Previous Article | Next Article 
Infection and Immunity, April 2005, p. 2344-2350, Vol. 73, No. 4
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.4.2344-2350.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Identification and Functional Characterization of Chicken Toll-Like Receptor 5 Reveals a Fundamental Role in the Biology of Infection with Salmonella enterica Serovar Typhimurium
Muhammad Iqbal,1
Victoria J. Philbin,1
G. S. K. Withanage,2
Paul Wigley,3
Richard K. Beal,1
Marianne J. Goodchild,4
Paul Barrow,3
Ian McConnell,2
Duncan J. Maskell,2
John Young,1
Nat Bumstead,4
Yvonne Boyd,4,
and
Adrian L. Smith1*
Divisions of Immunology and Pathology,1
Microbiology,3
Molecular Biology, Institute for Animal Health, Compton Laboratory, Compton, Newbury, Berkshire,4
Department of Clinical Veterinary Medicine, University of Cambridge, Cambridge, United Kingdom2
Received 8 October 2004/
Returned for modification 9 November 2004/
Accepted 10 December 2004

ABSTRACT
Toll-like receptors (TLRs) are a major component of the pattern
recognition receptor repertoire that detect invading microorganisms
and direct the vertebrate immune system to eliminate infection.
In chickens, the differential biology of
Salmonella serovars
(systemic versus gut-restricted localization) correlates with
the presence or absence of flagella, a known TLR5 agonist. Chicken
TLR5 (chTLR5) exhibits conserved sequence and structural similarity
with mammalian TLR5 and is expressed in tissues and cell populations
of immunological and stromal origin. Exposure of chTLR5
+ cells
to flagellin induced elevated levels of chicken interleukin-1ß
(chIL-1ß) but little upregulation of chIL-6 mRNA.
Consistent with the flagellin-TLR5 hypothesis, an aflagellar
Salmonella enterica serovar Typhimurium
fliM mutant exhibited
an enhanced ability to establish systemic infection. During
the early stages of infection, the
fliM mutant induced less
IL-1ß mRNA and polymorphonuclear cell infiltration
of the gut. Collectively, the data represent the identification
and functional characterization of a nonmammalian TLR5 and indicate
a role in restricting the entry of flagellated
Salmonella into
systemic sites of the chicken.

INTRODUCTION
The pattern recognition receptors (PRRs) play a central role
in the rapid initiation of host immune responses and the generic
identification of an invading pathogen (
36,
43) by recognition
of pathogen-associated molecular patterns. Toll-like receptors
(TLRs) have emerged as a major component of the vertebrate PRR
repertoire. Upon activation, TLRs induce the expression of a
wide range of immunoregulatory and effector molecules (
41,
51)
and maturation of immune cell types (
1,
3,
11,
24,
50).
A range of TLR genes has been identified in nonmammalian vertebrates including chicken (10, 18, 32) and fish (6, 26, 37). To date, avian orthologues of TLR2 and TLR4 have been characterized and expressed sequence tags (ESTs) with sequence homologies to TLR1, -6, or -10; TLR3; TLR5; and TLR7 have been identified (34, 48; our unpublished results). Two chicken TLR2 (chTLR2) molecules (type 1 and type 2) were identified that lie in a tandem arrangement within a genomic region expressing conserved synteny to mammals (10, 18). The chTLR4 gene was also demonstrated to lie in a region of conserved synteny and has been associated with susceptibility to systemic infection with Salmonella enterica serovar Typhimurium in young chickens (32). Collectively, these data indicate that a range of distinct TLR genes, orthologous to the mammalian TLR repertoire, were present before the divergence of birds and mammals over 300 million years ago.
The observation that nonflagellated Salmonella enterica serovars (Gallinarum or Pullorum) typically cause more acute systemic infection than flagellated serovars (Typhimurium or Enteritidis) provoked our interest in chTLR5. Our working hypothesis was that TLR5-flagellin interactions contribute to the broad biology of Salmonella serovars in the chicken. We identified a chicken orthologue for TLR5, determined expression patterns in tissues, and isolated immune cell populations and cultured cells. Exposure of chTLR5+ cells to flagellin induced upregulation of chicken interleukin-1ß (chIL-1ß), and the differential biology of aflagellar and intact serovar Typhimurium in the chicken revealed a likely role for TLR5 in avian salmonellosis.

MATERIALS AND METHODS
Animals and Salmonella.
Specific-pathogen-free inbred line 7
2 (White Leghorn) and Rhode
Island Red chickens were bred at the Institute for Animal Health
(IAH) and reared under conventional conditions. A spontaneous
nalidixic-acid-resistant mutant of
S. enterica serovar Typhimurium
strain F98 (phage type 14) and serovar Typhumurium F98
fliM::Km
are described elsewhere (
4,
55). Bacterial stocks were stored
in glycerol at 70°C and grown in Luria-Bertani broth
at 37°C in an orbital shaking incubator at 150 rpm.
Database mining and BAC identification.
Chicken EST databases (12, 53) were screened by BLAST with human TLR5 (huTLR5) sequences (NM003268). Primers were designed from a putative chTLR5 EST and used to generate amplification products from genomic DNA for hybridization screening of the Wageningen Bacterial Artificial Chromosome (BAC) library (14) with filters supplied by the Medical Research Council Human Genome Mapping Project Resource Centre, Cambridge, United Kingdom.
Positive BAC clones were sequenced (Lark Technologies, Saffron Walden, United Kingdom) and analyzed using the NIX program (http://www.hgmp.mrc.ac.uk/NIX). Alignments were performed using Clustal W version 10 (52), and structural domains were predicted using SMART (http://smart.embl-heidelberg.de).
