This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fine, D. H.
Right arrow Articles by Kaplan, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fine, D. H.
Right arrow Articles by Kaplan, J. B.

 Previous Article  |  Next Article 

Infection and Immunity, April 2005, p. 1947-1953, Vol. 73, No. 4
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.4.1947-1953.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

The Actinobacillus actinomycetemcomitans Autotransporter Adhesin Aae Exhibits Specificity for Buccal Epithelial Cells from Humans and Old World Primates

Daniel H. Fine,* Kabilan Velliyagounder, David Furgang, and Jeffrey B. Kaplan

Department of Oral Biology, New Jersey Dental School, Newark, New Jersey

Received 14 October 2004/ Returned for modification 16 November 2004/ Accepted 30 November 2004


arrow
ABSTRACT
 
Cells of the gram-negative periodontopathogen Actinobacillus actinomycetemcomitans express a surface-exposed, outer membrane autotransporter protein, designated Aae, which has been implicated in epithelial cell binding. We constructed a mutant strain of A. actinomycetemcomitans that contained a transposon insertion in the Aae structural gene (aae) and tested the mutant to determine its ability to bind to buccal epithelial cells (BECs) isolated from healthy volunteers. Significantly fewer mutant cells than wild-type cells bound to BECs. A broad-host-range plasmid that contained an intact aae gene driven by a heterologous tac promoter restored the ability of the mutant strain to bind to BECs at wild-type levels. This plasmid also conferred upon Escherichia coli the ability to express the Aae protein on its surface and to bind to human BECs. Aae-expressing E. coli also bound to BECs isolated from six Old World primates but not to BECs isolated from four New World primates or nine other nonprimate mammals, as well as to human gingival epithelial cells but not to human pharyngeal, palatal, tongue, bronchial, or cervical epithelial cells. Our findings indicate that Aae mediates binding of A. actinomycetemcomitans to BECs from humans and Old World primates and that this process may contribute to the host range specificity and tissue tropism exhibited by this bacterium.


arrow
INTRODUCTION
 
Actinobacillus actinomycetemcomitans is a gram-negative bacterium that colonizes the oral cavities of humans and Old World primates (3). In humans, A. actinomycetemcomitans causes a severe and rapid form of periodontal disease that affects adolescents (23). A. actinomycetemcomitans is also a member of the clinically important HACEK group of oral bacteria (Haemophilus parainfluenzae, Haemophilus aphrophilus, Haemophilus paraphrophilus, A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae), which has been implicated in the etiology of infective endocarditis (1). A. actinomycetemcomitans cells secrete leukotoxin, a 120-kDa lipoprotein that kills polymorphonuclear leukocytes and macrophages of humans and Old World primates (19). Leukotoxin is considered to be an important virulence factor which may also play a role in the observed host range specificity of A. actinomycetemcomitans.

A. actinomycetemcomitans forms extremely tenacious biofilms on inert surfaces in vitro (5), a property that may contribute to the ability of A. actinomycetemcomitans to colonize surfaces such as teeth and damaged heart tissue. Tight adherence is mediated by adhesive type IV pili which are composed of repeating subunits of a 6.5-kDa protein designated Flp-1 (10, 11). Mutants with mutations in the Flp-1 structural gene (flp-1) fail to form biofilms in vitro and are unable colonize the oral cavity, elicit an immune response, or cause bone loss in a rat model of periodontal disease (18). These findings suggest that biofilm formation plays an important role in the pathogenesis of A. actinomycetemcomitans. However, A. actinomycetemcomitans is routinely isolated from mucosal surfaces of predentate children as young as 20 days old (13, 20). In adults, A. actinomycetemcomitans is recovered more frequently and in higher numbers from oral mucosal surfaces than from subgingival and supragingival plaque, and mucosal surfaces can have high diagnostic value for identifying individuals colonized by A. actinomycetemcomitans (2, 15). These findings suggest that the oral mucosa is the initial site colonized by A. actinomycetemcomitans and the primary reservoir of A. actinomycetemcomitans in the oral cavity.

