detect transcription from all ALS promoters in the presence of sufficient quantities of fungal RNA (7, 7a). RT-PCR using GFP-specific primers showed that under the control of the strong, constitutive TPI1 promoter, GFP-specific transcript was detected in the total kidney RNA from each mouse tested (Table 2). Signals from the ALS1 and ALS3 promoters were also observed, with detection increasing later in the time course of infection. This result presumably is due to the increased number of fungal cells in the kidney at later time points and the consequent increased ratio of fungal RNA to host RNA in the assayed samples. RT-PCR with GFP-specific primers detected transcription from the ALS9 promoter at the 24 h time point (Table 2). RT-PCR analysis was also done using a set of primers specific for each ALS gene (7). Results were similar to those from the GFP-specific RT-PCR analysis in that transcription from the ALS1, ALS3, and ALS9 promoters was detected (Table 3). Transcription from the ALS2 promoter was observed with a frequency similar to that from ALS1, mirroring results from a previous study that suggested that the levels of ALS1 and ALS2 transcript were similar in cultured cells (7). Transcription from the ALS4 promoter was observed in a minority of the samples assayed. Transcription from the ALS5, ALS6, and ALS7 promoters was not detected with any method used.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Results of GFP-specific RT-PCRs from analysis of total kidney RNA from mice inoculated with C. albicans PALS-GFP reporter strains


View this table:
[in this window]
[in a new window]
 
TABLE 3. Percent positive ALS-specific RT-PCR from analysis of total kidney RNA from mice inoculated with C. albicansa

In the experiments described here, various methods of detecting ALS gene expression were used as a means to infer which Als proteins are produced in the murine model of disseminated candidiasis. Immunostaining of reporter protein and RT-PCR to detect reporter gene and ALS transcription detected expression of ALS1, ALS2, ALS3, ALS4, and ALS9 under the conditions tested. Expression of more ALS genes was detected using RT-PCR than was detected using immunostaining, presumably because of the amplification-based nature of the RT-PCR technique. The relative ease of detection of transcription of some genes over that of others suggests that these genes are characterized by a stronger transcriptional response. The hierarchy observed here is similar to that found in cultured cell models and other disease models (7, 7a) and further supports the conclusion that the ALS family can be divided into two groups: one that is regulated by strong transcriptional responses and another that is characterized by lesser activity. Indication of signals from ALS5, ALS6, and ALS7 was absent from the present analysis. These ALS genes may be expressed during parenchymal organ infection, but the level of expression may simply be below the limit of detection for the assays utilized here. In this work and previous studies (7), the ratio of C. albicans RNA to host RNA appeared to strongly influence the ability to detect ALS transcripts. For example, it was easier to detect GFP in 12-h lesions by immunohistochemical staining than it was to detect GFP-specific transcript from the kidneys of the same animals. In this situation, the reporter protein was localized in an obvious region of a tissue section. RT-PCR at the same time point requires amplification of a specific transcript that is relatively rare compared to the host RNA present. It is therefore important to consider multiple approaches to gene expression analysis, as techniques differ in their limits of detection. Techniques that allow enrichment for fungal RNA among the total RNA extracted from C. albicans-infected kidneys would likely reveal the presence of ALS5-, ALS6-, and ALS7-specific transcripts. Alternatively, in situ PCR, with its combination of amplification and localization, might detect these transcripts, although designing probes that do not cross-react with other ALS sequences would be challenging. Ultimately, carefully validated monoclonal antibodies specific for each Als protein should be produced.

Use of these reagents would provide data regarding cellular localization of Als protein production with an improved detection limit, since the protein products from both ALS alleles could be assayed, rather than transcription and translation from the single allele inherent in the GFP approach used here. Regardless of detection limit, the comparison of the original staining for Als protein with the results presented here provides a hierarchy of transcriptional activity, from each ALS locus, in the murine tail vein disease model, supporting the hypothesis that certain Als proteins are abundantly produced in vivo and that others are less so. The identity of these proteins and their hierarchical arrangement in quantity parallel results gathered from other experimental approaches and present a consistent picture of ALS gene expression both in vitro and in vivo.


arrow
ACKNOWLEDGMENTS
 
We thank Jane Chladny and the histopathology staff of the Veterinary Diagnostic Laboratory for preparation and staining of slides.

This work was supported by Public Health Service grant DE14158 from the National Institute of Dental and Craniofacial Research, National Institutes of Health.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: 2522 VMBSB, 2001 S. Lincoln Ave., Urbana, IL 61802. Phone: (217) 333-5043. Fax: (217) 244-7421. E-mail: lhoyer{at}uiuc.edu. Back

