Previous Article | Next Article ![]()
Infection and Immunity, June 2005, p. 3330-3341, Vol. 73, No. 6
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.6.3330-3341.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Division of Molecular Infection Biology,1 Division of Cell Biology, Research Center Borstel, Leibniz Center for Medicine and Biosciences, Parkallee 22, D-23845 Borstel, Germany,4 Mucosal Immunity, German Research Center for Biotechnology (GBF), Mascheroder Weg 1, D-38124 Braunschweig, Germany,2 Max-von-Pettenkofer-Institut, Pettenkoferstrasse 9a, D-80336 München, Germany3
Received 8 July 2004/ Returned for modification 7 October 2004/ Accepted 9 December 2004
|
|
|---|
|
|
|---|
Of particular interest when host-pathogen relationships at the species level are compared, M. avium strains having different origins or morphotypes have been shown to differ widely in terms of replication and persistence, both in vitro and in vivo in a mouse model of infection (5, 9, 15, 29, 43, 48, 52), although the molecular basis for this variability in virulence remains undetermined. Previous studies demonstrated an inverse correlation between the virulence of some M. avium isolates and their ability to induce tumor necrosis factor alpha (TNF-
) in murine macrophages, suggesting that virulent strains elicit only very limited activation of macrophage effector mechanisms, thereby escaping elimination (24, 49). Using primary human monocyte-derived macrophages, we recently demonstrated that intracellular growth control of some M. avium strains was critically dependent on the extent of mitogen-activated protein (MAP) kinase phosphorylation, one essential signaling pathway of macrophage activation (9). However, our studies also demonstrated that there is no direct and simple correlation between MAP kinase phosphorylation, TNF-
secretion, and the capacity of different M. avium strains to replicate inside macrophages.
The mechanisms underlying virulence and persistence may therefore be more complex and may involve the coregulation of specific signaling and transcriptional machinery in response to each individual M. avium isolate. In the current study we performed a systematic, comparative analysis addressing the transcriptional response of macrophages after infection with M. avium strains with different origins and virulence characteristics. We carefully selected four strains which reflect a wide repertoire of M. avium infectivity and persistence.
M. avium 2151 was initially isolated from an AIDS patient in the United States and was classified as a serovar 2 strain (7). Its stably subcultivated morphotypes (smooth opaque [SmO] and smooth transparent [SmT]) have become an intensively studied and well-established model for colony morphotypes in M. avium (5, 15, 20, 41). 2151SmO is known to strongly activate macrophages of mouse and human origin and fails to multiply intracellularly. SmT only weakly activates human and mouse macrophages and shows progressive intracellular growth (9, 54). A second isolate from a European AIDS patient (SE01) was included in the study because it represents a different, yet common serovar (serovar 4), is virulent in mice, and has been shown to readily replicate within human macrophages in the face of massive host cell activation (9). The fourth strain, TMC724 (= ATCC 25291), has been used by various laboratories to study macrophage activation and granuloma formation in the mouse model, in which it is the most virulent strain known to date (5, 21, 29). In contrast to the clinical isolates of M. avium, TMC724 was originally cultured from fowl. Since nothing is known about the virulence of avian isolates in human macrophages, analysis of the gene expression pattern induced by this strain afforded a unique opportunity to compare evolutionarily distant prototypes of M. avium.
When they encounter microbes and microbial structures, macrophages undergo complex functional reprogramming, as recently shown by comprehensive gene expression analyses (10, 14, 22, 42). Our study corroborates that there is an overlapping pattern of regulated genes in human macrophages representing a general inflammatory response to all isolates of M. avium. The quantity of differentially expressed genes and the magnitude of gene regulation are directly correlated with the overall macrophage-activating capacity of the individual M. avium strain used for infection, as determined by MAP kinase phosphorylation and TNF-
production. Additionally, some M. avium strains preferentially induce regulation of a private set of genes that may strain specifically perturb the macrophage response to infection or that may counteract antimycobacterial effector mechanisms. Importantly, however, one strain (TMC724) could not be classified by gene response signatures, most likely due to a lack of overall host cell activation.
|
|
|---|
Isolation and cultivation of human monocyte-derived macrophages. Mononuclear cells were isolated from the peripheral blood of healthy volunteers by density gradient centrifugation (11). Lymphocytes and monocytes were separated by counterflow elutriation as previously described (27). Highly purified (consistently >95%) monocytes were cultivated for 7 days in Teflon culture bags (CellGenix, Freiburg, Germany) in RPMI 1640 (Biochrom, Berlin, Germany) in the presence of 2% (vol/vol) heat-inactivated human AB serum, 2 ng/ml human macrophage colony-stimulating factor (R&D Systems, Wiesbaden, Germany), 2 mmol/liter L-glutamine (Biochrom), 100 U/ml penicillin G (Biochrom), and 100 µg/ml streptomycin (Biochrom). The viability of cells was always >95%, as determined by trypan blue staining. Macrophages were phenotyped by determining the cell surface marker expression profile (CD14, macrophage mannose receptor, carboxypeptidase M, HLA-DR) as described previously (46). Macrophages were cultivated in RPMI 1640 containing 10% (vol/vol) heat-inactivated fetal calf serum (Biochrom) and 2 mmol/liter L-glutamine. Cultures were incubated at 37°C in a humidified atmosphere containing 5% CO2.