Tissues, sorted cell populations, and cultured cells.
Tissue samples were obtained from 8-week-old line 72 chickens. Splenic B, T-cell receptor gamma delta (TCR
), TCR
ß1, and TCR
ß2 cells were enriched using the AutoMACS system (Miltenyi Biotech, Surrey, United Kingdom) according to the manufacturer's instructions. Briefly, spleens were disrupted and lymphocytes were isolated using Ficoll-Paque Plus (Amersham Biosciences, Uppsala, Sweden). Splenocytes were labeled with anti-Bu-1 phycoerythrin, anti-TCR
(immunoglobulin G1 [IgG1]), or anti-TCR
ß2 (IgG1) at 200 µl/108 cells or with TCR
ß1 phycoerythrin at 500 µl/108 cells in phosphate-buffered saline-0.5% bovine serum albumin for 15 min on ice. Following washing, cell populations were isolated by positive selection (purity, >95%) by using antifluorochrome or rat anti-mouse IgG1-conjugated paramagnetic beads (Miltenyi Biotech). Monocyte-derived macrophages and heterophils were obtained from peripheral blood as described previously (28, 57).
Primary cultures of chicken kidney cells (CKC) and embryonic (e10d) fibroblasts (CEF) were prepared according to standard techniques. All cells were cultured in RPMI 1640 medium supplemented with penicillin-streptomycin, 7% fetal calf serum, and 3% chicken serum at 41°C under 5% CO2. The macrophage-like HD11 cell line (9) and the bursal lymphoma cell line DT40 (ATCC accession number CRL2111) were cultured in supplemented RPMI medium at 41°C under 5% CO2.
Treatment of cultured cells with serovar Typhimurium flagellin.
Confluent monolayers of CEF, CKC, or HD11 cells in 24-well plates (Nunc, Roskilde, Denmark) were treated with purified serovar Typhimurium-derived flagellin (InvivoGen, San Diego, Calif.) for 6 h (19). Analysis was performed with three independent experiments, each including triplicates of flagellin-treated and mock-treated wells.
RNA extraction.
Tissue samples were stored in RNAlater (QIAGEN Ltd. Crawley, United Kingdom) at 20°C before disruption by homogenization (Mini-bead beater; Biospec Products, Bartlesville, Okla.). Isolated cell subsets or cultured cells were disrupted directly in RLT buffer (QIAGEN) and frozen at 20°C until RNA extraction. RNA was extracted with the RNeasy Mini kit (QIAGEN) according to the manufacturer's instructions. Contaminating DNA was digested on column with RNase-free DNase 1 (QIAGEN) for 90 min at room temperature. The RNA was eluted with RNase-free water and stored at 80°C.
RT-PCR.
cDNA was obtained using a reverse transcription (RT) kit (Promega, Southampton, United Kingdom) according to the manufacturer's instructions. All cDNA preparations were standardized by RT-PCR for ß-actin with primers (forward, TGCTGTGTTCCCATCTATCG; reverse, TTGGTGACAATACCGTGTTCA; accession number L08165) and were free from genomic DNA contamination (data not shown).
PCR conditions were as follows: cDNA (1 to 2 µg), 200 µM deoxynucleoside triphosphates, 1x reaction buffer, 0.5 U of Taq polymerase (Promega, Southhampten, United Kingdom), and primers for chTLR5 (forward, TGCACATGTTTTCTCCTAGGT; reverse, CCACATCTGACTTCTGCCTTT) at 5 pM in a 50-µl final reaction volume with amplification (iCycler; Bio-Rad, Hemel Hampstead, United Kingdom) at 1 cycle at 95°C (2 min); 30 cycles at 95°C (30 s), 58°C (1 min), and 72°C (2 min); and 1 cycle at 72°C (10 min).
Quantitative analysis of cytokine mRNA.
The mRNA levels of chicken IL-1ß, IL-6, and 28S rRNA were quantified by real-time RT-PCR using the ABI Prism 7700 sequence detection system (TaqManR; PE Applied Biosystems, Warrington, United Kingdom) as described previously (27, 29).
Fold differences (R) in the expression of cytokine genes between samples (A and B), each relative to reference rRNA, were calculated from the CT values C (for the cytokine) and C' (for rRNA) by using the equation ln R(A/B) = (CA -CB)/S -(C'A-C'B)/S', where S and S' are, respectively, the slopes of plots of the CT value against the natural logarithm of concentration for serial 10-fold dilutions of cytokine DNA and rRNA, assayed on the same plate. This calculation avoids assumptions about the efficiency of the PCR amplifications and reduces to the common 
CT method in the case that both have perfect efficiency.
In vivo challenge.
Groups of 20 1-day-old specific-pathogen-free Rhode Island Red chickens were challenged orally with 2.5 x 108 CFU of wild-type or fliM mutant serovar Typhimurium F98 strain or mock treated. Birds were sacrificed at 0, 9, 24, and 48 h postinfection (p.i.) for bacterial analysis in the spleen, liver, and cecal contents as described previously (58). Samples of small intestine and cecal tonsil (CT) were fixed in 10% formalin saline for histology and in RNAlater for cytokine mRNA analysis. All experimental procedures satisfied the requirements of local and national regulation and ethical review with appropriate licenses.
Nucleotide sequence accession number.
The coding sequence for the chTLR5 was deposited in the EMBL database under accession number AJ626848.

RESULTS
Identification and mapping of chTLR5.