In vitro, A. actinomycetemcomitans is capable of binding to and invading epithelial cells (4, 14, 16), a property that may play a role in the ability of A. actinomycetemcomitans to colonize mucosal surfaces. Rose et al. (16) showed that A. actinomycetemcomitans cells express a 90-kDa surface-exposed protein, designated Aae, that is homologous to an epithelial cell adhesin (Hap) produced by H. influenzae (9). Aae is a member of the autotransporter family of bacterial proteins, which are characterized by a C-terminal domain that becomes integrated into the bacterial outer membrane and an N-terminal domain (the passenger domain) that is exposed on the cell surface (8). Rose et al. (16) showed that Aae mediates weak binding of A. actinomycetemcomitans to KB cells, a cell line that was originally thought to be derived from an epidermal carcinoma of the mouth but was subsequently found, based on isoenzyme, HeLa marker chromosome, and DNA fingerprinting analyses, to have been established via contamination by the human cervix carcinoma cell line HeLa (product information sheet ATCC CCL-17; American Type Culture Collection, Manassas, Va.).

In the present study we examined the host range specificity and tissue tropism of A. actinomycetemcomitans Aae. By using an A. actinomycetemcomitans aae knockout strain and a broad-host-range plasmid that expressed wild-type Aae in both A. actinomycetemcomitans and Escherichia coli, we obtained evidence that Aae mediates binding of A. actinomycetemcomitans to buccal epithelial cells (BECs) isolated specifically from humans and Old World primates.


arrow
MATERIALS AND METHODS
 
Bacterial strains and growth conditions. The bacterial strains used in this study are listed in Table 1. A. actinomycetemcomitans strains were cultured in 100-mm-diameter tissue-culture-treated polystyrene petri dishes (model 430167; Corning) containing 20 ml of Trypticase soy broth supplemented with 6 g of yeast extract per liter and 8 g of glucose per liter. Plasmids were mobilized into A. actinomycetemcomitans by using the RK2 oriT-defective mutant plasmid pRK21761as previously described (21). Plasmid-harboring strains of A. actinomycetemcomitans were cultured in medium containing 3 µg of chloramphenicol per ml. Inoculated culture vessels were incubated for 24 to 48 h at 37°C in an atmosphere containing 10% CO2. Cells were harvested by using a cell scraper, washed three times with phosphate-buffered saline (PBS), and then sonicated on ice for 30 s at 30% capacity with a 30% duty cycle by using a Branson model 450 sonicator equipped with a cup horn in order to disrupt cell aggregates. Previous studies showed that this brief sonication step had no effect on cell viability (4). Cell suspensions were adjusted to a concentration of ca. 107 CFU/ml, diluted in fresh PBS, and then mixed with epithelial cells as described below.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains and plasmids

E. coli strains were constructed by transforming plasmid DNAs into chemically competent DH5{alpha} cells (Invitrogen). E. coli transformants were cultured in 15-ml polypropylene tubes containing 3 ml of Luria-Bertani broth supplemented with 50 µg of chloramphenicol per ml. Inoculated tubes were incubated at 37°C with shaking until the culture reached the mid-log phase. Isopropyl-ß-D-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM, and the culture was incubated for an additional 3 h. Cells were washed three times with PBS, the concentration was adjusted to ca. 107 CFU/ml, and then the cells were mixed with epithelial cells as described below.

Construction of an aae knockout strain. Genomic DNA from A. actinomycetemcomitans strain CU1000 was amplified by PCR by using forward primer CGCGGATCCATAATGAAGAAAGTTTAGATGTGTTCTTTTTCAAA, which introduced a BamHI restriction site (underlined) 18 bp upstream of the aae initiation codon (boldface type), and reverse primer GGCGCTGCAGCTACCAGTAGTAATTCAGTTTTACTCC, which introduced a PstI restriction site (underlined) immediately downstream of the aae stop codon (boldface type). The PCR product (2.8 kb) was digested with BamHI and PstI and ligated into the BamHI/PstI sites of plasmid LITMUS28. The DNA sequence of the insert from the resulting plasmid (pVK45) was 99.4% identical (37 base changes) to the DNA sequence of aae from strain HK1651 (GenBank accession no. AY262734). Plasmid pVK45 was mutagenized with an EZ-TN transposon mutagenesis kit (Epicentre), which inserted a copy of the 2.0-kb kanamycin resistance transposon R6K{gamma}ori/KAN randomly into the plasmid. One plasmid (designated pVK52) contained a transposon insertion near the middle of aae at codon position 376. Plasmid pVK52 was used to transform A. actinomycetemcomitans strain IDH781N to kanamycin resistance by using a natural transformation protocol supplied by Mrinal Bhattacharjee and David Figurski (Columbia University). Genomic DNA isolated from the transformants was amplified by PCR by using the primers described above. One transformant (designated JK1046) which produced a PCR product that was 2.0 kb larger than that produced by strain IDH781N was selected. The insertion of transposon R6K{gamma}ori/KAN into the chromosomal aae locus of strain JK1046 was confirmed by DNA sequence analysis across the transposon junctions.

