This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lim, J.
Right arrow Articles by Luckhart, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lim, J.
Right arrow Articles by Luckhart, S.

 Previous Article  |  Next Article 

Infection and Immunity, May 2005, p. 2778-2789, Vol. 73, No. 5
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.5.2778-2789.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Induction of Nitric Oxide Synthase in Anopheles stephensi by Plasmodium falciparum: Mechanism of Signaling and the Role of Parasite Glycosylphosphatidylinositols

Junghwa Lim,1 D. Channe Gowda,2 Gowdahalli Krishnegowda,2 and Shirley Luckhart1*

Department of Biochemistry, Virginia Tech, Blacksburg, Virginia,1 Department of Biochemistry and Molecular Biology, Hershey Medical Center, Pennsylvania State University, Hershey, Pennsylvania2

Received 2 November 2004/ Returned for modification 15 December 2004/ Accepted 7 January 2005


arrow
ABSTRACT
 
Malaria parasite (Plasmodium spp.) infection in the mosquito Anopheles stephensi induces significant expression of A. stephensi nitric oxide synthase (AsNOS) in the midgut epithelium as early as 6 h postinfection and intermittently thereafter. This induction results in the synthesis of inflammatory levels of nitric oxide (NO) in the blood-filled midgut that adversely impact parasite development. In mammals, P. falciparum glycosylphosphatidylinositols (PfGPIs) can induce NOS expression in immune and endothelial cells and are sufficient to reproduce the major effects of parasite infection. These effects are mediated in part by mimicry of insulin signaling by PfGPIs. In this study, we demonstrate that PfGPIs can induce AsNOS expression in A. stephensi cells in vitro and in the midgut epithelium in vivo. Signaling by P. falciparum merozoites and PfGPIs is mediated through A. stephensi Akt/protein kinase B and a pathway involving DSOR1, a mitogen-activated protein kinase kinase, and an extracellular signal-regulated kinase. However, despite the involvement of kinases that are also associated with insulin signaling in A. stephensi cells, signaling by P. falciparum and by PfGPIs is distinctively different from signaling by insulin. Therefore, although mimicry of insulin by PfGPIs appears to be restricted to mammalian hosts of P. falciparum, the conservation of PfGPIs as a prominent parasite-derived signal of innate immunity can now be extended to include Anopheles mosquitoes, indicating that parasite signaling of innate immunity is conserved in mosquito and mammalian cells.


arrow
INTRODUCTION
 
Anopheles stephensi, a primary vector of Plasmodium spp. in India and the Middle East, limits malaria parasite development with the inducible synthesis of nitric oxide (NO) (34) catalyzed by A. stephensi NO synthase (AsNOS (32, 33). Induction of AsNOS expression is proportional to the intensity of parasite infection and is detectable in the midgut by 6 h postinfection (15, 31). Early induction is critical to inhibition of parasite development: dietary provision of the pan-NOS inhibitor N{omega}-nitro-L-arginine, with a half life in blood of 3 to 6 h (13), resulted in significantly higher parasite infection intensities than did the inactive enantiomer N{omega}-nitro-D-arginine (34).

The NO-mediated defense of A. stephensi is analogous to mammalian NO-mediated inactivation of liver-invading sporozoites and blood-stage gametocytes (36, 42), indicating that mosquitoes and mammals share a conserved antiparasite defense. The activation of mammalian immune effectors, including inflammatory cytokines, adhesion molecules and iNOS, has been attributed to parasite GPIs (reviewed in (22) and to hemozoin (27, 38, 55). In general, GPIs consist of a conserved ethanolamine phosphate-trimannosylglucosaminyl glycan core attached to phosphatidylinositol. GPIs are ubiquitous in eukaryotic cells, where their primary function is to anchor proteins to the cell membrane. In the case of P. falciparum GPIs (PfGPIs), key structural features include a terminal fourth mannose, variable fatty acyl substituents with unsaturated acyl residue on sn-2 position on glycerol, and C16:0 acyl moiety on C-2 of inositol (22). Compared to animal cells, parasites express GPIs at levels severalfold higher than are required for protein-anchoring (20). A number of studies during the past decade have shown that GPIs of various pathogenic parasites, including Plasmodium, Trypanosoma, and Leishmania species, are biologically active. For example, parasite GPIs can induce the production of proinflammatory cytokines and NO (49, 63). From the point of view of the host, these innate immune responses represent a first line of defense for recognition and elimination of parasites through responses that are toxic to invading microorganisms.

Early studies revealed that PfGPIs could induce lipogenesis and glucose oxidation in rat adipocytes and that injection of PfGPIs into mice could induce hypoglycemia (52). These observations led to the hypothesis that PfGPIs were insulin-mimetic. Subsequently, it was demonstrated that malaria parasite GPIs exhibited signaling characteristics of the insulin second messenger phosphoinositolglycan (PIG) (7), which is released from host cell GPI by insulin stimulation of phosphatidylinositol-dependent phospholipase activity. Although no additional studies have examined the insulin-like signaling behavior of PfGPIs in detail, studies with synthetic insulin-mimetic PIGs, developed for treatment of insulin-resistant diabetes, provide relevant insight into parasite GPI signaling. In adipocytes, the insulin-mimetic PIGs bypass insulin receptor (INR) activation and instead interact with an unidentified cell surface protein to induce tyrosine phosphorylation of mammalian insulin receptor substrates (IRSs), including IRS-1 and IRS-3 (21, 39). PIG-dependent IRS phosphorylation is then followed by signaling through the two major insulin signaling pathways (Fig. 1) involving phosphatidylinositol 3-kinase (PI3-K), Akt/PKB, and MEK/ERK (21).



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 1. Generalized insulin signal transduction pathways. Selected orthologous receptor and pathway elements from human (Hs), D. melanogaster (Dm) (11, 48), A. aegypti (Aa) (45, 46) and A. gambiae (Ag) (47) are indicated.

Differential activation of mosquito immune genes by bacteria and Plasmodium spp. (18, 19, 34, 44). indicates a degree of immune recognition that may be based in part on activation of host pathways by parasite GPIs. Available data on well-known GPI-linked parasite proteins suggest that GPIs derived from both asexual and sexual stages would be available to signal induction of AsNOS expression in A. stephensi from bloodmeal ingestion through sporogonic development (16, 24, 37, 51). In addition, recent work suggests that relevant signaling pathways in mosquito cells could transduce signals from PfGPIs for AsNOS induction. Insulin signaling pathway gene products orthologous to those in Drosophila melanogaster (11, 48) have been described from Aedes aegypti (45, 46) and from Anopheles gambiae (47). Insulin signal transduction can induce iNOS expression in mammalian cells, revealing a connection between insulin signaling and inflammation (3). In Caenorhabditis elegans, the insulin signaling pathway upregulates antimicrobial response genes, suggesting that the link between insulin signaling and host defense has been conserved through evolution (40). In this study, we show that P. falciparum GPIs can induce AsNOS expression in vitro and in vivo by activating kinases associated with insulin signaling, indicating that both signaling by GPIs and functional relevance of GPIs to innate immunity are evolutionarily conserved.


arrow
MATERIALS AND METHODS
 
Materials. Chemicals, antisera, and other reagents were purchased from the following companies: human serum and human red blood cells from Continental Services Group; RPMI 1640, Trizol reagent, and Topo TA cloning kit from Invitrogen Life Technologies; minimal essential medium (MEM) from Cellgro; hydroxy-2-naphthalenylmethylphosphonic acid-Trisacetoxymethyl ester and genistein from Calbiochem; LY294002, wortmannin, PD98059, human insulin, and monoclonal mouse anti-phospho-ERK antisera from Sigma-Aldrich; bovine serum albumin from Fisher Scientific; polyclonal rabbit antiphospho-INR antisera, polyclonal rabbit anti-phospho-PKB antisera, polyclonal rabbit anti-phospho-JNK/SAPK antisera, horseradish peroxidase (HRP)-conjugated anti-rabbit immunoglobulin G (IgG) from Biosource International; HRP-conjugated anti-mouse IgG and SuperSignal West Pico chemiluminescent detection kit from Pierce; lactate reagent from Trinity Biotech; Moloney murine leukemia virus reverse transcriptase from Applied Biosystems; Lig'nScribe kit and MEGAscript T7 transcription kit from Ambion; Effectene Transfection Reagent from QIAGEN; and protease inhibitor cocktail from Roche Diagnostics.

Isolation of P. falciparum merozoites, purification of PfGPIs, and stimulation of ASE cells. For preparation of merozoites, P. falciparum (FCR-3 strain) was cultured to 30% parasitemia and incubated at 0.2% hematocrit as described (41) to prevent reinvasion of merozoites. The culture was centrifuged at 900 rpm at 4°C for 5 min to remove the majority of infected and uninfected red blood cells. During subsequent centrifugation of the supernatant at 1,800 rpm, approximately 50% of the total merozoites and the remaining infected and uninfected red blood cells formed a layered pellet. The top layer of merozoites was carefully aspirated. The supernatant was then centrifuged at 3,600 rpm to pellet the remaining merozoites. Collected merozoites were combined and washed with endotoxin-free incomplete RPMI medium and stored at –80°C. Protein-free PfGPIs were isolated as described previously and purified by high-pressure liquid chromatography (28, 41). All preparations of PfGPIs used in our work were tested for endotoxin (28).