Editor: T. R. Kozel


arrow
REFERENCES
 
    1
  1. Bennett, J. E. 2000. Introduction to mycoses, p. 2655-2656. In G. Mandell, J. Bennett, and R. Dolin Mandell (ed.), Douglas and Bennett's principles and practice of infectious diseases. Churchill Livingstone, Philadelphia, Pa.
  2. 2
  3. Cannon, R. D., H. F. Jenkinson, and M. G. Shepherd. 1992. Cloning and expression of Candida albicans ADE2 and proteinase genes on a replicative plasmid in C. albicans and in Saccharomyces cerevisiae. Mol. Gen. Genet. 235:453-457.[CrossRef][Medline]
  4. 3
  5. Collart, M. A., and S. Oliviero. 1993. Preparation of yeast RNA, 13.12.11-13.12.15. In F. Ausubel, R. Brent, R. Kingston, D. Moore, J. Seidman, J. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley and Sons, Inc., New York, N.Y.
  6. 4
  7. Cormack, B. P., G. Bertram, M. Egerton, N. A. R. Gow, S. Falkow, and A. J. P. Brown. 1997. Yeast-enhanced green fluorescent protein (yEGFP): a reporter of gene expression in Candida albicans. Microbiology 143:303-311.[Abstract/Free Full Text]
  8. 5
  9. Douglas, L. J. 2003. Candida biofilms and their role in infection. Trends Microbiol. 11:30-36.[CrossRef][Medline]
  10. 6
  11. Fu, Y., A. S. Ibrahim, D. C. Sheppard, Y. C. Chen, S. W. French, J. E. Cutler, S. G. Filler, and J. E. Edwards, Jr. 2002. Candida albicans Als1p: an adhesin that is a downstream effector of the EFG1 filamentation pathway. Mol. Microbiol. 44:61-72.[CrossRef][Medline]
  12. 7
  13. Green, C. B., G. Cheng, J. Chandra, M. A. Ghannoum, and L. L. Hoyer. 2004. RT-PCR detection of Candida albicans gene family expression in the reconstituted human epithelium (RHE) model of superficial oroesophageal candidiasis. Microbiology 150:267-275.[Abstract/Free Full Text]
  14. 7
  15. Green, C. B., X. Zhao, K. M. Yeater, and L. L. Hoyer. Construction and real-time RT-PCR validation of Candida albicans PALS-GFP reporter strains and their use in flow cytometry analysis of ALS gene expression in budding and filamenting cells. Microbiology, in press.
  16. 8
  17. Hoyer, L. L. 2001 The ALS gene family of Candida albicans. Trends Microbiol. 9:176-180.[CrossRef][Medline]
  18. 9
  19. Hoyer, L. L., T. L. Payne, and J. E. Hecht. 1998. Identification of Candida albicans ALS2 and ALS4 and localization of Als proteins to the fungal cell surface. J. Bacteriol. 180:5334-5343.[Abstract/Free Full Text]
  20. 10
  21. Hoyer, L. L., J. Clevenger, J. E. Hecht, E. J. Ehrhart, and F. M. Poulet. 1999. Detection of Als proteins on the cell wall of Candida albicans in murine tissues. Infect. Immun. 67:4251-4255.[Abstract/Free Full Text]
  22. 11
  23. Murad, A. M., P. R. Lee, I. D. Broadbent, C. J. Barelle, and A. J. Brown. 2000. CIp10, an efficient and convenient integrating vector for Candida albicans. Yeast 16:325-327.[CrossRef][Medline]
  24. 12
  25. Odds, F. C. 1988. Candida and candidosis, 2nd ed. Balliere Tindall, London, United Kingdom.
  26. 13
  27. Pfaller, M. A., R. N. Jones, S. A. Messer, M. B. Edmond, and R. P. Wenzel. 1998. National surveillance of nosocomial blood stream infection due to Candida albicans: frequency of occurrence and antifungal susceptibility in the SCOPE program. Diagn. Microbiol. Infect. Dis. 31:327-332.[CrossRef][Medline]
  28. 14
  29. Wey, S. B., M. Mori, M. A. Pfaller, R. F. Woolson, and R. P. Wenzel. 1988. Hospital-acquired candidemia. The attributable mortality and excess length of stay. Arch. Intern. Med. 148:2642-2645.[Abstract/Free Full Text]
  30. 15
  31. Zhao, X., S.-H. Oh, G. Cheng, C. B. Green, J. A. Nuessen, K. Yeater, R. P. Leng, A. J. P. Brown, and L. L. Hoyer. 2004. ALS3 and ALS8 represent a single locus that encodes a Candida albicans adhesin; functional comparison between Als3p and Als1p. Microbiology 150:2415-2428.[Abstract/Free Full Text]


Infection and Immunity, March 2005, p. 1852-1855, Vol. 73, No. 3
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.3.1852-1855.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Enjalbert, B., Rachini, A., Vediyappan, G., Pietrella, D., Spaccapelo, R., Vecchiarelli, A., Brown, A. J. P., d'Enfert, C. (2009). A Multifunctional, Synthetic Gaussia princeps Luciferase Reporter for Live Imaging of Candida albicans Infections. Infect. Immun. 77: 4847-4858 [Abstract] [Full Text]  
  • Chaffin, W. L. (2008). Candida albicans Cell Wall Proteins. Microbiol. Mol. Biol. Rev. 72: 495-544 [Abstract] [Full Text]  
  • Otoo, H. N., Lee, K. G., Qiu, W., Lipke, P. N. (2008). Candida albicans Als Adhesins Have Conserved Amyloid-Forming Sequences. Eukaryot Cell 7: 776-782 [Abstract] [Full Text]  
  • Zhao, X., Oh, S.-H., Hoyer, L. L. (2007). Unequal contribution of ALS9 alleles to adhesion between Candida albicans and human vascular endothelial cells. Microbiology 153: 2342-2350 [Abstract] [Full Text]  
  • Dranginis, A. M., Rauceo, J. M., Coronado, J. E., Lipke, P. N. (2007). A Biochemical Guide to Yeast Adhesins: Glycoproteins for Social and Antisocial Occasions. Microbiol. Mol. Biol. Rev. 71: 282-294 [Abstract] [Full Text]  
  • Zhao, X., Daniels, K. J., Oh, S.-H., Green, C. B., Yeater, K. M., Soll, D. R., Hoyer, L. L. (2006). Candida albicans Als3p is required for wild-type biofilm formation on silicone elastomer surfaces.. Microbiology 152: 2287-2299 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Green, C. B.
Right arrow Articles by Hoyer, L. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Green, C. B.
Right arrow Articles by Hoyer, L. L.