Genetic complementation of the aae mutation. The BamHI/PstI insert from pVK45 was ligated into the BamHI/PstI sites of the broad-host-range plasmid pJAK16, which placed aae under control of an IPTG-inducible tac promoter. The resulting plasmid (pVK43) was mobilized into A. actinomycetemcomitans strain IDH781N as described above. Transconjugants were grown in medium supplemented with 1 mM IPTG.

Construction of an flp-1 knockout strain. A. actinomycetemcomitans strain IDH781N was transformed to kanamycin resistance with genomic DNA isolated from A. actinomycetemcomitans strain JK1009 by using the natural transformation protocol described above. Strain JK1009 contains an IS903{phi}kan transposon insertion in the beginning of the flp-1 gene, which results in complete loss of pilus protein production and biofilm formation (11). Genomic DNA isolated from the transformants was amplified by PCR by using flp-1-specific primers which flanked the transposon insertion sites (12). One transformant (designated JK1047) that produced a PCR product of the expected size was selected. The transposon insertion site in the chromosome of strain JK1047 was confirmed by DNA sequence analysis. Genetic complementation of the flp-1 mutation in strain JK1047 was carried out by using plasmid pRA33, which contained wild-type flp-1 under control of an IPTG-inducible tac promoter.

Polystyrene adherence assay. A quantitative adherence assay was carried out in 96-well polystyrene microtiter plates as previously described (11). Briefly, cells were inoculated into the wells of the microtiter plates and allowed to adhere for 1 h. Loosely adherent cells were removed by washing, and adherent cells were stained with crystal violet for 10 min and then washed extensively. The crystal violet remaining in each well was then solubilized in ethanol, and the absorbance of the solution at 595 nm was measured. Adherence was proportional to optical density. Polystyrene adherence assays were performed three times with similar results.

Isolation of epithelial cells. Buccal epithelial cells were collected from healthy human volunteers and from various mammalian species by scraping the inside of a cheek with a sterile tongue depressor. Cells were collected in 5 ml of PBS, washed once, and resuspended in PBS. BECs were counted with a hemocytometer and diluted in PBS to obtain a concentration of 103 to 104 cells/ml.

Human gingival, palatal, and tongue epithelial cells were collected by using a similar method. Cell lines A-549 (ATCC CCL-185; American Type Culture Collection), NHBE (BioWhittaker, Walkersville, Md.), and KB (ATCC CCL-17) were used as sources of human alveolar, bronchial, and cervical epithelial cells, respectively.

Epithelial cell binding assay. Binding of A. actinomycetemcomitans and E. coli cells to epithelial cells was measured by using the assay described by Fine and Furgang (4). Briefly, 250 µl of epithelial cells was mixed with 250 µl of bacterial cells in a 2-ml polypropylene microcentrifuge tube, resulting in a ratio of 103 to 104 bacterial cells per epithelial cell. The tube was gently rotated for 90 min at 37°C. The epithelial cells were separated from unbound bacteria by centrifugation through a Ficoll gradient, and the bacteria bound to the epithelial cells were diluted and plated on agar for enumeration. Attachment of bacterial cells to epithelial cells was confirmed by direct microscopic visualization of rhodamine-labeled E. coli against a fluorescein-cytokeratin-labeled BEC background. All assays were performed in duplicate and on at least three separate occasions. The significance of differences in binding was determined by using an unpaired, two-tailed t test (P < 0.05).