Anopheles stephensi rearing, infection with P. falciparum, and provision of PfGPIs by artificial bloodmeal. Anopheles stephensi Liston were reared at 27°C and 75% relative humidity. Use of mice and hamsters as bloodmeal sources in the rearing of A. stephensi is in compliance with all federal guidelines and institutional policies. For infection with P. falciparum, 4- to 5-day-old mosquitoes were allowed to feed on an artificial bloodmeal containing cultured P. falciparum (NF54 strain), filtered human serum, washed human red blood cells and RPMI 1640 with HEPES. Mosquitoes fed on the above bloodmeal without parasites were used as controls. The use of anonymously collected human blood components for these procedures is in compliance with all federal guidelines and institutional policies. Bloodmeals were provided through 37°C water-jacketed baudruche membranes. Mosquitoes were allowed to feed for approximately 30 min to ensure that the majority of insects were engorged. Midguts of blood-fed mosquitoes were dissected immediately after the 30-min feeding period (0 h) and at various times post-bloodmeal. Total midgut RNA was isolated with Trizol reagent.

AsNOS expression was analyzed by quantitative reverse transcription (RT)-PCR using an ABI Prism 7700 Sequence Detection System (PE Applied Biosystems). The amplification efficiencies of AsNOS and S7 ribosomal protein gene were optimized so that AsNOS expression level could be normalized against S7 ribosomal protein gene expression by the comparative Ct method as described (14). PCR of AsNOS was performed with 700 nM each primer and 200 nM probe: AsNOS forward 5'GACCAAACCGGTCATCCTGAT3'; AsNOS reverse 5'GGAATCTTGCAGTCAACCATTTC3'; probe 5'CACCGTTCCGTTCGTTCTGGCA3'. For all samples, the reaction was duplicated.

For provision of PfGPIs, 5 µg of PfGPIs were dissolved in 10 µl 80% ethanol and this solution was added to 1 ml of bloodmeal mixture to yield a final concentration of 2.5 µM PfGPIs. As a control, 10 µl of 80% ethanol was added to a separate aliquot of the bloodmeal mixture for feeding to matched mosquitoes from the same cohort. Midguts were dissected from each group at various times post-blood meal and total RNA was isolated and used for quantitative RT-PCR of AsNOS expression as described above. For analyses of signaling protein activation, a third control group of mosquitoes fed only the bloodmeal mixture was added. At 0 h and 0.5 h post-blood meal, 30 midguts were dissected from each group for Western blots. Blood was removed by puncturing the midguts with minuten probes and washing twice with phosphate-buffered saline containing a protease inhibitor cocktail on ice. Midgut tissues were triturated in 80 µl of lysis buffer containing 10 mM Tris-HCl (pH 7.4), 100 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM NaF, 20 mM Na4P2O7, 2 mM Na3VO4, 0.1% sodium dodecyl sulfate (SDS), 0.5% sodium deoxycholate, 1% Triton X-100, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, 60 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 µg/ml pepstatin. Cell debris was removed by centrifugation for 10 min at 4°C. Protein concentration was measured by Bradford assay (Bio-Rad) and proteins were mixed with 2x Sample buffer containing 125 mM Tris-HCl (pH 6.8), 10% glycerol, 10% SDS, 0.006% bromophenol blue, and 130 mM dithiothreitol. Equivalent amounts of proteins per lane were electrophoretically separated by SDS-polyacrylamide gel electrophoresis (PAGE). Western blots were performed as described below.

Stimulation of A. stephensi cells. Immortalized, embryo-derived A. stephensi cell lines, ASE (29, 31) and MSQ43 (generously provided by the Department of Entomology, Water Reed Army Institute of Research (31), were cultured in modified MEM containing 5% heat-inactivated fetal bovine serum (E5 medium) at 28°C under 5% CO2. For stimulation, 1 x 106 cells were seeded in 96-well plates and allowed to grow overnight. Cells were stimulated with merozoites, incomplete medium, human insulin, or HEPES buffer. For kinase inhibition studies, cells were pretreated with inhibitors or diluents of inhibitors as controls for 30 to 60 min and then stimulated. For Western blots, cells were harvested at 5 to 30 min after stimulation, lysed in buffer described above and prepared for analysis. At 48 h after stimulation, RNA isolation and AsNOS expression analyses were performed as described above.

Western blot analyses. Lysates prepared from stimulated cells and midgut tissues were centrifuged at 10,000 rpm at 4°C for 10 min to remove insoluble material. Supernatant proteins were electrophoretically separated by SDS-PAGE and then transferred to nitrocellulose membrane using a semidry blotter (Bio-Rad). The membranes were blocked with Tris-buffered saline (pH 7.4; TBS) containing 3% bovine serum albumin. After washing with TBS containing 0.1% Tween 20, the membranes were incubated with a 1:1,000 dilution of polyclonal rabbit anti-phospho-INR antisera, a 1:1,000 dilution of polyclonal rabbit anti-phospho JNK/SAPK antisera, a 1:1,000 dilution of polyclonal rabbit anti-phospho-PKB antisera, or a 1:10,000 dilution of monoclonal mouse anti-phospho-ERK antisera for 2 h at room temperature. The INR antiserum recognizes three phosphotyrosine residues within the activation loop of the receptor, while the PKB antiserum recognizes a threonine phosphorylated by PDK1 and the ERK and JNK/SAPK antisera recognize bisphosphorylated (pT/pY) ERK and bisphosphorylated (pT/pY) JNK/SAPK, respectively. The sequences of peptides used to generate these antisera are 100% conserved with predicted amino acid sequences among orthologous proteins from mammals, D. melanogaster and/or other mosquito species, and, as such, were expected to recognize relevant A. stephensi proteins. Membranes were then washed and incubated with a 1:250,000 dilution of horseradish peroxidase (HRP)-conjugated anti-rabbit IgG or a 1:50,000 dilution of HRP-conjugated anti-mouse IgG. Peroxidase activity was detected with the SuperSignal West Pico chemiluminescent detection kit. For JNK/SAPK Western blot, signal intensities were measured using a GS-800 calibrated densitometer (Bio-Rad) and normalized against untreated, control cells.

Measurement of lactate release. ASE cells (1 x 106 per well in 96-well plates) were stimulated with human insulin, PfGPIs, or P. falciparum merozoites for 4 h. Cells stimulated with HEPES buffer, 80% ethanol, or incomplete medium were used as controls. Culture media were collected after 4 h and lactate level was measured as described (8) using lactate reagent.

Expression of INR, DSOR1, and Akt/PKB gene orthologs in the A. stephensi midgut. Total RNA was isolated from 10 to 15 P. falciparum infected and uninfected A. stephensi midguts at 24 h post-blood meal and from ASE cells as described. First strand cDNA was synthesized using MuLV reverse transcriptase. Fragments of A. stephensi INR, DSOR1, and Akt/PKB genes were amplified with degenerate primers: INR forward 5' GGNTCGTTNGGTATGGTTTA 3'; INR reverse 5' CGTTCCATTACNCCACCGTC 3'; DSOR1 forward 5' CGGANACGCCGAAATCAC 3'; DSOR1 reverse 5' TTCTANGGCGCNTTCTACAG 3'; Akt/PKB forward 5' TTCACCTTCATCATCCGCGG 3'; Akt/PKB reverse 5' ATCATCTCGTACATGACNACGCC 3'. PCR products were cloned into Topo TA plasmid. Double-stranded, partial sequences of A. stephensi INR, DSOR1, and Akt/PKB gene orthologs were deposited in GenBank and these sequences were used to design gene-specific primers for RT-PCR.

Conditions for RT-PCR analyses of the A. stephensi genes were as follows. INR: forward primer 5' GGGTCGTTGGGTATGGTTTA 3' and reverse primer 5' CGTTCCATTACCCCACCGTC 3', 1 cycle of 95°C for 10 min, 35 cycles of 94°C 30 s, 53°C 30 s, 72°C 1 min, and 1 cycle of 72°C 10 min. DSOR1: forward primer 5' CGGAGACGCCGAAATCAC 3' and reverse primer 5' TTCTATGGCGCGTTCTACAG 3', 1 cycle of 95°C 10 min, 35 cycles of 94°C 30 s, 56°C 30 s, 72°C 30 s, and 1 cycle of 72°C 10 min. Akt/PKB: forward primer 5' TTCACCTTCATCATCCGCGG 3' and reverse primer 5' ATCATCTCGTACATGACGACGCC 3', 1 cycle of 95°C 10 min, 35 cycles of 94°C 30 s, 59°C 30 s, 72°C 30 s, and 1 cycle of 72°C 10 min. Control reactions for each target gene were performed in the absence of RT to confirm a lack of contaminating genomic DNA.

Suppression of Akt/PKB and DSOR1 mRNA levels in MSQ43 cells by RNA interference (RNAi) and analyses of AsNOS Induction. To produce templates for double-stranded RNA synthesis, 858bp and 550bp of A. stephensi Akt/PKB and DSOR1 were amplified from plasmid clones by PCR. Sense and antisense ssRNA were synthesized using the Lig'nScribe kit and the MEGAscript T7 transcription kit. Double-stranded RNAs of A. stephensi Akt/PKB and DSOR1 were produced as described (30). For each transfection, 2.5 x 106 MSQ43 cells in 10 ml E5 medium were transfected with 2 µg of double-stranded RNA using Effectene Transfection Reagent; control cells were treated in an identical manner but without double-stranded RNA (e.g., mock transfection). To examine the reduction of mRNA levels of Akt/PKB and DSOR1 in transfected MSQ43 cells, total RNA was isolated from 6 h to 5 d posttransfection and RT-PCR was performed as described above. For stimulation experiments, culture medium was removed from MSQ43 cells at 12 h posttransfection and 1 x 106 MSQ43 cells were reseeded in 96-well plates. Cells were allowed to stabilize for 6 h and then stimulated with P. falciparum merozoites, incomplete medium, human insulin, or HEPES buffer for 48 h. Following stimulation, AsNOS expression was measured by quantitative RT-PCR as described above.