An EST with sequence homology to huTLR5 (BI066471) was identified
and used to identify three BACs (Wag002L14, Wag019C29, and Wag501K15)
which mapped (by fluorescent in situ hybridization) to the centromeric
region 3q11-3q21 of chicken chromosome 3 (unpublished data).
Analysis of the Wag002L14 sequence identified a region with
homology to huTLR5. A chTLR5 open reading frame was identified
in a single exon (as with mammalian TLR5) and confirmed by sequence
of RT-PCR products.
Comparison of the chTLR5 amino acid sequence with huTLR and mouse TLR (moTLR) revealed the highest identity with TLR5 (50 and 46%), with higher identity in the TIR domain (70 and 69%). Amino acid sequences of chTLR5, huTLR5, and mTLR5 were aligned, and predicted domain analysis (31) showed conservation of the TLR5 LRR pattern (Fig. 1).
Expression of chTLR5 mRNA and flagellin-induced cytokine production.
ChTLR5 mRNA was expressed in a broad range of tissues, including
those with minimal (e.g., kidney and liver) or substantial (e.g.,
spleen and gut) immune compartments (Fig.
2A). The strongest
signals were obtained with colon, spleen, kidney, lung, heart,
and testes. With the immune cell fractions, chTLR5 message was
detected with all cell types examined, including monocyte-derived
macrophages, heterophils, and B- and T-cell subsets (Fig.
2B).
Although chTLR5 message was detected in all four of the cultured
cell populations, the relative intensity of the RT-PCR products
differed (Fig.
2C), with strongest signals from the stromal-cell-derived
populations (CEF and CKC).
Exposure of cultured CEF, CKC, and HD11 cells to
Salmonella-derived
flagellin led to the upregulation of chIL-1ß mRNA
(Fig.
3) 114-fold, 6-fold, and 3-fold, respectively. In contrast,
chIL-6 mRNA was not significantly increased by exposure of the
cultured cells to the flagellin preparation.
Flagella status affects serovar Typhimurium infection.
To assess the importance of flagella-host interactions during
avian serovar Typhimurium infection, we analyzed the bacteriology,
cytokine induction, and pathology after challenge with wild-type
or flagella-deficient
fliM mutant bacteria. The numbers of wild-type
or
fliM mutant
Salmonella in the cecal contents were equivalent
at both 9 and 24 h p.i. (Fig.
4A). In contrast, the numbers
of aflagellar
fliM bacteria in the liver at 9 h p.i. were substantially
higher (10
3/g) than those with wild-type serovar Typhimurium
(undetectable). At 24 h p.i., the numbers of
fliM mutant and
wild-type bacteria in the liver were comparable, indicating
that flagella deficiency only enhances the initial phases of
systemic colonization.
To characterize the effect of flagella status on the induction
of host responses, the levels of cytokine mRNA (chIL-1ß
and chIL-6) and inflammatory infiltrate in the gut were assessed.
The CT represents a major site for the invasion of serovar Typhimurium,
whereas fewer bacteria appear to enter the body in small intestinal
sites (
5). Greater increases in the amounts of mRNA for proinflammatory
cytokines were detected in CT than in ileal tissue samples (Fig.
5). At 9 h p.i., CT chIL-1ß mRNA levels reflected
the flagella status of the
Salmonella, less being detected with
aflagellar bacteria. Small differences were evident with ileal
samples at 9 h p.i., but these were not statistically significant.
At 24 h p.i., levels of CT chIL-1ß mRNA were elevated
(

4,500-fold) but there were no differences related to flagella
status. Levels of chIL-6 mRNA were increased at 24 h p.i. (Fig.
5), with higher amounts induced by flagella-intact serovar Typhimurium
(
P < 0.05). Microscopic examination of the cecal wall revealed
the rapid development of a polymorphonuclear (PMN) cell infiltrate
(Fig.
4B) which was slower during infection with aflagellar
serovar Typhimurium.

DISCUSSION
TLRs represent a major component of the vertebrate PRR system
which affords the ability to detect and to differentiate between
major groups of invading microorganisms. TLR-derived signals
are important in the initiation and fine tuning of responses
to mediate protective immunity. Innate recognition of
Salmonella enterica is mediated by a range of TLR-pathogen-associated molecular
pattern interactions, including TLR4-lipopolysaccharide (LPS),
TLR5-flagellin, and TLR9-unmethylated CpG motifs. Indeed, involvement
of TLR4 in the protection against systemic salmonellosis has
been described for both mammals and chickens (
32,
39,
40). With
MOLF/Ei mice, TLR5 is linked with resistance to systemic salmonellosis
(
46) and flagellin-TLR5 interactions mediate
Salmonella recognition
by enterocytes (
19,
20,
60,
61). In chickens, aflagellar serovars
(Gallinarum or Pullorum) typically cause more severe systemic
infection than flagella-intact serovars (Typhimurium or Enteritidis).
These observations stimulated our work to characterize chTLR5
and to assess the role for flagellin-dependent interactions
in defining the biology of
Salmonella in the chicken.
In mammals, a repertoire of 13 TLRs has been described. With chickens, only chTLR2 and chTLR4 have been characterized in detail (18, 32), although EST sequences with similarity to mammalian TLR (TLR1, -6, or -10), TLR3, TLR5, and TLR7 have been reported (34, 48). A range of TLR agonists has been shown to stimulate the production of nitric oxide and cytokines and/or changes in cell surface molecules with cultured chicken cells. These agonists include LPS (15), lipoteichoic acid (17), polyinosinic-poly(C) (35) and unmethylated CpG DNA motifs (23).