Preparation of anti-Aae antiserum. The N-terminal portion of aae that encodes the surface-exposed passenger domain of the Aae adhesin (corresponding to bp 160 to 1,878 in GenBank accession no. AY487820) was amplified by PCR by using genomic DNA isolated from A. actinomycetemcomitans strain CU1000 as a target. The forward primer (TCAACCGGCACATATGTCAGAGTTTAATGCTCA) introduced an NdeI restriction site (underlined) upstream of aae codon 54, and the reverse primer (GCTCGGTACCTGGGTTATATATCGTTGGG) introduced a KpnI restriction site (underlined) downstream of aae codon 626. The PCR product (1,754 bp) was digested with NdeI and KpnI and ligated into the NdeI/KpnI sites of the T7 expression vector pET-29b (Novagen), resulting in plasmid pVK71. Recombinant Aae passenger domain protein was purified from cultures of E. coli strain BL21(DE3) carrying pVK71 by using an Ni affinity column (Pharmacia model 154-0990). Immunization and bleeding of specific-pathogen-free female New Zealand White rabbits were carried out by Pocono Rabbit Farm and Laboratory (Canadensis, Pa.). The specificity of the rabbit antiserum was confirmed by probing filters containing immobilized Aae passenger domain with both preimmune and postimmune sera.

Microscopic assays for functional analysis. Human BECs and E. coli cells were mixed and incubated as described above. BECs incubated in the absence of bacterial cells were used as controls in all experiments. After Ficoll gradient centrifugation, BECs were washed with PBS and heat fixed onto glass microscope slides.

For immunofluorescence microscopy, microscope slides were treated with anti-Aae antiserum (diluted 1:160) for 60 min at room temperature to label bacterial cells. The slides were then washed twice in PBS and once in distilled water and air dried. The slides were then treated with a 1:20 dilution of tetramethyl rhodamine isocyanate-conjugated goat anti-rabbit immunoglobulin G (Sigma catalog no. T6778) for 60 min, washed with water, and air dried. To label BECs, slides were treated with a 1:50 dilution of fluorescein isothiocyanate-conjugated anti-cytokeratin monoclonal antibody (Sigma catalog no. F3418) for 60 min, washed with water, and air dried. The slides were viewed at a magnification of x400 by using an Olympus BX50WI fluorescence microscope equipped with fluorescein and rhodamine filters. Individual tetramethyl rhodamine isocyanate and fluorescein isothiocyanate images of each field were digitized and combined in Adobe Photoshop 4.0 to obtain a single dual-fluorescence image.

For crystal violet staining, microscope slides were treated with Gram crystal violet solution (Fisher catalog no. 23-291472) for 60 s and then rinsed extensively with distilled water and air dried. The slides were viewed at a magnification of x400 by using an Olympus BX50WI microscope under bright-field conditions. Images of each field were recorded and digitized with a computer.

Nucleotide sequence accession number. The DNA sequence of aae from A. actinomycetemcomitans strain CU1000 has been deposited in the GenBank database under accession no. AY487820.


arrow
RESULTS
 
A. actinomycetemcomitans aae mutant is deficient in human buccal epithelial cell binding. We constructed an isogenic mutant of the transformable A. actinomycetemcomitans strain IDH781N which contained a transposon insertion at codon position 376 of aae. This aae mutant strain (designated JK1046) and parental strain IDH781N were tested to determine their abilities to bind to BECs isolated from healthy volunteers (Fig. 1A). Significantly more wild-type cells than mutant cells bound to BECs (210 ± 14 and 14 ± 4 bacterial cells per BEC, respectively; P < 0.01). A plasmid carrying a wild-type aae gene under control of a heterologous IPTG-inducible tac promoter (plasmid pVK43) restored the ability of the mutant strain to bind to BECs at wild-type levels (Fig. 1A). The aae mutant exhibited wild-type levels of biofilm formation when it was tested in a 96-well microtiter plate biofilm assay (Fig. 1B). In contrast, a strain which contained a transposon insertion in flp-1 (strain JK1047) exhibited significantly reduced biofilm formation in the microtiter plate assay (Fig. 1B). These findings indicate that Aae mediates binding of A. actinomycetemcomitans to oral epithelial cells but not to abiotic surfaces.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. Binding characteristics of wild-type A. actinomycetemcomitans strain IDH781 and isogenic aae mutant strain JK1046. (A) BEC binding assay. The bars indicate the mean numbers of A. actinomycetemcomitans (Aa) cells per BEC for duplicate samples, and the error bars indicate ranges. Plasmid pJAK16 was the vector, and plasmid pVK43 was pJAK16 containing aae. (B) Biofilm formation in the wells of a 96-well microtiter plate. The optical density at 590 nm [OD (590 nm)] was proportional to biofilm formation. Strain JK1047 is an isogenic flp-1 mutant of strain IDH781N that lacks adhesive pili. Plasmid pRA33 is pJAK16 containing flp-1. (C) Binding to BECs isolated from humans and various mammalian species. Solid bars, wild-type strain IDH781; open bars, aae mutant strain JK1046. The asterisks indicate Old World primates. The bars indicate the mean numbers of A. actinomycetemcomitans (Aa) cells per BEC for duplicate samples, and the error bars indicate ranges. The values for species lacking bars were <1 bacterial cell per 1,000 BECs.