DNA sequencing and analysis. DNA sequencing was carried out by using a dideoxy dye termination method on an ABI sequencer (Perkin-Elmer Cetus) by UC Davis Sequencing. Nucleotide sequences were compared against standard databases and deposited in GenBank for AsINR (AY697415), AsDSOR1 (AY697414) and AsAkt/PKB (AY697413).

Statistical analyses. Data from replicated analyses are represented as means ± standard errors (SEs) and were analyzed using the Student t test. P values are shown in graphical representations of the data.


arrow
RESULTS
 
AsNOS expression in A. stephensi cells is induced by P. falciparum merozoites and PfGPIs. To identify the P. falciparum factor(s) responsible for AsNOS induction, we established an in vitro system using A. stephensi embryo-derived ASE and MSQ43 cell lines, tractable and proven models for AsNOS induction (31). Anopheles stephensi cells were stimulated with P. falciparum merozoites at a ratio of 15.6 or 1.56 merozoites per cell. These parasite to host cell ratios are comparable to natural infection in vivo. Specifically, ingestion of 1 to 2 µl of blood by A. stephensi from a host with a 10% parasitemia, typical in peripheral blood samples from life-threatening P. falciparum infections (5), would lead to midgut infections of 250 to 550 parasites per midgut epithelial cell. Our in vitro assays of 15.6 or 1.56 merozoites per mosquito cell would be typical of mosquito feeding on hosts with lower (0.25 to 0.5%) parasitemias (35). At 48 h after treatment, 15.6 and 1.56 merozoites per ASE cell induced AsNOS expression > 3-fold (P = 0.08) and >1.5-fold (P = 0.05), respectively, compared to medium-treated controls (Fig. 2A). Merozoites induced similar levels of AsNOS expression in MSQ43 cells (see below; Fig. 8D and 9D). These results are consistent with levels of AsNOS expression induced by natural parasite infection in vivo (31) and demonstrated that whole parasites contained AsNOS-inducing factors that were recognized by A. stephensi cells.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 2. AsNOS expression is induced by P. falciparum merozoites and PfGPIs. (A) ASE cells were stimulated with 15.6 merozoites per cell (equivalent to 0.25 µM GPIs; n = 3), with 1.56 merozoites per cell (equivalent to 0.025 µM GPIs; n = 2) or incomplete medium as a control for 48 h. (B) ASE cells were stimulated with 2.5 µM (n = 3), 0.25 µM (n = 5), or 0.025 µM PfGPIs (n = 1) in 80% ethanol or with an equivalent volume of 80% ethanol as a control for 48 h. (C) Midguts were dissected from A. stephensi immediately after (0 h) and from 1-48 h post-blood meal after PfGPI or control feeding for analysis of AsNOS expression. Data were derived from two replicates of experimental and control feeds with two separate cohorts of A. stephensi. In panels A to C, AsNOS expression levels were divided by control expression levels to show relative induction. Values represent means ± SEs. Data within each treatment or time point versus the control were analyzed using the Student t test; P values are shown.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 8. Plasmodium falciparum merozoites activate ERK and require DSOR1 for AsNOS induction. (A) ASE cells were pretreated for 30 min with 0.04 µM or 4 µM PD98059, a MEK inhibitor, dissolved in dimethyl sulfoxide or with an equivalent volume of dimethyl sulfoxide as a mock pretreatment (0 µM). After pretreatment, cells were stimulated with 1.7 µM human insulin in HEPES buffer (n = 8 for 0.04 µM inhibitor, n = 5 for 4 µM inhibitor) or with 15.6 P. falciparum merozoites per cell in incomplete RPMI 1640 medium (n = 2 for 0.04 µM inhibitor, n = 3 for 4 µM inhibitor) for 48 h. AsNOS expression levels were divided by mock pretreatment expression levels to show relative effects of the inhibitor on insulin (line) or parasite (bars) induction of AsNOS. Values represent means ± SEs. Data (inhibitor versus mock pretreatment) were analyzed using the Student t test; P values are shown. (B) Anti-phospho-ERK Western blot of ASE cells pretreated with 0.4 µM PD98059 or dimethyl sulfoxide then stimulated with 1.7 µM human insulin or with 15.6 P. falciparum merozoites per cell for 5 min. Unstimulated ASE cells were used as controls (incomplete medium- and HEPES buffer-stimulated cells yielded identical results, not shown). Anti-phospho-ERK antisera did not cross-react with P. falciparum merozoites (not shown). The figure shown is representative of replicated Western blots from independent experiments. (C) RT-PCRof DSOR1 expression levels following RNAi of A. stephensi DSOR1 in mock control (C) and double-stranded RNA-transfected (T) MSQ43 cells from 6 h to 5 d posttransfection. Ribosomal S7 protein gene RT-PCR amplification was used as a loading control and to confirm sample integrity. (D) AsNOS expression levels in mock- and DSOR1 double-stranded RNA-transfected cells were divided by expression levels in matched transfected cells stimulated with HEPES buffer or incomplete RPMI 1640 medium to show relative AsNOS induction by treatment with 1.7 µM insulin (n = 3) or with 15.6 P. falciparum merozoites per cell (n = 2), respectively. Values represent means ± SEs. Data within each treatment were analyzed using the Student t test; P values are shown.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 9. Plasmodium falciparum merozoites activate Akt and require Akt for AsNOS induction. (A) ASE cells were pretreated for 1 h with 1 µM or 20 µM LY294002, a PI3-K inhibitor, dissolved in 100% ethanol or with an equivalent volume of ethanol as a mock pretreatment (0 µM). After pretreatment, cells were stimulated with 1.7 µM human insulin in HEPES buffer (n = 2 for both concentrations of inhibitors) or with 15.6 P. falciparum merozoites per cell in incomplete RPMI 1640 medium (n = 3 for both concentrations of inhibitors) for 48 h. AsNOS expression levels were divided by mock pretreatment expression levels to show relative effects of the inhibitor on insulin (line) or parasite (bars) induction of AsNOS. Values represent means ± SEs. Data (inhibitor versus mock pretreatment) were analyzed using the Student t test; P values are shown. (B) Anti-phospho-Akt/PKB Western blot of ASE cells stimulated with 1.7 µM human insulin or with 15.6 P. falciparum merozoites per cell for 10 min or 30 min. Unstimulated ASE cells were used as controls (incomplete medium- and HEPES buffer-stimulated cells yielded identical results, not shown). Anti-phospho-Akt/PKB antisera did not cross-react with P. falciparum merozoites (not shown). Arrow indicates slower migrating, fully phosphorylated putative A. stephensi Akt/PKB. The figure shownis representative of replicated Western blots from independent experiments. C, RT-PCR of Akt expression levels following RNAi of A. stephensi Akt in mock control (C) and double-stranded RNA-transfected (T) MSQ43 cells from 6 h to 5 d posttransfection. Ribosomal S7 protein gene RT-PCR amplification was used as a loading control and to confirm sample integrity. (D) AsNOS expression levels in mock- and Akt double-stranded RNA-transfected cells were divided by expression levels in matched transfected cells stimulated with incomplete RPMI 1640 medium to show relative AsNOS induction by treatment with 15.6 P. falciparum merozoites per cell (n = 2), respectively. Values represent means ± SEs. Data within each treatment were analyzed using the Student t test; P values are shown.

To determine whether PfGPIs could induce AsNOS expression, ASE cells were stimulated with PfGPIs at concentrations equivalent to ingestion by A. stephensi of {approx}40,000 or 400,000 parasites (1% or 10% parasitemia [5]). Given that each malaria parasite contributes 107 GPIs (20), meals of 40,000 or 400,000 parasites would contain {approx}0.32 µM or 3.2 µM GPIs. Based on these calculations, we selected 0.025 to 2.5 µM PfGPIs for stimulation. Treatment with 0.25 µM and 2.5 µM PfGPIs induced AsNOS expression in ASE cells 1.7-fold (P = 0.01; Fig. 2B) and 5.2-fold (P = 0.03; Fig. 2B), respectively, compared to controls, indicating that biologically relevant levels of PfGPIs could induce AsNOS expression in our in vitro model system. Our results also suggested that P. falciparum components other than GPIs could induce AsNOS expression since 15.6 and 1.56 merozoites per ASE cells (equivalent to 0.25 µM and 0.025 µM PfGPIs, respectively) induced AsNOS expression 3-fold and 1.5-fold, respectively, (Fig. 2A), whereas 0.25 µM PfGPIs induced AsNOS expression only 1.7-fold and 0.025 µM PfGPIs did not induce AsNOS expression relative to controls (Fig. 2B).