Infection of human macrophages with M. avium: in vitro infection and MAP kinase phosphorylation. A total of 0.4 x 106 human monocyte-derived macrophages (MDM) (at a concentration of 0.8 x 106 cells per ml) were inoculated with 1.2 x 106 CFU of M. avium per well. A lower initial infection rate than the infection rates used in all other experimental procedures was chosen to prevent macrophage death during the 7-day culture, especially with highly replicative M. avium isolates. After 4 h cells were washed vigorously with warm Hanks balanced salt solution to remove extracellular bacteria. To determine bacterial uptake, macrophages were lysed by addition of 0.1% saponin. Lysates were serially diluted in sterile, distilled water containing 0.05% Tween 80 and plated on 7H10 agar containing 0.075% pyruvate. For investigation of bacterial growth, parallel cultures were maintained for 3 and 7 days in 500 µl medium (after 3 days 500 µl fresh medium was added to 7-day cultures). Subsequently, cells were washed, lysed, diluted, and plated for CFU determination as described above. For analysis of MAP kinase phosphorylation, macrophages were incubated with M. avium (4.0 x 106 CFU per well) for 30 min as described above. Cell lysates were analyzed as described previously (46).
RNA isolation, reverse transcription PCR (RT-PCR), and ELISA.
For microarray analyses 4.5 x 106 human macrophages were cultivated in tissue culture plates (Nunc, Roskilde, Denmark) and infected with M. avium at a ratio of 10 mycobacteria per macrophage for 4 h. Culture supernatants of stimulated macrophages were harvested and stored at 20°C until analysis. A sandwich enzyme-linked immunosorbent assay (ELISA) was used for detecting TNF-
(H. Gallati, Intex, Muttenz, Switzerland) (25). Assays were performed as recommended by the manufacturer.
Macrophages were lysed by addition of TriFast FL (PeqLab, Erlangen, Germany). Total RNA was isolated by phase separation with 1-bromo-3-chloropropane (Sigma).
For validation of gene expression, equal amounts of RNA were reverse transcribed (Superscript II RNase H reverse transcriptase; Invitrogen, Karlsruhe, Germany) and used for quantitative RT-PCR (LightCycler technology; Roche) using the following gene-specific primer pairs: for beta-2-microglobulin, forward primer 5' GCTGTGCTCGCGCTACTCTC 3' and reverse primer (5' GCGGCATCTTCAAACCTCCAT 3'); for TNF-
, forward primer 5' GGCTCCAGGCGGTGCTTGTTC 3' and reverse primer 5' AGACGGCGATGCGGCTGATG 3'; for interleukin-12p40 (IL-12p40), forward primer 5' TCAGAGGGGACAACAAGGAGTATG 3' and reverse primer 5' CTGGGCCCGCACGCTAAT 3'; for lymphocyte antigen 64 (LY64) (CD180), forward primer 5' AGCTGCTTCTTTTGGGTGGTG 3' and reverse primer 5' TTGGGGAACTTAATGGAGGAAATA 3'; and for myosin X, forward primer 5' CACGCTGCCATCCCACCTCTC 3' and reverse primer 5' CCGCGCTGACACCCAACCA 3'. For RT-PCR of RANTES and pentraxin 3 (PTX3) the primer pairs described previously were used (36, 44). Gene expression was expressed as the relative expression normalized to beta-2-microglobulin expression. The specificity of amplified products was confirmed by sequence analyses.
DNA microarray hybridization and analysis. The quality and integrity of total RNA isolated from human macrophages were controlled by analyzing all samples with an Agilent Technologies 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany). Equal amounts of total RNA of five individual donors were pooled to perform biotin-labeled target synthesis for array hybridization. The entire experimental approach was repeated with a second donor pool that was comparable in terms of the distribution of the ages, genders, and purified protein derivative reactivities of the individuals.