Host range specificity of Aae. We tested A. actinomycetemcomitans wild-type strain IDH781N and the aae mutant strain JK1046 to determine their abilities to bind to BECs isolated from six Old World primates, four New World primates, and nine nonprimate mammals (Fig. 1C). Strain IDH781N bound to BECs isolated from Old World primates, rats, and cows. In contrast, strain JK1046 bound at lower levels to BECs isolated from humans and Old World primates and at wild-type levels to BECs isolated from rats and cows. These data suggest that Aae recognizes a receptor present on the surface of BECs of humans and Old World primates and that one or more other adhesins mediate binding of A. actinomycetemcomitans to BECs derived from rats and cows.

Expression of aae in E. coli. Plasmid pVK43 was transformed into E. coli strain DH5{alpha}. Transformants expressed Aae protein on the surface, as determined by immunofluorescence microscopy with anti-Aae antiserum and a rhodamine-labeled anti-rabbit immunoglobulin G secondary antibody (Fig. 2A and B). Microscopic examination of both rhodamine-labeled E. coli against a fluorescein-cytokeratin-labeled BEC background (Fig. 2C and D) and crystal violet-stained bacterial cells (Fig. 2E and F) confirmed that E. coli cells expressing Aae bound to human BECs.



View larger version (67K):
[in this window]
[in a new window]
 
FIG. 2. Functional expression of A. actinomycetemcomitans aae in E. coli. (A, C, and E) E. coli strain DH5{alpha} carrying plasmid vector pJAK16; (B, D, and F) strain DH5{alpha} carrying plasmid pVK43 (pJAK16 plus aae). (A and B) Detection of Aae on the surface of E. coli by using anti-Aae rabbit antiserum and a rhodamine-labeled secondary antibody. (C and D) Binding of E. coli to human BECs visualized by using rhodamine-labeled A. actinomycetemcomitans against a fluorescein-cytokeratin-labeled BEC background. (E and F) Binding of E. coli to human BECs visualized by staining with crystal violet.

When increasing numbers of Aae-expressing E. coli cells were added to BECs, a plateau in the number of bacterial cells per BEC was observed (Fig. 3). These data indicate that E. coli cells expressing Aae fully saturated the BEC binding sites. The plateau level reached by both the Aae-expressing E. coli strain and the A. actinomycetemcomitans flp-1 knockout strain (JK1047) was 1 to 2 logs lower than the plateau level reached by wild-type A. actinomycetemcomitans strain IDH781N (Fig. 3). These data suggest that the increased BEC binding exhibited by wild-type strain IDH781N may be due to bacterial autoaggregation mediated by Flp-1 pili (11). Flp-1 protein may also bind to a distinct BEC receptor. The aae mutant strain JK1046 bound to BECs only when high numbers of bacterial cells were added (Fig. 3). This binding may have been nonspecific or may have resulted from the presence of a second BEC adhesin on the surface of A. actinomycetemcomitans cells.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 3. Equilibrium binding of bacterial cells to human BECs. The data are means for duplicate samples, whose values varied by <5%.

When tested with BECs isolated from various mammalian species, Aae-expressing E. coli bound only to BECs isolated from humans and Old World primates (Fig. 4). The level of binding of E. coli carrying plasmid vector pJAK16 was <1 bacterial cell per 100 BECs. These data confirmed both the host range specificity of Aae and the presence one or more different A. actinomycetemcomitans surface adhesins that recognize BEC receptors of rats and cows.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 4. Binding of E. coli strain DH5{alpha} carrying plasmid pVK43 to epithelial cells isolated from humans and various mammalian species. The asterisks indicate Old World primates. The bars indicate mean numbers of E. coli cells per epithelial cell for duplicate samples, and the error bars indicate ranges. The values for species lacking bars were <1 bacterial cell per 1,000 BECs.