AsNOS Expression in the A. stephensi midgut epithelium is induced by PfGPIs. To determine whether PfGPIs could function as an AsNOS-inducing ligand in vivo, we provided 2.5 µM PfGPIs in artificial bloodmeals to two separate cohorts of A. stephensi. Age-matched mosquitoes fed equivalent bloodmeals with only 80% ethanol added were used as controls. At various times after feeding, samples of total RNA from dissected midguts were analyzed for AsNOS expression by quantitative RT-PCR. AsNOS expression in midguts from PfGPI-treated A. stephensi was induced 1.4-fold (P = 0.05), >2.5-fold (P = 0.1), and > 2-fold (P = 0.03, P = 0.01) relative to controls at 0 h (immediately after feeding) and at 1 h, at 24 h and 48 h post-blood meal (Fig. 2C), indicating that PfGPIs signal AsNOS induction in vivo.

Putative INR-, DSOR1-, and Akt/PKB-encoding genes are expressed in A. stephensi cell lines and in the midgut. Based on previous observations that PfGPIs are insulin-mimetic (7, 52) and that insulin signaling can induce NOS expression in mammalian cells (3), we hypothesized that parasite GPIs signal AsNOS induction through pathways involving PI3-K, Akt/PKB and MEK/ERK. Initially, to establish the presence of these signaling molecules in mosquitoes, we characterized expression of A. stephensi genes encoding a predicted INR, the MEK homolog DSOR1, and Akt/PKB (Fig. 3). In nonquantitative RT-PCR assays, we determined that all three genes are expressed in the A. stephensi midgut, in the presence and absence of P. falciparum infection, and in the ASE cell line (Fig. 4). We also determined that ASE cells and the midgut epithelium are responsive to human insulin. Specifically, 1.7 µM insulin induced AsNOS expression in ASE cells maximally to 2.2-fold relative to controls at 48 h after treatment (Fig. 5A and B), while the same insulin concentration induced AsNOS expression in the midgut to 1.9-fold at 6 h and to 3.6-fold at 36 h postfeeding relative to controls (not shown).



View larger version (68K):
[in this window]
[in a new window]
  		FIG. 3. Alignment of predicted amino acid sequences of AsINR, AsDSOR1, and AsAkt/PKB with predicted orthologous sequences from A. gambiae, A. aegypti, and D. melanogaster. Conserved amino acids are represented in bold type. (A) The predicted amino acid sequence of AsINR gene fragment (AY697415) was aligned with A. gambiae INR (XP_320130), A. aegypti INR (AAB17094, and D. melanogaster INR (NP_524436). (B) The predicted amino acid sequence of AsDSOR1 gene fragment (AY697414) was aligned with A. gambiae DSOR1 (XP_322064) and D. melanogaster DSOR1 (NP_511098). Nucleotide sequences encoding overlined amino acid sequences were used to design gene specific primers for RNAi. (C) The predicted amino acid sequence of AsAkt/PKB gene fragment (AY697413) was aligned with A. gambiae Akt/PKB (EAA03708, A. aegypti Akt/PKB (AAP37655 and D. melanogaster Akt/PKB (CAA81204. Nucleotide sequences encoding overlined amino acid sequences were used to design gene specific primers for RNAi.



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 4. Anopheles stephensi INR, DSOR1, and Akt/PKB genes are expressed in ASE cells and in the midgut epithelium. Fragments of A. stephensi INR, DSOR1, and Akt/PKB genes were amplified from cDNA samples using gene-specific primers and cycling conditions described in the text. Control reactions were performed on RNA in the absence of reverse transcriptase to confirm a lack of contaminating genomic DNA. Results show amplifications from cDNA and RNA from A. stephensi midgut tissue 24 h postinfection with P. falciparum (Inf midgut), amplifications from cDNA and RNA prepared from A. stephensi midgut tissue 24 h after an uninfected bloodmeal (Uninf midgut), amplifications from cDNA and RNA prepared from ASE cells, and control amplifications without added cDNA or RNA (no-template control, NTC). A representative figure of RT-PCR results is shown.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 5. AsNOS expression is induced maximally in ASE cells by 1.7 µM human insulin at 48 h after stimulation. (A) ASE cells were stimulated with various concentrations of human insulin in HEPES buffer (n = 3 for 0.17 µM, n = 7 for 0.85 µM, n = 8 for 1.7 µM, n = 3 for 3.4 µM, n = 4 for 17 µM) or HEPES buffer only as a control for 48 h. (B) ASE cells were stimulated with 1.7 µM human insulin or HEPES buffer for 2- 48 h (n = 4 for 2 h, n = 4 for 6 h, n = 4 for 12 h, n = 4 for 24 h, n = 4 for 36 h, n = 9 for 48 h). For panels A and B, AsNOS expression levels were measured by quantitative RT-PCR and were divided by control expression levels to show relative induction. Values represent means ± SEs.

Plasmodium falciparum merozoites signal A. stephensi cells through non-INR protein tyrosine kinase. To determine whether P. falciparum signaled AsNOS induction through activation of an A. stephensi INR, ASE cells were pretreated with HNMPA-(AM)3, an INR tyrosine kinase inhibitor, prior to stimulation. In these and subsequent inhibitor assays, human insulin was used as a standard to verify involvement of insulin signaling pathway components. Plasmodium falciparum merozoites were used to stimulate ASE cells to account for potential involvement of signaling factor(s) other than PfGPIs. Pretreatment of ASE cells with 0.1 µM or 1 µM HNMPA-(AM)3 led to, respectively, 45% (P = 0.02) and 32% (P = 0.02) decreases in insulin-induced AsNOS expression and 92% (P = 0.0002) and 84% (P = 0.0001) decreases in merozoite-induced AsNOS expression relative to controls (Fig. 6A). These results suggested that INR activation is necessary for both insulin and parasite induction of AsNOS. In A. aegypti, HNMPA-(AM)3 inhibited bovine insulin signaling in ovaries, although a 90% reduction in signaling required a much higher concentration (1 mM) of HNMPA-(AM)3 than was used in our assays (46).



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 6. Plasmodium falciparum merozoites signal A. stephensi cells and AsNOS induction through non-INR PTK. (A) ASE cells were pretreated for 1 h with HNMPA-(AM)3, an inhibitor of INR activation, dissolved in dimethyl sulfoxide or with an equivalent volume of dimethyl sulfoxide as a mock pretreatment (0 µM). After pretreatment, cells were stimulated with 1.7 µM human insulin in HEPES buffer (n = 7 for 0.1 µM inhibitor, n = 4 for 1 µM inhibitor) or with 15.6 P. falciparum merozoites per cell in incomplete RPMI 1640 medium (n = 2 for both inhibitor concentrations) for 48 h prior to analysis of AsNOS expression. (B) Anti-phospho-INR Western blot of ASE cells stimulated with 1.7 µM human insulin or with 15.6 P. falciparum merozoites per cell for 5-30 min. Unstimulated ASE cells (NS) were used as controls (incomplete medium- and HEPES buffer-stimulated cells yielded identical results, not shown). Anti-phospho-INR antisera did not cross-react with P. falciparum merozoites (not shown). The figure shown is representative of replicated Western blots from independent experiments. (C) ASE cells were pretreated for 1 h with genistein, a PTK inhibitor, dissolved in dimethyl sulfoxide or with an equivalent volume of dimethyl sulfoxide as a mock pretreatment (0 µM). After pretreatment, cells were stimulated with P. falciparum merozoites as in A (n = 3 for 10–3 µM inhibitor, n = 2 for 10–4 µM inhibitor). For panels A and C, AsNOS expression levels were divided by mock pretreatment expression levels to show relative effects of the inhibitor on parasite induction of AsNOS expression. Values represent means ± SEs. Data (inhibitor versus mock pretreatment) were analyzed using the Student t test; P values are shown.

In our assays with HNMPA-(AM)3 and other inhibitors (see below), we noted an unexpected pattern of higher AsNOS induction levels at higher inhibitor concentrations. We determined that treatment of ASE cells with high concentration of inhibitors induced phosphorylation of a putative JNK/SAPK (Fig. 7), a signaling protein whose activation has been associated with stress-related induction of NOS expression and NO synthesis in mammalian cells (10, 23). Therefore, it appears that JNK/SAPK activation in A. stephensi cells may account for slightly higher AsNOS induction levels at higher inhibitor concentrations.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 7. Treatment with kinase inhibitors induces JNK/SAPK phosphorylation in ASE cells. ASE cells were treated with 100 µM LY294002 for 30 min, 100 µM genistein for 1 h, 100 µM HNMPA-(AM)3 for 1 h or 40 µM PD98059 for 30 min. After stimulation, cells were collected and lysed as described in the text and applied to anti-phospho-JNK/SAPK Western blots. Signal intensity of each band is shown. The figure shown is representative of replicated Western blots from independent experiments.

To verify INR activation by insulin and P. falciparum merozoites, anti-phospho-INR Western blots were performed on lysates prepared from ASE cells stimulated with 1.7 µM human insulin or 15.6 merozoites per cell for 5, 15, and 30 min. A cross-reacting band of 98 kDa, a molecular mass consistent with that reported for the A. aegypti INR ß subunit (45), was detected in insulin-stimulated cells, but not in merozoite-stimulated cells (Fig. 6B). Plasmodium falciparum signaling was not associated with INR activation, a result inconsistent with inhibition by HNMPA-(AM)3. However, HNMPA-(AM)3 can inhibit PTKs other than those associated with INRs, including nonreceptor PTKs (50) and p59 hck, a src family PTK, which has been implicated in PfGPI signaling in mammalian cells (58, 59).