The chTLR5 gene was identified and localized to the previously defined region of homology shared between the proximal region of chicken chromosome 3, human chromosome 1, and mouse chromosome 1 (21, 44). The level of amino acid identity for chTLR5 and huTLR5 is similar to that for chTLR2 and huTLR2 and that for chTLR4 and huTLR4 (18, 32). Comparisons of gene structure, genomic location, amino acid composition, and patterns of LRR support the premise that chTLR5 is an orthologue of mammalian TLR5. Moreover, chTLR5 mRNA is expressed with a similarly broad cell and tissue distribution to mammalian TLR5 (25, 59).
Bacterial flagellin is an agonist for mammalian (22) and fish TLR5 (54) and stimulated chTLR5+ cells to upregulate chIL1ß mRNA but not nitric oxide or chIL-6 mRNA. Provocatively, the degree of flagellin-induced IL-1ß mRNA correlated with the level of TLR5 RT-PCR product detected. Similarly, levels of chTLR4 correlated with the amount of LPS-induced nitric oxide in macrophages (15, 16). The failure of flagellin to induce chIL-6 mRNA was unexpected and contrasted with the exposure of CKC to live serovar Typhimurium (27) and the production of IL-6 by mammalian cells (20). With live Salmonella, CKC upregulated chIL6 mRNA after exposure to flagellated serovars (Typhimurium, Enteritidis, and Dublin) but not aflagellated serovar Gallinarum (27). However, our results suggest that the apparent correlation of CKC IL-6 response with flagella status is not mediated by flagellin-chTLR5 interactions. Exposure of CKC to live serovar Typhimurium or serovar Enteritidis failed to stimulate chIL-1ß (27), suggesting that some serovars may subvert flagellin-TLR5 responses.
Analyses of epithelial-dominated CKC cultures are not necessarily representative of early in vivo interactions with enterocytes that express TLR5 only on the basolateral surface (19). Unfortunately, well-defined enterocyte-like cell lines are not available for the chicken and an in vivo approach using the aflagellar serovar Typhimurium F98 fliM mutant and parental wild-type F98 was adopted for subsequent studies. Consistent with previous studies (2), the numbers of cecal salmonellae were independent of flagella status at both 9 and 24 h p.i. Despite the comparable availability of both strains for invasion, higher numbers of aflagellar salmonellae were detected in the liver at 9 h p.i., indicating a competitive advantage in early systemic colonization. This difference was not seen at 24 h p.i., and the advantage of aflagellar status was short-lived and probably related to an ability to evade early host recognition.
TLR5 has been shown to play a significant role in the susceptibility of MOLF/Ei mice to systemic salmonellosis, independent of either NRAMP or TLR4 loci (46, 47). Interestingly, MOLF/Ei mice succumb to infection with lower bacterial loads than C57BL/6 (natural resistance-associated macrophage protein [NRAMP])s mice, indicating a complex interplay between bacterial load and disease outcome (45). A wide range of flagella-deficient strains of serovar Typhimurium have been examined for virulence in rodents either after intravenous, intraperitoneal, or oral routes with sometimes contradictory conclusions (13, 33, 42, 49). The early, enhanced systemic infection associated with aflagellar status has also been documented after oral challenge of mice, and the transient nature of the effect may represent reduced intramacrophage survival (42, 56). The transient nature of aflagellar advantage in chickens would not have been detected in studies with fliC serovar Enteritidis at 24 to 72 h p.i. (2, 38).
The reduced levels of CT chIL1ß and chIL6 seen after challenge with aflagellar serovar Typhimurium are consistent with the reduced enteric PMN infiltration also noted with murine colitis (49). Other cytokines and chemokines are induced by intact Salmonella (7, 8, 58) and may also contribute to the reduced infiltrate and enhanced translocation of aflagellar bacteria from the gut. Flagellin-induced IL-1ß upregulation would characterize the response of many cell types of immune or stromal origin. TLR5 is basolaterally orientated on enterocytes, but these cells can respond to serovar Typhimurium-induced translocation of flagellin (20) or as the result of subepithelial bacterial invasion. Hence, enterocyte-induced cytokine or chemokine response may represent a first line of defense against flagellated Salmonella. The delayed IL-6 response is probably a downstream event associated with differential immune cell recruitment due to the induced IL-1ß response, which may also be TLR5 dependent. Indeed, the consequences of exposure to TLR agonists are dependent upon cell type even when the cells express a similar array of TLRs (25). A clear consequence of reduced proinflammatory cytokines in the CT was reduced PMN infiltration, an important factor in defining the chicken-Salmonella relationship (30). These observations support the hypothesis that the early phases of avian salmonellosis are defined, at least in part, by flagellin-TLR5 interactions.

ACKNOWLEDGMENTS
This work was funded by the BBSRC grant numbers 201/S15839 and
8/BFP11365 and BBSRC studentship 02/A1/S/08451.
We also acknowledge the assistance provided by the staff of the production units and experimental animal facilities and the cell culture core facility of the IAH.

FOOTNOTES
* Corresponding author. Mailing address: Enteric Immunology, Stewart Building G2D, Division of Immunology and Pathology, Institute for Animal Health, Compton, Newbury, Berkshire RG20 7NN, United Kingdom. Phone: 044 1635 577293. Fax: 044 1635 577263. E-mail:
adrian.smith{at}bbsrc.ac.uk.

We dedicate this article to the memory of our valued colleague and friend Nat Bumstead, who sadly passed away during the completion of this work. 
Editor: F. C. Fang
Present address: TSE Research Unit, Science Directorate, Department of Environment Food and Rural Affairs, Westminster, London SW1P 3JH, United Kingdom. 