Aae-mediated binding exhibits tissue tropism. When tested with human epithelial cells derived from various other anatomical sites, the Aae-expressing strain of E. coli bound to human gingival epithelial cells (3 ± 1 bacterial cells per epithelial cell) but not to human alveolar, bronchial, palatal, tongue, or cervical epithelial cells (<1 bacterial cell per 100 epithelial cells). It is interesting that E. coli cells expressing Aae did not bind to tongue epithelial cells, although the tongue is the oral site that is most frequently colonized by A. actinomycetemcomitans (2, 15). This observation suggests that binding of A. actinomycetemcomitans to tongue epithelium may be mediated by an adhesin other that Aae.


arrow
DISCUSSION
 
In this report we present physical, microscopic, and genetic evidence that the Aae adhesin mediates binding of A. actinomycetemcomitans to BECs isolated from humans and Old World primates but not to BECs isolated from New World primates or nonprimate mammals. Inactivation of aae in wild-type A. actinomycetemcomitans strain IDH781N failed to reduce binding of bacterial cells to inert surfaces or to BECs isolated from rats and cows, indicating that other adhesins or surface molecules mediate these interactions. Functional expression of A. actinomycetemcomitans aae in E. coli confirmed the host specificity of Aae and indicated that Aae also exhibits tissue tropism for epithelial cells of buccal and gingival origin. The observed pattern of host specificity and tissue tropism exhibited by Aae in vitro correlates with the observed pattern of colonization exhibited by A. actinomycetemcomitans in nature, suggesting that Aae is a key determinant of oral colonization. Aae may also play a role in epithelial cell invasion (14, 17).

Although attachment is a prerequisite for oral infection by a microorganism, prospective infectious agents also face the challenge of the early host response. Polymorphonuclear leukocytes (PMNs) usually provide the most effective antibacterial defense in the initial stages of infection. In the case of A. actinomycetemcomitans, leukotoxin production may provide a bacterial strategy to counteract the PMN response. A. actinomycetemcomitans leukotoxin, which kills PMNs and macrophages isolated from humans and Old World primates, binds to LFA-1, a ß2 integrin protein that is not present on the surface of BECs. These data suggest that the narrow host ranges exhibited by Aae and leukotoxin evolved independently and that the evolution of host range specificity may be a complex process that involves several host-specific factors. These findings also suggest that the natural history of A. actinomycetemcomitans may date back at least 35 million years to the time when humans and Old World primates last had a common ancestor (22).

Our findings provide a molecular basis for the susceptibility of humans to colonization by A. actinomycetemcomitans. A complete understanding of the Aae-receptor interaction on a molecular level could be used to develop novel antiadhesive interventions that could have broad therapeutic and preventive applications for diseases caused by A. actinomycetemcomitans.


arrow
ACKNOWLEDGMENTS
 
We thank Mrinal Bhattacharjee and David Figurski (Columbia University) for providing the protocols and accompanying bacterial strains and plasmids used for natural transformation of A. actinomycetemcomitans and Karen Rice (Southwest National Primate Research Center, San Antonio, Tex.), Keith Mansfield (New England Regional Primate Research Center, Southborough, Mass.), Larry Katz (New Jersey Agricultural Station, Rutgers University, New Brunswick, N.J.), and Helen Schreiner (New Jersey Dental School) for help in obtaining epithelial cells.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Medical Science Building, Room C-636, 185 S. Orange Ave., Newark, NJ 07103. Phone: (973) 972-7053. Fax: (973) 972-0045. E-mail: finedh{at}umdnj.edu. Back