To determine whether PTKs other than the INR tyrosine kinase were involved in parasite signaling of AsNOS induction, we pretreated ASE cells with genistein, a PTK inhibitor that is inactive against INR (1), prior to parasite stimulation. Pretreatment with 10–4 or 10–3 µM genistein reduced AsNOS expression by 47% (P = 0.04) and 21% (P = 0.01), respectively, in merozoite-stimulated cells relative to controls (Fig. 6C), suggesting that A. stephensi non-INR PTKs are involved in parasite signaling.

Plasmodium falciparum merozoites activate ERK and require DSOR1 for AsNOS induction. To determine whether P. falciparum signals AsNOS induction through MEK activation, ASE cells were pretreated with PD98059, a MEK inhibitor, prior to stimulation. Pretreatment of ASE cells with 0.04 µM or 4 µM PD98059, respectively, reduced AsNOS expression by 17% (P = 0.03) and 22% (P = 0.09) in insulin-stimulated cells and by 75% (P = 0.002) and 60% (P = 0.001) in merozoite-stimulated cells relative to controls (Fig. 8A), suggesting that MEK activation is critical to parasite and insulin induction of AsNOS. To verify this conclusion, we first examined activation of ERK by Western blotting in cells stimulated by merozoites and human insulin, then used RNAi-dependent gene silencing to determine whether A. stephensi DSOR1, the putative activator of ERK, was necessary for parasite- and insulin-induced AsNOS expression.

Anti-phospho-ERK Western blots were performed on protein samples prepared from ASE cells stimulated with 1.7 µM human insulin or 15.6 merozoites per cell for 5 or 15 min. A single cross-reacting band of 50 kDa, somewhat larger than the 44-kDa Drosophila melanogaster ortholog (4), was detected in samples collected from insulin- and parasite-stimulated cells (Fig. 8B). As expected, insulin induced ERK phosphorylation within 5 min in ASE cells relative to controls (Fig. 8B, lane 2 versus 3) and PD98059 pretreatment reduced activation of ERK (Fig. 8B, lane 2 versus 5) suggesting the specificity of this inhibitor. Unexpectedly, merozoite stimulation reduced ERK phosphorylation relative to controls after 5 min (Fig. 8B, lane 1 versus 3); identical results were obtained at 15 min after stimulation (not shown). Further, PD98059 pretreatment reduced ERK phosphorylation in response to merozoites to an undetectable level (Fig. 8B, lane 1 versus 4). Because PD98059 also inhibited parasite induction of AsNOS (Fig. 8A), we infer that some level of ERK phosphorylation is required for parasite induction of AsNOS.

To determine whether DSOR1, the predicted upstream activator of A. stephensi ERK, was necessary for P. falciparum and insulin induction of AsNOS, we silenced DSOR1 with RNAi in MSQ43 cells prior to stimulation. In DSOR1 double-stranded RNA-transfected cells, DSOR1 mRNA levels were undetectable from 6 h to 5 d posttransfection (Fig. 8C). For AsNOS induction assays, MSQ43 cells were stimulated at 18 h posttransfection with 15.6 merozoites per cell, 1.7 µM human insulin, medium or HEPES buffer for 48 h. DSOR1 RNAi reduced merozoite induction of AsNOS by 87% relative to mock transfected cells (P = 0.04), while insulin induction was reduced by only 41% relative to mock transfected cells (P = 0.007; Fig. 8D). These data mirrored levels of AsNOS induction observed following pretreatment with PD98059 (Fig. 8A) and confirmed that DSOR1 and its likely impact on ERK activation are necessary for P. falciparum induction of AsNOS.

Plasmodium falciparum merozoites require Akt/PKB for AsNOS induction. To determine whether P. falciparum signals AsNOS induction through activation of A. stephensi PI3-K and Akt/PKB, ASE cells were pretreated with LY294002 and wortmannin, PI3-K inhibitors, prior to stimulation with human insulin or P. falciparum merozoites. Pretreatment of ASE cells with 1 µM or 20 µM LY294002 had no effect on the insulin-mediated induction of AsNOS compared to controls (Fig. 9A). Similar results were obtained when cells were pretreated with 1 x 10–4 to 10 µM wortmannin prior to insulin stimulation (not shown). In contrast to our results, 10–2 to 100 µM LY294002 reduced insulin-stimulated steroidogenesis in A. aegypti ovary cells by 60% (46), suggesting that insulin signaling varies among mosquito cell types. Treatment with 1 µM or 20 µM LY294002 reduced AsNOS expression by 65% (P = 0.0001) and 51% (P = 0.0002), respectively, in merozoite-stimulated cells relative to controls (Fig. 9A), suggesting that PI3-K activity is critical to parasite induction of AsNOS. To verify this conclusion, we examined activation of Akt/PKB by Western blotting in ASE cells stimulated by human insulin and merozoites, then used RNAi-dependent gene silencing to determine whether A. stephensi Akt/PKB was necessary for parasite-induced AsNOS expression.

Anti-phospho-Akt Western blots were performed on lysates prepared from ASE cells stimulated with 1.7 µM human insulin or 15.6 merozoites per cell for 10 or 30 min. A 56 kDa band and a slightly slower migrating band of 58 kDa cross-reacted with the anti-phospho-Akt antisera (Fig. 9B). We suggest that this 58 kDa band is the result of a mass shift from multiple phosphorylation events as has been described for mouse Akt/PKB (17). As predicted from results with LY294002 and wortmannin (see above), insulin did not induce phosphorylation of a putative Akt/PKB (Fig. 9B, lane 1 versus 2 and lane 4 versus 5) while merozoites induced phosphorylation of Akt/PKB relative to controls at 10 and 30 min (Fig. 9B, arrow, lane 1 versus 3 and lane 4 versus 6).

To determine whether Akt/PKB was necessary for P. falciparum induction of AsNOS, we silenced Akt/PKB with RNAi in MSQ43 cells prior to stimulation. In Akt/PKB double-stranded RNA-transfected cells, Akt/PKB mRNA levels were undetectable from 6 h to 5 d posttransfection (Fig. 9C). For AsNOS induction assays, MSQ43 cells were stimulated at 18 h posttransfection with 15.6 merozoites per cell or medium for 48 h. As expected, Akt/PKB RNAi reduced merozoite induction of AsNOS by 65% relative to mock transfected cells (P = 0.00002; Fig. 9D), indicating a prominent role for Akt/PKB activation in parasite induction of AsNOS.

Plasmodium falciparum merozoites and PfGPIs are not insulin-mimetic to A. stephensi cells. Based on observations that PfGPIs are insulin-mimetic to mammalian cells (7, 52), we hypothesized that merozoites and PfGPIs may be perceived as insulin-mimetic to A. stephensi cells. Because insulin induces lactate release rather than glucose uptake in D. melanogaster Kc cells (8), we assayed lactate release in ASE cells stimulated with 0.17, 1.7, or 17 µM human insulin or HEPES buffer from 1 to 8 h after treatment. At 4 h after treatment with 1.7 µM insulin, lactate release relative to control cells was maximal and nearly identical to the 1.3-fold induction reported for Kc cells (not shown) (8). Although these assays confirmed that ASE cells were similar to Kc cells in response to insulin, stimulation with PfGPIs and merozoites failed to induce significant lactate release relative to control treatments (Fig. 10). Our data indicate that, while merozoites and PfGPIs activate mosquito cells through signaling proteins that are associated with insulin signal transduction pathways, neither merozoites nor PfGPIs are insulin-mimetic to A. stephensi cells.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 10. Plasmodium falciparum merozoites and PfGPIs do not mimic the effects of insulin on lactate release by A. stephensi cells. ASE cells were stimulated with 2.5 µM PfGPI in 80% ethanol (n = 2), with 15.6 P. falciparum merozoites per cell in incomplete medium (n = 2), or with 1.7 µM human insulin in HEPES buffer (n = 2) for 4 h. Matched control cells for each replicate were stimulated with equivalent volumes of HEPES buffer, incomplete medium or 80% ethanol. Lactate levels are represented as means ± SEs. Data within each treatment were analyzed using the Student t test.

PfGPIs signal the A. stephensi midgut epithelium through activation of Akt/PKB and ERK. Based on our results that P. falciparum signals AsNOS induction in vitro through DSOR1/ERK- and PI3-K/Akt-dependent pathways, we reasoned that PfGPI signaling in vivo would recapitulate these pathway associations. To address this question, two separate cohorts of female A. stephensi were provided with a bloodmeal supplemented with 2.5 µM PfGPIs in 80% ethanol, a bloodmeal supplemented with an equivalent volume of 80% ethanol, or an unmodified bloodmeal. Midguts were dissected at 0 h (immediately after) and at 0.5 h after feeding and prepared for Western blots of ERK and Akt/PKB phosphorylation. At both time points, PfGPIs induced phosphorylation of ERK and Akt/PKB in the A. stephensi midgut epithelium relative to both controls (Fig. 11) indicating that merozoites (Fig. 8B and 9B) and PfGPIs signal through activation of A. stephensi Akt/PKB and ERK.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 11. Plasmodium falciparum GPIs rapidly activate putative A. stephensi Akt/PKB and ERK in the mosquito midgut epithelium. Anti-phospho-Akt and anti-phospho-ERK Western blots of A. stephensi midgut tissue proteins immediately after (0 h) and 0.5 h after feeding on artificial bloodmeals with PfGPIs, 80% ethanol, or nothing added (blood only). The figure shown is representative of replicated Western blots from independent experiments.


arrow
DISCUSSION
 
Current efforts to control malaria parasite transmission include the development of genetically modified Anopheles mosquitoes that exhibit enhanced refractoriness to Plasmodium spp. The search for antiparasite effectors has identified some promising targets in the immune-responsive mosquito, including melanotic encapsulation and the synthesis of toxic reactive oxygen species, antimicrobial peptides, and NOS, as well as putative nonself recognition factors and signaling cascades implicated in transducing responses to bacterial challenge (reviewed in reference 17). Although the repertoire of reported responses to malaria parasite infection and invasion may be confounded by resident microbial flora in Anopheles (56), significant expression of immune genes in antibiotic-treated, parasite-infected mosquitoes has consistently predicted the existence of Plasmodium-specific mechanisms of gene induction (34, 44). However, the identity of parasite-derived signaling factors capable of inducing specific responses in Anopheles cells has remained unknown until completion of the work described here.