REFERENCES
1 - Akira, S., K. Takeda, and T. Kaisho. 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2:675-680.[CrossRef][Medline]
2 - Allen-Vercoe, E., and M. J. Woodward. 1999. Colonisation of the chicken caecum by afimbriate and aflagellate derivatives of Salmonella enterica serotype Enteritidis. Vet. Microbiol. 69:265-275.[CrossRef][Medline]
3 - Banchereau, J., and R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245-252.[CrossRef][Medline]
4 - Barrow, P. A., M. B. Huggins, M. A. Lovell, and J. M. Simpson. 1987. Observations on the pathogenesis of experimental Salmonella typhimurium infection in chickens. Res. Vet. Sci. 42:194-199.[Medline]
5 - Barrow, P. A., M. A. Lovell, and B. A. D. Stocker. 2000. Protection against experimental fowl typhoid by parenteral administration of live SL5928, an aroA-serC (aromatic dependent) mutant of a wild-type Salmonella Gallinarum strain made lysogenic for P22e sie. Avian Pathol. 29:423-431.[CrossRef][Medline]
6 - Bayne, C. J., L. Gerwick, K. Fujiki, M. Nakao, and T. Yano. 2001. Immune-relevant (including acute phase) genes identified in the livers of rainbow trout, Oncorhynchus mykiss, by means of suppression subtractive hybridization. Dev. Comp. Immunol. 25:205-217.[CrossRef][Medline]
7 - Beal, R. K., C. Powers, P. Wigley, P. A. Barrow, and A. L. Smith. 2004. Temporal dynamics of the cellular, humoral and cytokine responses in chickens during primary and secondary infection with Salmonella enterica serovar Typhimurium. Avian Pathol. 33:25-33.[CrossRef][Medline]
8 - Beal, R. K., P. Wigley, C. Powers, S. D. Hulme, P. A. Barrow, and A. L. Smith. 2004. Age at primary infection with Salmonella enterica serovar Typhimurium in the chicken influences persistence of infection and subsequent immunity to re-challenge. Vet. Immunol. Immunopathol. 100:151-164.[CrossRef][Medline]
9 - Beug, H., A. von Kirchbach, G. Doderlein, J. F. Conscience, and T. Graf. 1979. Chicken hematopoietic cells transformed by seven strains of defective avian leukemia viruses display three distinct phenotypes of differentiation. Cell 18:375-390.[CrossRef][Medline]
10 - Boyd, Y., M. Goodchild, S. Morroll, and N. Bumstead. 2001. Mapping of the chicken and mouse genes for toll-like receptor 2 (TLR2) to an evolutionarily conserved chromosomal segment. Immunogenetics 52:294-298.[CrossRef][Medline]
11 - Brightbill, H. D., and R. L. Modlin. 2000. Toll-like receptors: molecular mechanisms of the mammalian immune response. Immunology 101:1-10.
12 - Buerstedde, J. M., H. Arakawa, A. Watahiki, P. P. Carninci, Y. Y. Hayashizaki, B. Korn, and J. Plachy. 2002. The DT40 web site: sampling and connecting the genes of a B cell line. Nucleic Acids Res. 30:230-231.[Abstract/Free Full Text]
13 - Carsiotis, M., D. L. Weinstein, H. Karch, I. A. Holder, and A. D. O'Brien. 1984. Flagella of Salmonella typhimurium are a virulence factor in infected C57BL/6J mice. Infect. Immun. 46:814-818.[Abstract/Free Full Text]
14 - Crooijmans, R. P., J. Vrebalov, R. J. Dijkhof, J. J. van der Poel, and M. A. Groenen. 2000. Two-dimensional screening of the Wageningen chicken BAC library. Mamm. Genome 11:360-363.[CrossRef][Medline]
15 - Dil, N., and M. A. Qureshi. 2002. Differential expression of inducible nitric oxide synthase is associated with differential Toll-like receptor-4 expression in chicken macrophages from different genetic backgrounds. Vet. Immunol. Immunopathol. 84:191-207.[CrossRef][Medline]
16 - Dil, N., and M. A. Qureshi. 2003. Interleukin-1beta does not contribute to genetic strain-based differences in iNOS expression and activity in chicken macrophages. Dev. Comp. Immunol. 27:137-146.[CrossRef][Medline]
17 - Farnell, M. B., H. He, K. Genovese, and M. H. Kogut. 2003. Pharmacological analysis of signal transduction pathways required for oxidative burst in chicken heterophils stimulated by a Toll-like receptor 2 agonist. Int. Immunopharmacol. 3:1677-1684.[CrossRef][Medline]
18 - Fukui, A., N. Inoue, M. Matsumoto, M. Nomura, K. Yamada, Y. Matsuda, K. Toyoshima, and T. Seya. 2001. Molecular cloning and functional characterization of chicken toll-like receptors. A single chicken toll covers multiple molecular patterns. J. Biol. Chem. 276:47143-47149.[Abstract/Free Full Text]
19 - Gewirtz, A. T., T. A. Navas, S. Lyons, P. J. Godowski, and J. L. Madara. 2001. Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J. Immunol. 167:1882-1885.[Abstract/Free Full Text]
20 - Gewirtz, A. T., P. O. Simon, Jr., C. K. Schmitt, L. J. Taylor, C. H. Hagedorn, A. D. O'Brien, A. S. Neish, and J. L. Madara. 2001. Salmonella typhimurium translocates flagellin across intestinal epithelia, inducing a proinflammatory response. J. Clin. Investig. 107:99-109.[Medline]
