Erratum for Leverton and Kaper, Infect. Immun. 73 (2) 1034-1043.
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leverton, L. Q.
Right arrow Articles by Kaper*, J. B.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Leverton, L. Q.
Right arrow Articles by Kaper*, J. B.

 Previous Article  |  Next Article 

Infection and Immunity, April 2005, p. 2570, Vol. 73, No. 4
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.4.2570.2005

ERRATUM

Temporal Expression of Enteropathogenic Escherichia coli Virulence Genes in an In Vitro Model of Infection

Laura Q. Leverton1,2 and James B. Kaper*1,2

Department of Microbiology and Immunology,1 Center for Vaccine Development, School of Medicine, University of Maryland, Baltimore, Maryland2

Volume 73, no. 2, pages 1034-1043, 2005. Page 1035, Table 2, row 1, column 3, reverse primer for ler: "ACCAGGTCTGCCCTTGTTGA" should read "ACCAGGTCTGCCCTTCTTCA."

Row 4, column 3, reverse primer for eae: "GATTAACCTATGCCGTTCCA" should read "GATTAACCTCTGCCGTTCCA."

Infection and Immunity, April 2005, p. 2570, Vol. 73, No. 4
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.4.2570.2005





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leverton, L. Q.
Right arrow Articles by Kaper*, J. B.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Leverton, L. Q.
Right arrow Articles by Kaper*, J. B.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»