In mammalian cells, PfGPIs are sufficient to account for the most notable effects of P. falciparum (53, 54, 57). We have demonstrated that 2.5 µM PfGPIs can induce AsNOS expression >5-fold in A. stephensi cells, results that are consistent with inductions of NO synthesis of 1.5-fold and 4-fold by 1 µM and 10 µM PfGPIs, respectively, in mouse macrophages (57). During parasite infection, induction of AsNOS expression in the midgut is biphasic, with >2-fold inductions at 6 h, 36 h, and 48 h after feeding (31). Provision of PfGPIs in the bloodmeal also induced a biphasic pattern of AsNOS expression in the mosquito midgut (Fig. 2C), with the earlier initial induction compared to natural infection (0 to 1 h versus 6 h) likely due to the more immediate availability of a larger concentration of PfGPIs in the midgut after feeding. The similarity of AsNOS induction patterns following feeding on PfGPIs and natural infection suggests that parasite GPIs are an important signal for AsNOS induction prior to (<24 h) and during parasite invasion (24 to 48 h) of the midgut.

Plasmodium falciparum and PfGPIs signal A. stephensi cells through insulin-responsive PI3-K/Akt and DSOR1/ERK. In mouse macrophages, PfGPIs induced rapid phosphorylation of ERK2, although PD98059 pretreatment suggested that ERK signaling was not involved in induction of macrophage NO synthesis by PfGPIs (63). In our studies with A. stephensi, stimulation of different target cells (ASE cells in vitro and midgut cells in vivo) with both whole parasites and PfGPIs revealed important information about ERK signaling. Although some level of ERK phosphorylation is necessary for AsNOS induction by P. falciparum in vitro (Fig. 8A and 8), ERK phosphorylation by PfGPIs in vivo (Fig. 11) was more prominent.

In mammalian cells, nonphosphorylated, monophosphorylated, and fully bisphosphorylated forms of ERK2 are detectable (9, 60), with the balance of these forms in different cell types maintained by the opposing action of MEK1 and multiple protein phosphatases. Based on these observations, it was proposed that diverse signals may be integrated at the phosphatase level, rather than the kinase level, to dictate the cellular responses to external stimuli (61). Indeed, the activity of monophosphorylated ERK2 was determined to be intermediate to that of unphosphorylated and fully active bisphosphorylated ERK2 (62). The reduction in ERK phosphorylation within 5 min of parasite stimulation, together with our knockout results, suggests that an ERK pool with diminished levels of bisphosphorylated ERK and perhaps higher levels of functional, monophosphorylated ERK drives the MEK-dependent cellular response to P. falciparum in ASE cells. As with ERK activation, we noted subtle differences in Akt activation in A. stephensi cells in vitro and in vivo. Specifically, PfGPI-induced Akt/PKB phosphorylation in midgut cells (Fig. 11) did not result in the protein mass shift observed following P. falciparum stimulation of ASE cells (Fig. 9B). While some of these differences may be attributable to physiological differences between ASE and midgut cells, they also suggest that multiple signals from whole parasites, including at least PfGPIs and perhaps hemozoin (27, 38, 55) and others, contribute to AsNOS induction.

In addition to mimicry of insulin, PfGPIs signal mammalian cells through protein kinase C{varepsilon}, PTK p59 hck, and nuclear factor-{kappa}B/c-rel (57, 59). Additional data indicate that Toll-like receptors are activated by malaria parasites (28), a signaling mechanism that is well established for GPIs of the parasitic protozoan Trypanosoma cruzi (2, 6). Although our data indicate involvement of kinases associated with insulin signaling in AsNOS induction by P. falciparum and PfGPIs, these agents are not insulin-mimetic to A. stephensi cells. We conclude that activation of A. stephensi Akt/PKB and DSOR1/ERK by P. falciparum merozoites and PfGPIs is likely due to activation of pathways that share signaling components with insulin signal transduction pathways. Akt/PKB, for example, phosphorylates more than 50 known mammalian substrates associated with cell growth, defense, survival, and metabolism (25), suggesting that malaria parasite activation of A. stephensi Akt/PKB perturbs multiple pathways and physiological processes in A. stephensi cells. Further, inhibition of parasite signaling of AsNOS induction by genistein, a PTK inhibitor that is inactive against the INR (1), indicates that other PTKs, perhaps including representatives of the src family, are involved in parasite signaling of AsNOS induction. Therefore, mimicry of insulin by PfGPIs appears to be restricted to mammalian hosts of P. falciparum, but the conservation of PfGPIs as a prominent parasite-derived signal of innate immunity can now be extended to include Anopheles mosquitoes. This novel finding significantly increases the likelihood of identifying additional signaling pathways and downstream effectors associated with mosquito resistance to parasite development.

In general, the context of parasite signaling of AsNOS induction in the mosquito midgut is likely to be complicated by simultaneous exposure of midgut cells to dynamic concentrations of parasite-derived factors, mosquito-derived factors and exogenous factors in mammalian blood ingested during feeding. The latter factors include human insulin, which can induce AsNOS expression after feeding, and human transforming growth factor -ß1, which alters AsNOS induction and parasite infection in A. stephensi (31). We are challenged, therefore, to determine whether these factor(s) synergize or interfere with other signals, endogenous and exogenous in the blood-filled midgut, to mediate anti-parasite immunity in the mosquito. Cross talk among pathways of interest to us is well known from mammalian systems. For example, transforming growth factor ß1-mediated growth inhibition is dependent on activation of IRS proteins (26), while the effects of transforming growth factor ß1 are regulated by PI3-K/Akt at the level of direct interaction between Akt and Smad3 (12, 43). Hence, an understanding of the complexity of the signaling milieu in the mosquito, which exhibits remarkable conservation with that in the mammalian host, is necessary for the success of efforts to manipulate signaling factors, pathways or effector genes to enhance mosquito refractoriness.


arrow
ACKNOWLEDGMENTS
 
This work was supported by Public Health Service grants AI41027 and AI60664 from the National Institute of Allergy and Infectious Diseases at the National Institutes of Health.

We thank Jackie Williams and Megan Dowler of the Walter Reed Army Institute of Research for their assistance with and provision of materials for P. falciparum infections.


arrow
FOOTNOTES
 
* Corresponding author. Present address: Department of Medical Microbiology and Immunology, 3146 Tupper Hall, One Shields Avenue, University of California at Davis, School of Medicine, Davis, CA 95616. Phone: (530) 754-6963. Fax: (530) 752-8692. E-mail: sluckhart{at}ucdavis.edu. Back

Editor: W. A. Petri, Jr.