Editor: J. T. Barbieri


arrow
REFERENCES
 
    1
  1. Berbari, E. F., F. R. Cockerill, and J. M. Stickelberg. 1997. Infective endocarditis due to unusual or fastidious microorganisms. Mayo Clin. Proc. 72:532-542.[Abstract]
  2. 2
  3. Eger, T., L. Zöller, H.-P. Müller, S. Hoffmann, and D. Lobinsky. 1996. Potential diagnostic value of sampling oral mucosal surfaces for Actinobacillus actinomycetemcomitans in young adults. Eur. J. Oral Sci. 104:112-117.[Medline]
  4. 3
  5. Eke, P. I., L. Braswell, R. Arnold, and M. Fritz. 1993. Sub-gingival microflora in Macaca mulatta species of rhesus monkey. J. Periodontal Res. 28:72-80.[CrossRef][Medline]
  6. 4
  7. Fine, D. H., and D. Furgang. 2002. Lactoferrin iron levels affect attachment of Actinobacillus actinomycetemcomitans to buccal epithelial cells. J. Periodontol. 73:616-623.[CrossRef][Medline]
  8. 5
  9. Fine, D. H., D. Furgang, J. Kaplan, J. Charlesworth, and D. H. Figurski. 1999. Tenacious adhesion of Actinobacillus actinomycetemcomitans strain CU1000 to salivary-coated hydroxyapatite. Arch. Oral Biol. 44:1063-1076.[CrossRef][Medline]
  10. 6
  11. Fine, D. H., D. Furgang, H. C. Schreiner, P. Goncharoff, J. Charlesworth, G. Ghazwan, P. Fitzgerald-Bocarsly, and D. H. Figurski. 1999. Phenotypic variation in Actinobacillus actinomycetemcomitans during laboratory growth: implications for virulence. Microbiology 145:1335-1347.[Abstract/Free Full Text]
  12. 7
  13. Haubek, D., K. Poulsen, S. Asikainen, and M. Kilian. 1995. Evidence for absence in northern Europe of especially virulent clonal types of Actinobacillus actinomycetemcomitans. J. Clin. Microbiol. 33:395-401.[Abstract]
  14. 8
  15. Henderson, I. R., and J. P. Nataro. 2001. Virulence functions of autotransporter proteins. Infect. Immun. 69:1231-1243.[Free Full Text]
  16. 9
  17. Hendrixson, D. R., and J. W. St Geme III. 1998. The Haemophilus influenzae Hap serine protease promotes adherence and microcolony formation, potentiated by a soluble host protein. Mol. Cell 2:841-850.[CrossRef][Medline]
  18. 10
  19. Kachlany, S. C., P. J. Planet, M. K. Bhattacharjee, E. Kollia, R. DeSalle, D. H. Fine, and D. H. Figurski. 2000. Nonspecific adherence by Actinobacillus actinomycetemcomitans requires genes widespread in Bacteria and Archaea. J. Bacteriol. 182:6169-6176.[Abstract/Free Full Text]
  20. 11
  21. Kachlany, S. C., P. J. Planet, R. DeSalle, D. H. Fine, D. H. Figurski, and J. B. Kaplan. 2001. flp-1, the first representative of a new pilin gene subfamily, is required for non-specific adherence of Actinobacillus actinomycetemcomitans. Mol. Microbiol. 40:542-554.[CrossRef][Medline]
  22. 12
  23. Kaplan, J. B., S. Kokeguchi, Y. Murayama, and D. H. Fine. 2002. Sequence diversity in the major fimbrial subunit gene (flp-1) of Actinobacillus actinomycetemcomitans. Oral Microbiol. Immunol. 17:354-359.[CrossRef][Medline]
  24. 13
  25. Lamell, C. W., A. L. Griffen, D. L. McClellan, and E. J. Leys. 2000. Acquisition and colonization stability of Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis in children. J. Clin. Microbiol. 38:1196-1199.[Abstract/Free Full Text]
  26. 14
  27. Meyer, D. H., J. E. Lippmann, and P. M. Fives-Taylor. 1996. Invasion of epithelial cells by Actinobacillus actinomycetemcomitans: a dynamic, multistep process. Infect. Immun. 64:2988-2997.[Abstract]
  28. 15
  29. Müller, H.-P., P. Eickholz, A. Heinecke, S. Pohl, R. F. Müller, and D. E. Lange. 1995. Simultaneous isolation of Actinobacillus actinomycetemcomitans from subgingival and extracrevicular locations of the mouth. J. Clin. Periodontol. 22:413-419.[CrossRef][Medline]
  30. 16
  31. Rose, J. E., D. H. Meyer, and P. M. Fives-Taylor. 2003. Aae, an autotransporter involved in adhesion of Actinobacillus actinomycetemcomitans to epithelial cells. Infect. Immun. 71:2384-2393.[Abstract/Free Full Text]
  32. 17
  33. Rudney, J. D., R. Chen, and G. J. Sedgewick. 2001. Intracellular Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis in buccal epithelial cells collected from human subjects. Infect. Immun. 69:2700-2707.[Abstract/Free Full Text]
  34. 18
  35. Schreiner, H. C., K. Sinatra, J. B. Kaplan, D. Furgang, S. C. Kachlany, P. J. Planet, B. A. Perez, D. H. Figurski, and D. H. Fine. 2003. Tight-adherence genes of Actinobacillus actinomycetemcomitans are required for virulence in a rat model. Proc. Natl. Acad. Sci. USA 100:7295-7300.[Abstract/Free Full Text]
  36. 19
  37. Taichman, N. S., D. L. Simpson, S. Sakurada, M. Cranfield, J. DiRienzo, and J. Slots. 1987. Comparative studies on the biology of Actinobacillus actinomycetemcomitans leukotoxin in primates. Oral Microbiol. Immunol. 2:97-104.[Medline]
  38. 20
  39. Tanner, A. C., P. M. Milgrom, R. Kent, S. A. Mokeem, R. C. Page, C. A. Riedy, P. Weinstein, and J. Bruss. 2002. The microbiota of young children from tooth and tongue samples. J. Dent. Res. 81:53-57.[Abstract/Free Full Text]
  40. 21
  41. Thomson, V. J., M. K. Bhattacharjee, D. H. Fine, K. M. Derbyshire, and D. H. Figurski. 1999. Direct selection of IS903 transposon insertions by use of a broad-host-range vector: isolation of catalase-deficient mutants of Actinobacillus actinomycetemcomitans. J. Bacteriol. 181:7298-7307.[Abstract/Free Full Text]
  42. 22
  43. Vogel, T. U., D. T. Evans, J. A. Urvater, D. H. O'Connor, A. L. Hughes, and D. I. Watkins. 1999. Major histocompatibility complex class I genes in primates: co-evolution with pathogens. Immunol. Rev. 167:327-337.[CrossRef][Medline]
  44. 23
  45. Zambon, J. J. 1985. Actinobacillus actinomycetemcomitans in human periodontal disease. J. Clin. Periodontol. 12:1-20.[CrossRef][Medline]