21 - Groenen, M. A., H. H. Cheng, N. Bumstead, B. F. Benkel, W. E. Briles, T. Burke, D. W. Burt, L. B. Crittenden, J. Dodgson, J. Hillel, S. Lamont, A. P. de Leon, M. Soller, H. Takahashi, and A. Vignal. 2000. A consensus linkage map of the chicken genome. Genome Res. 10:137-147.[Abstract/Free Full Text]
22 - Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett, J. K. Eng, S. Akira, D. M. Underhill, and A. Aderem. 2001. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410:1099-1103.[CrossRef][Medline]
23 - He, H., and M. H. Kogut. 2003. CpG-ODN-induced nitric oxide production is mediated through clathrin-dependent endocytosis, endosomal maturation, and activation of PKC, MEK1/2 and p38 MAPK, and NF-
B pathways in avian macrophage cells (HD11). Cell. Signal. 15:911-917.[CrossRef][Medline]
24 - Hertz, C. J., S. M. Kiertscher, P. J. Godowski, D. A. Bouis, M. V. Norgard, M. D. Roth, and R. L. Modlin. 2001. Microbial lipopeptides stimulate dendritic cell maturation via Toll-like receptor 2. J. Immunol. 166:2444-2450.[Abstract/Free Full Text]
25 - Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres, and G. Hartmann. 2002. Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J. Immunol. 168:4531-4537.[Abstract/Free Full Text]
26 - Jault, C., L. Pichon, and J. Chluba. 2004. Toll-like receptor gene family and TIR-domain adapters in Danio rerio. Mol. Immunol. 40:759-771.[CrossRef][Medline]
27 - Kaiser, P., L. Rothwell, E. E. Galyov, P. A. Barrow, J. Burnside, and P. Wigley. 2000. Differential cytokine expression in avian cells in response to invasion by Salmonella typhimurium, Salmonella enteritidis and Salmonella gallinarum. Microbiology 12:3217-3226.
28 - Kogut, M. H., E. D. McGruder, B. M. Hargis, D. E. Corrier, and J. R. DeLoach. 1995. In vivo activation of heterophil function in chickens following injection with Salmonella enteritidis-immune lymphokines. J. Leukoc. Biol. 57:56-62.[Abstract]
29 - Kogut, M. H., L. Rothwell, and P. Kaiser. 2003. Priming by recombinant chicken interleukin-2 induces selective expression of IL-8 and IL-18 mRNA in chicken heterophils during receptor-mediated phagocytosis of opsonized and nonopsonized Salmonella enterica serovar enteritidis. Mol. Immunol. 40:603-610.[CrossRef][Medline]
30 - Kogut, M. H., G. I. Tellez, E. D. McGruder, B. M. Hargis, J. D. Williams, D. E. Corrier, and J. R. DeLoach. 1994. Heterophils are decisive components in the early responses of chickens to Salmonella enteritidis infections. Microb. Pathog. 16:141-151.[CrossRef][Medline]
31 - Letunic, I., L. Goodstadt, N. J. Dickens, T. Doerks, J. Schultz, R. Mott, F. Ciccarelli, R. R. Copley, C. P. Ponting, and P. Bork. 2002. Recent improvements to the SMART domain-based sequence annotation resource. Nucleic Acids Res. 30:242-244.[Abstract/Free Full Text]
32 - Leveque, G., V. Forgetta, S. Morroll, A. L. Smith, N. Bumstead, P. Barrow, J. C. Loredo-Osti, K. Morgan, and D. Malo. 2003. Allelic variation in TLR4 is linked to susceptibility to Salmonella enterica serovar Typhimurium infection in chickens. Infect. Immun. 71:1116-1124.[Abstract/Free Full Text]
33 - Lockman, H. A., and R. Curtiss III. 1990. Salmonella typhimurium mutants lacking flagella or motility remain virulent in BALB/c mice. Infect. Immun. 58:137-143.[Abstract/Free Full Text]
34 - Lynn, D. J., A. T. Lloyd, and C. O'Farrelly. 2003. In silico identification of components of the Toll-like receptor (TLR) signaling pathway in clustered chicken expressed sequence tags (ESTs). Vet. Immunol. Immunopathol. 93:177-184.[CrossRef][Medline]
35 - Marcus, P. I., and M. J. Sekellick. 2001. Combined sequential treatment with interferon and dsRNA abrogates virus resistance to interferon action. J. Interferon Cytokine Res. 21:423-429.[CrossRef][Medline]
36 - Medzhitov, R., P. Preston-Hurlburt, and C. A. Janeway, Jr. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388:394-397.[CrossRef][Medline]
37 - Meijer, A. H., S. F. Gabby Krens, I. A. Medina Rodriguez, S. He, W. Bitter, B. Ewa Snaar-Jagalska, and H. P. Spaink. 2004. Expression analysis of the Toll-like receptor and TIR domain adaptor families of zebrafish. Mol. Immunol. 40:773-783.[CrossRef][Medline]
38 - Parker, C. T., and J. Guard-Petter. 2001. Contribution of flagella and invasion proteins to pathogenesis of Salmonella enterica serovar enteritidis in chicks. FEMS Microbiol. Lett. 204:287-291.[CrossRef][Medline]