arrow
REFERENCES
 
    1
  1. Abler, A., J. A. Smith, P. A. Randazzo, P. L. Rothenberg, and L. Jarett. 1992. Genistein differentially inhibits postreceptor effects of insulin in rat adipocytes without inhibiting the insulin receptor kinase. J. Biol. Chem. 267:3946-3951.[Abstract/Free Full Text]
    2. 2
  2. Almeida, I. C., M. M. Camargo, D. O. Procopio, L. S. Silva, A. Mehlert, L. R. Travassos, R. T. Gazzinelli, and M. A. Ferguson. 2000. Highly purified glycosylphosphatidylinositols from Trypanosoma cruzi are potent proinflammatory agents. EMBO J. 19:1476-1485.[CrossRef][Medline]
    3. 3
  3. Begum, N., L. Ragolia, J. Rienzie, M. McCarthy, and N. Duddy. 1998. Regulation of mitogen-activated protein kinase phosphatase-1 induction by insulin in vascular smooth muscle cells. Evaluation of the role of the nitric oxide signaling pathway and potential defects in hypertension. J. Biol. Chem. 273:25164-25170.[Abstract/Free Full Text]
    4. 4
  4. Biggs, W. H., 3rd, and S. L. Zipursky. 1992. Primary structure, expression, and signal-dependent tyrosine phosphorylation of a Drosophila homolog of extracellular signal-regulated kinase. Proc. Natl. Acad. Sci. USA 89:6295-6299.[Abstract/Free Full Text]
    5. 5
  5. Bruce-Chwatt, L. J. 1971. Essential Malariology. John Wiley and Sons, New York, N.Y.
    6. 6
  6. Campos, M. A., I. C. Almeida, O. Takeuchi, S. Akira, E. P. Valente, D. O. Procopio, L. R. Travassos, J. A. Smith, D. T. Golenbock, and R. T. Gazzinelli. 2001. Activation of toll-like receptor-2 by glycosylphosphatidylinositol anchors from a protozoan parasite. J. Immunol. 167:416-423.[Abstract/Free Full Text]
    7. 7
  7. Caro, H. N., N. A. Sheikh, J. Taverne, J. H. Playfair, and T. W. Rademacher. 1996. Structural similarities among malaria toxins insulin second messengers, and bacterial endotoxin. Infect Immun. 64:3438-3441.[Abstract]
    8. 8
  8. Ceddia, R. B., G. J. Bikopoulos, A. J. Hilliker, and G. Sweeney. 2003. Insulin stimulates glucose metabolism via the pentose phosphate pathway in Drosophila Kc cells. FEBS Lett. 555:307-310.[CrossRef][Medline]
    9. 9
  9. Cha, H., and P. Shapiro. 2001. Tyrosine-phosphorylated extracellular signal-regulated kinase associates with the Golgi complex during G2/M phase of the cell cycle: evidence for regulation of Golgi structure. J. Cell Biol. 153:1355-1367.[Abstract/Free Full Text]
    10. 10
  10. Chan, E. D., and D. W. Riches. 2001. IFN-gamma + LPS induction of iNOS is modulated by ERK, JNK/SAPK, and p38(mapk) in a mouse macrophage cell line. Am. J. Physiol. Cell Physiol. 280:C441-450.[Abstract/Free Full Text]
    11. 11
  11. Clemens, J. C., C. A. Worby, N. Simonson-Leff, M. Muda, T. Maehama, B. A. Hemmings, and J. E. Dixon. 2000. Use of double-stranded RNA interference in Drosophila cell lines to dissect signal transduction pathways. Proc. Natl. Acad. Sci. USA 97:6499-6503.[Abstract/Free Full Text]
    12. 12
  12. Conery, A. R., Y. Cao, E. A. Thompson, C. M. Townsend, Jr., T. C. Ko, and K. Luo. 2004. Akt interacts directly with Smad3 to regulate the sensitivity to TGF-beta induced apoptosis. Nat. Cell Biol. 6:366-372.[CrossRef][Medline]
    13. 13
  13. Conner, E. M., S. Aiko, M. Fernandez, H. D. Battarbee, L. Gray, and M. B. Grisham. 2000. Duration of the hemodynamic effects of N(G)-nitro-L-arginine methyl ester in vivo. Nitric Oxide. 4:85-93.[CrossRef][Medline]
    14. 14
  14. Crampton, A., and S. Luckhart. 2001. The role of As60A, a TGF-beta homolog, in Anopheles stephensi innate immunity and defense against Plasmodium infection. Infection, Genetics Evolution. 1:131-141.
    15. 15
  15. Crampton, A. L., and S. Luckhart. 2001. Isolation and characterization of As60A, a transforming growth factor-beta gene, from the malaria vector Anopheles stephensi. Cytokine 13:65-74.[CrossRef][Medline]
    16. 16
  16. del Carmen Rodriguez, M., P. Gerold, J. Dessens, K. Kurtenbach, R. T. Schwartz, R. E. Sinden, and G. Margos. 2000. Characterisation and expression of pbs25, a sexual and sporogonic stage specific protein of Plasmodium berghei. Mol. Biochem. Parasitol. 110:147-159.[CrossRef][Medline]
    17. 17
  17. Dimopoulos, G. 2003. Insect immunity and its implication in mosquito-malaria interactions. Cell Microbiol. 5:3-14.[CrossRef][Medline]
    18. 18
  18. Dimopoulos, G., A. Richman, H. M. Muller, and F. C. Kafatos. 1997. Molecular immune responses of the mosquito Anopheles gambiae to bacteria and malaria parasites. Proc. Natl. Acad. Sci. USA 94:11508-11513.[Abstract/Free Full Text]
    19. 19
  19. Dimopoulos, G., D. Seeley, A. Wolf, and F. C. Kafatos. 1998. Malaria infection of the mosquito Anopheles gambiae activates immune-responsive genes during critical transition stages of the parasite life cycle. EMBO J. 17:6115-6123.[CrossRef][Medline]
    20. 20
  20. Ferguson, M. A., J. S. Brimacombe, S. Cottaz, R. A. Field, L. S. Guther, S. W. Homans, M. J. McConville, A. Mehlert, K. G. Milne, J. E. Ralton, and et al. 1994. Glycosyl-phosphatidylinositol molecules of the parasite and the host. Parasitology 108 Suppl.:S45-54.
    21. 21
  21. Frick, W., A. Bauer, J. Bauer, S. Wied, and G. Muller. 1998. Insulin-mimetic signalling of synthetic phosphoinositolglycans in isolated rat adipocytes. Biochem J. 336:163-181.
    22. 22
  22. Gowda, D. C. 2002. Structure and activity of glycosylphosphatidylinositol anchors of Plasmodium falciparum. Microbes Infect. 4:983-990.[CrossRef][Medline]
    23. 23
  23. Guan, Z., S. Y. Buckman, L. D. Springer, and A. R. Morrison. 1999. Both p38alpha(MAPK) and JNK/SAPK pathways are important for induction of nitric-oxide synthase by interleukin-1beta in rat glomerular mesangial cells. J. Biol. Chem. 274:36200-36206.[Abstract/Free Full Text]
    24. 24
  24. Han, Y. S., and C. Barillas-Mury. 2002. Implications of Time Bomb model of ookinete invasion of midgut cells. Insect Biochem. Mol. Biol. 32:1311-1316.[CrossRef][Medline]
    25. 25
  25. Hanada, M., J. Feng, and B. A. Hemmings. 2004. Structure, regulation and function of PKB/AKT-a major therapeutic target. Biochim. Biophys. Acta. 1697:3-16.[Medline]
    26. 26
  26. Huang, S. S., S. M. Leal, C. L. Chen, I. H. Liu, and J. S. Huang. 2004. Cellular growth inhibition by TGF-beta1 involves IRS proteins. FEBS Lett. 565:117-121.[CrossRef][Medline]
    27. 27
  27. Jaramillo, M., D. C. Gowda, D. Radzioch, and M. Olivier. 2003. Hemozoin increases IFN-gamma-inducible macrophage nitric oxide generation through extracellular signal-regulated kinase- and NF-kappa B-dependent pathways. J. Immunol. 171:4243-4253.[Abstract/Free Full Text]
    28. 28
  28. Krishnegowda, G., A. M. Hajjar, J. Zhu, E. J. Douglass, S. Uematsu, S. Akira, A. S. Woods, and D. C. Gowda. Induction of proinflammatory responses in macrophages by the glycosylphosphatidylinositols (GPIs) of Plasmodium falciparum: Cell signaling receptors, GPI structural requirement, and regulation of GPI activity. J. Biol. Chem., in press.
    29. 29
  29. Kurtti, T. J., and O. G. Munderloh. 1989. Advances in the definition of culture media for mosquito cells, vol. 1. CRC Press, Inc, Boca Raton, FL.
    30. 30
  30. Levashina, E. A., L. F. Moita, S. Blandin, G. Vriend, M. Lagueux, and F. C. Kafatos. 2001. Conserved role of a complement-like protein in phagocytosis revealed by double-stranded RNA knockout in cultured cells of the mosquito, Anopheles gambiae. Cell. 104:709-718.[CrossRef][Medline]
    31. 31
  31. Luckhart, S., A. L. Crampton, R. Zamora, M. J. Lieber, P. C. Dos Santos, T. M. Peterson, N. Emmith, J. Lim, D. A. Wink, and Y. Vodovotz. 2003. Mammalian transforming growth factor beta1 activated after ingestion by Anopheles stephensi modulates mosquito immunity. Infect. Immun. 71:3000-3009.[Abstract/Free Full Text]
    32. 32
  32. Luckhart, S., and K. Li. 2001. Transcriptional complexity of the Anopheles stephensi nitric oxide synthase gene. Insect Biochem. Mol. Biol. 31:249-256.[CrossRef][Medline]
    33. 33
  33. Luckhart, S., and R. Rosenberg. 1999. Gene structure and polymorphism of an invertebrate nitric oxide synthase gene. Gene 232:25-34.[CrossRef][Medline]
    34. 34
  34. Luckhart, S., Y. Vodovotz, L. Cui, and R. Rosenberg. 1998. The mosquito Anopheles stephensi limits malaria parasite development with inducible synthesis of nitric oxide. Proc. Natl. Acad. Sci. USA 95:5700-5705.[Abstract/Free Full Text]
    35. 35
  35. Markell, E. K., D. T. John, W. A. Krotoski. 1999. Medical Parasitology, 8th ed. W.B. Saunders Company, Philadelphia, PA.
    36. 36
  36. Mellouk, S., S. L. Hoffman, Z. Z. Liu, P. de la Vega, T. R. Billiar, and A. K. Nussler. 1994. Nitric oxide-mediated antiplasmodial activity in human and murine hepatocytes induced by gamma interferon and the parasite itself: enhancement by exogenous tetrahydrobiopterin. Infect. Immun. 62:4043-4046.[Abstract/Free Full Text]