Infection and Immunity, April 2005, p. 1947-1953, Vol. 73, No. 4
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.4.1947-1953.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Fine, D. H., Markowitz, K., Furgang, D., Fairlie, K., Ferrandiz, J., Nasri, C., McKiernan, M., Gunsolley, J. (2007). Aggregatibacter actinomycetemcomitans and Its Relationship to Initiation of Localized Aggressive Periodontitis: Longitudinal Cohort Study of Initially Healthy Adolescents. J. Clin. Microbiol. 45: 3859-3869 [Abstract] [Full Text]  
  • Yue, G., Kaplan, J. B., Furgang, D., Mansfield, K. G., Fine, D. H. (2007). A Second Aggregatibacter actinomycetemcomitans Autotransporter Adhesin Exhibits Specificity for Buccal Epithelial Cells in Humans and Old World Primates. Infect. Immun. 75: 4440-4448 [Abstract] [Full Text]  
  • Tang, G., Ruiz, T., Barrantes-Reynolds, R., Mintz, K. P. (2007). Molecular heterogeneity of EmaA, an oligomeric autotransporter adhesin of Aggregatibacter (Actinobacillus) actinomycetemcomitans. Microbiology 153: 2447-2457 [Abstract] [Full Text]  
  • Rhodes, E. R., Shoemaker, C. J., Menke, S. M., Edelmann, R. E., Actis, L. A. (2007). Evaluation of different iron sources and their influence in biofilm formation by the dental pathogen Actinobacillus actinomycetemcomitans. J Med Microbiol 56: 119-128 [Abstract] [Full Text]  
  • Ruiz, T., Lenox, C., Radermacher, M., Mintz, K. P. (2006). Novel Surface Structures Are Associated with the Adhesion of Actinobacillus actinomycetemcomitans to Collagen.. Infect. Immun. 74: 6163-6170 [Abstract] [Full Text]  
  • Haraszthy, V. I., Jordan, S. F., Zambon, J. J. (2006). Identification of Fur-regulated genes in Actinobacillus actinomycetemcomitans.. Microbiology 152: 787-796 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fine, D. H.
Right arrow Articles by Kaplan, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fine, D. H.
Right arrow Articles by Kaplan, J. B.