39 - Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, M. Freudenberg, P. Ricciardi-Castagnoli, B. Layton, and B. Beutler. 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085-2088.[Abstract/Free Full Text]
40 - Qureshi, S. T., L. Lariviere, G. Leveque, S. Clermont, K. J. Moore, P. Gros, and D. Malo. 1999. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4). J. Exp. Med. 189:615-625.[Abstract/Free Full Text]
41 - Remer, K. A., M. Brcic, and T. W. Jungi. 2003. Toll-like receptor-4 is involved in eliciting an LPS-induced oxidative burst in neutrophils. Immunol. Lett. 85:75-80.[CrossRef][Medline]
42 - Robertson, J. M., N. H. McKenzie, M. Duncan, E. Allen-Vercoe, M. J. Woodward, H. J. Flint, and G. Grant. 2003. Lack of flagella disadvantages Salmonella enterica serovar Enteritidis during the early stages of infection in the rat. J. Med. Microbiol. 52:91-99.[Abstract/Free Full Text]
43 - Rock, F. L., G. Hardiman, J. C. Timans, R. A. Kastelein, and J. F. Bazan. 1998. A family of human receptors structurally related to Drosophila Toll. Proc. Natl. Acad. Sci. USA 95:588-593.[Abstract/Free Full Text]
44 - Schmid, M., I. Nanda, M. Guttenbach, C. Steinlein, M. Hoehn, M. Schartl, T. Haaf, S. Weigend, R. Fries, J. M. Buerstedde, K. Wimmers, D. W. Burt, J. Smith, S. A'Hara, A. Law, D. K. Griffin, N. Bumstead, J. Kaufman, P. A. Thomson, T. Burke, M. A. Groenen, R. P. Crooijmans, A. Vignal, V. Fillon, M. Morisson, F. Pitel, M. Tixier-Boichard, K. Ladjali-Mohammedi, J. Hillel, A. Maki-Tanila, H. H. Cheng, M. E. Delany, J. Burnside, and S. Mizuno. 2000. First report on chicken genes and chromosomes 2000. Cytogenet. Cell Genet. 90:169-218.[CrossRef][Medline]
45 - Sebastiani, G., V. Blais, V. Sancho, S. N. Vogel, M. M. Stevenson, P. Gros, J.-M. Lapointe, S. Rivest, and D. Malo. 2002. Host immune response to Salmonella enterica serovar Typhimurium infection in mice derived from wild strains. Infect. Immun. 70:1997-2009.[Abstract/Free Full Text]
46 - Sebastiani, G., G. Leveque, L. Lariviere, L. Laroche, E. Skamene, P. Gros, and D. Malo. 2000. Cloning and characterization of the murine toll-like receptor 5 (Tlr5) gene: sequence and mRNA expression studies in Salmonella-susceptible MOLF/Ei mice. Genomics 64:230-240.[CrossRef][Medline]
47 - Sebastiani, G., L. Olien, S. Gauthier, E. Skamene, K. Morgan, P. Gros, and D. Malo. 1998. Mapping of genetic modulators of natural resistance to infection with Salmonella Typhimurium in wild-derived mice. Genomics 47:180-186.[CrossRef][Medline]
48 - Smith, J., D. Speed, A. S. Law, E. J. Glass, and D. W. Burt. 2004. In-silico identification of chicken immune-related genes. Immunogenetics 56:122-133.[CrossRef][Medline]
49 - Stecher, B., S. Hapfelmeier, C. Müller, M. Kremer, T. Stallmach, and W.-D. Hardt. 2004. Flagella and chemotaxis are required for efficient induction of Salmonella enterica serovar Typhimurium colitis in streptomycin-pretreated mice. Infect. Immun. 72:4138-4150.[Abstract/Free Full Text]
50 - Supajatura, V., H. Ushio, A. Nakao, K. Okumura, C. Ra, and H. Ogawa. 2001. Protective roles of mast cells against enterobacterial infection are mediated by Toll-like receptor 4. J. Immunol. 167:2250-2256.[Abstract/Free Full Text]
51 - Thoma-Uszynski, S., S. Stenger, O. Takeuchi, M. T. Ochoa, M. Engele, P. A. Sieling, P. F. Barnes, M. Rollinghoff, P. L. Bolcskei, M. Wagner, S. Akira, M. V. Norgard, J. T. Belisle, P. J. Godowski, B. R. Bloom, and R. L. Modlin. 2001. Induction of direct antimicrobial activity through mammalian toll-like receptors. Science 291:1544-1547.[Abstract/Free Full Text]
52 - Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
53 - Tirunagaru, V. G., L. Sofer, J. Cui, and J. Burnside. 2000. An expressed sequence tag database of T-cell-enriched activated chicken splenocytes: sequence analysis of 5251 clones. Genomics 66:144-151.[CrossRef][Medline]
54 - Tsujita, T., H. Tsukada, M. Nakao, H. Oshiumi, M. Matsumoto, and T. Seya. 2004. Sensing bacterial flagellin by membrane and soluble orthologs of Toll-like receptor 5 in rainbow trout (Onchorhynchus mikiss). J. Biol. Chem. 279:48588-48597.[Abstract/Free Full Text]
55 - Turner, A. K., M. A. Lovell, S. D. Hulme, L. Zhang-Barber, and P. A. Barrow. 1998. Identification of Salmonella typhimurium genes required for colonization of the chicken alimentary tract and for virulence in newly hatched chicks. Infect. Immun. 66:2099-2106.[Abstract/Free Full Text]
56 - Weinstein, D. L., M. Carsiotis, C. R. Lissner, and A. D. O'Brien. 1984. Flagella help Salmonella typhimurium survive within murine macrophages. Infect. Immun. 46:819-825.[Abstract/Free Full Text]