    37. 37
  37. Moran, P., and I. W. Caras. 1994. Requirements for glycosylphosphatidylinositol attachment are similar but not identical in mammalian cells and parasitic protozoa. J. Cell Biol. 125:333-343.[Abstract/Free Full Text]
    38. 38
  38. Mordmuller, B., F. Turrini, H. Long, P. G. Kremsner, and P. Arese. 1998. Neutrophils and monocytes from subjects with the Mediterranean G6PD variant: effect of Plasmodium falciparum hemozoin on G6PD activity, oxidative burst and cytokine production. Eur. Cytokine Netw. 9:239-245.[Medline]
    39. 39
  39. Muller, G., N. Hanekop, W. Kramer, W. Bandlow, and W. Frick. 2002. Interaction of phosphoinositolglycan(-peptides) with plasma membrane lipid rafts of rat adipocytes. Arch. Biochem. Biophys. 408:17-32.[CrossRef][Medline]
    40. 40
  40. Murphy, C. T., S. A. McCarroll, C. I. Bargmann, A. Fraser, R. S. Kamath, J. Ahringer, H. Li, and C. Kenyon. 2003. Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature 424:277-283.[CrossRef][Medline]
    41. 41
  41. Naik, R. S., E. A. Davidson, and D. C. Gowda. 2000. Developmental stage-specific biosynthesis of glycosylphosphatidylinositol anchors in intraerythrocytic Plasmodium falciparum and its inhibition in a novel manner by mannosamine. J. Biol. Chem. 275:24506-24511.[Abstract/Free Full Text]
    42. 42
  42. Naotunne, T. S., N. D. Karunaweera, K. N. Mendis, and R. Carter. 1993. Cytokine-mediated inactivation of malarial gametocytes is dependent on the presence of white blood cells and involves reactive nitrogen intermediates. Immunology 78:555-562.[Medline]
    43. 43
  43. Remy, I., A. Montmarquette, and S. W. Michnick. 2004. PKB/Akt modulates TGF-beta signalling through a direct interaction with Smad3. Nat. Cell Biol. 6:358-365.[CrossRef][Medline]
    44. 44
  44. Richman, A. M., G. Dimopoulos, D. Seeley, and F. C. Kafatos. 1997. Plasmodium activates the innate immune response of Anopheles gambiae mosquitoes. EMBO J. 16:6114-6119.[CrossRef][Medline]
    45. 45
  45. Riehle, M. A., and M. R. Brown. 2002. Insulin receptor expression during development and a reproductive cycle in the ovary of the mosquito Aedes aegypti. Cell Tissue Res. 308:409-420.[CrossRef][Medline]
    46. 46
  46. Riehle, M. A., and M. R. Brown. 1999. Insulin stimulates ecdysteroid production through a conserved signaling cascade in the mosquito Aedes aegypti. Insect Biochem. Mol. Biol. 29:855-860.[CrossRef][Medline]
    47. 47
  47. Riehle, M. A., S. F. Garczynski, J. W. Crim, C. A. Hill, and M. R. Brown. 2002. Neuropeptides and peptide hormones in Anopheles gambiae. Science. 298:172-175.[Abstract/Free Full Text]
    48. 48
  48. Rintelen, F., H. Stocker, G. Thomas, and E. Hafen. 2001. PDK1 regulates growth through Akt and S6K in Drosophila. Proc. Natl. Acad. Sci. USA 98:15020-15025.[Abstract/Free Full Text]
    49. 49
  49. Ropert, C., and R. T. Gazzinelli. 2000. Signaling of immune system cells by glycosylphosphatidylinositol (GPI) anchor and related structures derived from parasitic protozoa. Curr. Opin. Microbiol. 3:395-403.[CrossRef][Medline]
    50. 50
  50. Saperstein, R., P. P. Vicario, H. V. Strout, E. Brady, E. E. Slater, W. J. Greenlee, D. L. Ondeyka, A. A. Patchett, and D. G. Hangauer. 1989. Design of a selective insulin receptor tyrosine kinase inhibitor and its effect on glucose uptake and metabolism in intact cells. Biochemistry 28:5694-5701.[CrossRef][Medline]
    51. 51
  51. Schmidt, A., R. T. Schwarz, and P. Gerold. 1998. Plasmodium falciparum: asexual erythrocytic stages synthesize two structurally distinct free and protein-bound glycosylphosphatidylinositols in a maturation-dependent manner. Exp. Parasitol. 88:95-102.[CrossRef][Medline]
    52. 52
  52. Schofield, L., and F. Hackett. 1993. Signal transduction in host cells by a glycosylphosphatidylinositol toxin of malaria parasites. J. Exp. Med. 177:145-153.[Abstract/Free Full Text]
    53. 53
  53. Schofield, L., S. Novakovic, P. Gerold, R. T. Schwarz, M. J. McConville, and S. D. Tachado. 1996. Glycosylphosphatidylinositol toxin of Plasmodium up-regulates intercellular adhesion molecule-1, vascular cell adhesion molecule-1, and E-selectin expression in vascular endothelial cells and increases leukocyte and parasite cytoadherence via tyrosine kinase-dependent signal transduction. J. Immunol. 156:1886-1896.[Abstract]
    54. 54
  54. Schofield, L., L. Vivas, F. Hackett, P. Gerold, R. T. Schwarz, and S. Tachado. 1993. Neutralizing monoclonal antibodies to glycosylphosphatidylinositol, the dominant TNF-alpha-inducing toxin of Plasmodium falciparum: prospects for the immunotherapy of severe malaria. Ann. Trop. Med. Parasitol. 87:617-626.[Medline]
    55. 55
  55. Sherry, B. A., G. Alava, K. J. Tracey, J. Martiney, A. Cerami, and A. F. Slater. 1995. Malaria-specific metabolite hemozoin mediates the release of several potent endogenous pyrogens (TNF, MIP-1 alpha, and MIP-1 beta) in vitro, and altered thermoregulation in vivo. J. Inflamm. 45:85-96.[Medline]
    56. 56
  56. Straif, S. C., C. N. Mbogo, A. M. Toure, E. D. Walker, M. Kaufman, Y. T. Toure, and J. C. Beier. 1998. Midgut bacteria in Anopheles gambiae and An. funestus (Diptera: Culicidae) from Kenya and Mali. J. Med. Entomol. 35:222-226.[Medline]
    57. 57
  57. Tachado, S. D., P. Gerold, M. J. McConville, T. Baldwin, D. Quilici, R. T. Schwarz, and L. Schofield. 1996. Glycosylphosphatidylinositol toxin of Plasmodium induces nitric oxide synthase expression in macrophages and vascular endothelial cells by a protein tyrosine kinase-dependent and protein kinase C-dependent signaling pathway. J. Immunol. 156:1897-1907.[Abstract]
    58. 58
  58. Tachado, S. D., P. Gerold, M. J. McConville, T. Baldwin, D. Quilici, R. T. Schwarz, and L. Schofield. 1996. Glycosylphosphatidylinositol toxin of Plasmodium induces nitric oxide synthase expression in macrophages and vascular endothelial cells by a protein tyrosine kinase-dependent and protein kinase C-dependent signaling pathway. J. Immunol. 156:1897-1907.
    59. 59
  59. Tachado, S. D., P. Gerold, R. Schwarz, S. Novakovic, M. McConville, and L. Schofield. 1997. Signal transduction in macrophages by glycosylphosphatidylinositols of Plasmodium, Trypanosoma, and Leishmania: activation of protein tyrosine kinases and protein kinase C by inositolglycan and diacylglycerol moieties. Proc. Natl. Acad. Sci. USA. 94:4022-4027.[Abstract/Free Full Text]
    60. 60
  60. Yao, Z., Y. Dolginov, T. Hanoch, Y. Yung, G. Ridner, Z. Lando, D. Zharhary, and R. Seger. 2000. Detection of partially phosphorylated forms of ERK by monoclonal antibodies reveals spatial regulation of ERK activity by phosphatases. FEBS Lett. 468:37-42.[CrossRef][Medline]
    61. 61
  61. Zhou, B., Z. X. Wang, Y. Zhao, D. L. Brautigan, and Z. Y. Zhang. 2002. The specificity of extracellular signal-regulated kinase 2 dephosphorylation by protein phosphatases. J. Biol. Chem. 277:31818-31825.[Abstract/Free Full Text]
    62. 62
  62. Zhou, B., and Z. Y. Zhang. 2002. The activity of the extracellular signal-regulated kinase 2 is regulated by differential phosphorylation in the activation loop. J. Biol. Chem. 277:13889-13899.[Abstract/Free Full Text]
    63. 63
  63. Zhu, J., G. Krishnegowda, and D. C. Gowda. Induction of proinflammatory responses in macrophages by the glycosylphosphatidylinositols (GPIs) of Plasmodium falciparum: The requirement of ERK, p38, JNK and NF-kappa B pathways for the expression of proinflammatory cytokines and nitric oxide. J. Biol. Chem., in press.

Infection and Immunity, May 2005, p. 2778-2789, Vol. 73, No. 5
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.5.2778-2789.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Kang, M.-A., Mott, T. M., Tapley, E. C., Lewis, E. E., Luckhart, S. (2008). Insulin regulates aging and oxidative stress in Anopheles stephensi. J. Exp. Biol. 211: 741-748 [Abstract] [Full Text]  
  • Winter, F., Edaye, S., Huttenhofer, A., Brunel, C. (2007). Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion. Nucleic Acids Res 35: 6953-6962 [Abstract] [Full Text]  
  • Akman-Anderson, L., Olivier, M., Luckhart, S. (2007). Induction of Nitric Oxide Synthase and Activation of Signaling Proteins in Anopheles Mosquitoes by the Malaria Pigment, Hemozoin. Infect. Immun. 75: 4012-4019 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lim, J.
Right arrow Articles by Luckhart, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lim, J.
Right arrow Articles by Luckhart, S.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»