57 - Wigley, P., S. D. Hulme, N. Bumstead, and P. A. Barrow. 2002. In vivo and in vitro studies of genetic resistance to systemic salmonellosis in the chicken encoded by the SAL1 locus. Microbes Infect. 4:1111-1120.[CrossRef][Medline]
58 - Withanage, G. S., P. Kaiser, P. Wigley, C. Powers, P. Mastroeni, H. Brooks, P. Barrow, A. Smith, D. Maskell, and I. McConnell. 2004. Rapid expression of chemokines and proinflammatory cytokines in newly hatched chickens infected with Salmonella enterica serovar Typhimurium. Infect. Immun. 72:2152-2159.[Abstract/Free Full Text]
59 - Zarember, K. A., and P. J. Godowski. 2002. Tissue expression of human Toll-like receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines. J. Immunol. 168:554-561.[Abstract/Free Full Text]
60 - Zeng, H., A. Q. Carlson, Y. Guo, Y. Yu, L. S. Collier-Hyams, J. L. Madara, A. T. Gewirtz, and A. S. Neish. 2003. Flagellin is the major proinflammatory determinant of enteropathogenic Salmonella. J. Immunol. 171:3668-3674.[Abstract/Free Full Text]
61 - Zhang, D., G. Zhang, M. S. Hayden, M. B. Greenblatt, C. Bussey, R. A. Flavell, and S. Ghosh. 2004. A toll-like receptor that prevents infection by uropathogenic bacteria. Science 303:1522-1526.[Abstract/Free Full Text]
Infection and Immunity, April 2005, p. 2344-2350, Vol. 73, No. 4
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.4.2344-2350.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Woods, D. C, Schorey, J. S, Johnson, A L
(2009). Toll-like receptor signaling in hen ovarian granulosa cells is dependent on stage of follicle maturation. Reproduction
137: 987-996
[Abstract]
[Full Text]
-
Winter, S. E., Thiennimitr, P., Nuccio, S.-P., Haneda, T., Winter, M. G., Wilson, R. P., Russell, J. M., Henry, T., Tran, Q. T., Lawhon, S. D., Gomez, G., Bevins, C. L., Russmann, H., Monack, D. M., Adams, L. G., Baumler, A. J.
(2009). Contribution of Flagellin Pattern Recognition to Intestinal Inflammation during Salmonella enterica Serotype Typhimurium Infection. Infect. Immun.
77: 1904-1916
[Abstract]
[Full Text]
-
Abasht, B., Kaiser, M. G., van der Poel, J., Lamont, S. J.
(2009). Genetic lines differ in Toll-like receptor gene expression in spleens of chicks inoculated with Salmonella enterica serovar Enteritidis. Poult. Sci.
88: 744-749
[Abstract]
[Full Text]
-
Thomson, N. R., Clayton, D. J., Windhorst, D., Vernikos, G., Davidson, S., Churcher, C., Quail, M. A., Stevens, M., Jones, M. A., Watson, M., Barron, A., Layton, A., Pickard, D., Kingsley, R. A., Bignell, A., Clark, L., Harris, B., Ormond, D., Abdellah, Z., Brooks, K., Cherevach, I., Chillingworth, T., Woodward, J., Norberczak, H., Lord, A., Arrowsmith, C., Jagels, K., Moule, S., Mungall, K., Sanders, M., Whitehead, S., Chabalgoity, J. A., Maskell, D., Humphrey, T., Roberts, M., Barrow, P. A., Dougan, G., Parkhill, J.
(2008). Comparative genome analysis of Salmonella Enteritidis PT4 and Salmonella Gallinarum 287/91 provides insights into evolutionary and host adaptation pathways. Genome Res
18: 1624-1637
[Abstract]
[Full Text]
-
Keestra, A. M., van Putten, J. P. M.
(2008). Unique Properties of the Chicken TLR4/MD-2 Complex: Selective Lipopolysaccharide Activation of the MyD88-Dependent Pathway. J. Immunol.
181: 4354-4362
[Abstract]
[Full Text]
-
Lillehoj, H. S., Kim, C. H., Keeler, C. L. Jr., Zhang, S.
(2007). Immunogenomic Approaches to Study Host Immunity to Enteric Pathogens. Poult. Sci.
86: 1491-1500
[Abstract]
[Full Text]
-
Keestra, A. M., de Zoete, M. R., van Aubel, R. A. M. H., van Putten, J. P. M.
(2007). The Central Leucine-Rich Repeat Region of Chicken TLR16 Dictates Unique Ligand Specificity and Species-Specific Interaction with TLR2. J. Immunol.
178: 7110-7119
[Abstract]
[Full Text]
-
Adriaensen, C., De Greve, H., Tian, J. Q., De Craeye, S., Gubbels, E., Eeckhaut, V., Van Immerseel, F., Ducatelle, R., Kumar, M., Hernalsteens, J.-P.
(2007). A Live Salmonella enterica Serovar Enteritidis Vaccine Allows Serological Differentiation between Vaccinated and Infected Animals. Infect. Immun.
75: 2461-2468
[Abstract]
[Full Text]
-
Vijay-Kumar, M., Wu, H., Jones, R., Grant, G., Babbin, B., King, T. P., Kelly, D., Gewirtz, A. T., Neish, A. S.
(2006). Flagellin Suppresses Epithelial Apoptosis and Limits Disease during Enteric Infection. Am. J. Pathol.
169: 1686-1700
[Abstract]
[Full Text]
-
Higgs, R., Cormican, P., Cahalane, S., Allan, B., Lloyd, A. T., Meade, K., James, T., Lynn, D. J., Babiuk, L. A., O'Farrelly, C.
(2006). Induction of a Novel Chicken Toll-Like Receptor following Salmonella enterica Serovar Typhimurium Infection. Infect. Immun.
74: 1692-1698
[Abstract]
[Full Text]