For biotin-labeled target synthesis starting from total RNA, reactions were performed using standard protocols supplied by the manufacturer (Affymetrix, Santa Clara, CA). Briefly, 8 µg total RNA (equal amounts from five different donors per hybridization) were converted to double-stranded DNA using 100 pmol of a T7T23V primer (Eurogentec, Seraing, Belgium) containing a T7 promoter. The double-stranded DNA was then used directly in an in vitro transcription reaction in the presence of biotinylated nucleotides using a T7 RNA polymerase (BioArray high-yield RNA transcript labeling kit; ENZO, New York, NY). The concentration of biotin-labeled cRNA was determined by UV absorbance. In all cases, 12.5 µg of each biotinylated cRNA preparation was fragmented and placed in a hybridization cocktail containing four biotinylated hybridization controls (BioB, BioC, BioD, and Cre) as recommended by the manufacturer. Samples were hybridized to an identical lot of Affymetrix U95Av2 human genome GeneChips for 16 h. Each U95Av2 GeneChip contains oligonucleotides for 12,558 human genes and expressed sequence tags derived from common UniGene clusters. After hybridization the GeneChips were washed, stained with streptavidin-phycoerythrin, and read using an Affymetrix GeneChip fluidic station and scanner.
Fluorescence intensities were normalized to median array intensities for all conditions tested, and the fold changes were calculated relative to unstimulated baseline controls. Analysis of data was done with gene expression software (GeneChip, MicroDB, and Data Mining Tool; all obtained from Affymetrix) with a filter for regulated genes that employed the following stringent criteria to define genes as significantly differentially expressed: (i) a signal log2 ratio of >1 or <1, signifying changes in the expression level between control conditions (baseline) and stimulated cells; and (ii) a change in the P value of <0.001 or >0.999, describing the likelihood and direction of change of expression for each transcript. P values indicated the level of significance of the difference between the baseline and experimental conditions based on the Wilcoxon signed-rank test. Genes defined as differentially expressed were significantly regulated in both donor pools, each of which consisted of five individual donors. Unless indicated otherwise specifically below, genes represented by more than one transcript on the Affymetrix U95Av2 GeneChip were considered a single gene for the discussion of absolute numbers of differentially expressed individual genes.
Statistical analysis.
For comparison of RT-PCR results, the global hypothesis was tested according to Friedman. For posttesting, data obtained from independent experiments were compared using the Wilcoxon rank test. The
-error was corrected by the Shaffer procedure.
|
|
|---|
![]() View larger version (19K): [in a new window] |
FIG. 1. Uptake and intracellular replication of four M. avium strains in human macrophages. Human MDM were infected with the smooth transparent (SmT) and smooth opaque (SmO) morphotypes of M. avium strain 2151, strain TMC724, and strain SE01 at an MOI of 3. CFU counts in lysed macrophages were determined 4 h and 3 and 7 days after infection. The values are means ± standard deviations for duplicates of one representative experiment of the experiments performed.
|
release and MAP kinase activation of macrophages infected with different strains of M. avium.
The virulence of M. avium strains has previously been correlated to their capacity to induce cytokine release from infected macrophages (5, 24). We compared the TNF-
production of human monocyte-derived macrophages after infection (10 bacteria per macrophage) with four selected M. avium strains (Fig. 2A). TMC724 and 2151SmT induced only small amounts of TNF-
, and consistently higher TNF-
levels were induced by 2151SmT than by TMC724 when an identical multiplicity of infection (MOI) was used for stimulation. In contrast, 2151SmO and SE01 induced the release of large amounts of TNF-
, and SE01 reproducibly triggered the highest levels of TNF-
.
![]() View larger version (43K): [in a new window] |
FIG. 2. TNF- release and p38 MAP kinase activation in cultures of human macrophages infected with different M. avium strains. (A) Human MDM were infected with M. avium strains TMC724, 2151SmT, 2151SmO, and SE01 at an MOI of 10. Supernatants were harvested after 4 h. Cytokine concentrations were measured by ELISA. The values are means ± standard deviations for three independent experiments. ctrl., control. (B) Human MDM were incubated with M. avium strains TMC724, 2151SmT, 2151SmO, and SE01 at an MOI of 10 for 30 min. Cells were lysed, and aliquots of cell lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotted onto nitrocellulose membranes. The membranes were incubated with specific anti-phospho-p38 antibodies, followed by a peroxidase-coupled secondary antibody. Visualization was performed by enhanced chemiluminescence. To control equal protein loading, the amounts of total p38 were detected in the same lysates. The results of one representative experiment of three independent experiments are shown.
|
in response to different M. avium strains might be determined by the differential intensity of pretranscriptional signaling events. We therefore analyzed MAP kinase activation in human macrophages induced by the four M. avium strains after 30 min of stimulation. TMC724 and 2151SmT induced only weak phosphorylation of p38 and ERK1/2 in human macrophages (Fig. 2B and data not shown). However, the signal obtained for 2151SmT was usually stronger than that obtained for TMC724 when a similar MOI (10 bacteria per macrophage) was used for stimulation. In contrast, 2151SmO and SE01 induced marked MAP kinase phosphorylation, and the signal induced by SE01 was consistently stronger than that induced by 2151SmO (Fig. 2B).
These data indicate that the virulence, as measured by the capacity to replicate within macrophages (Fig. 1), of individual M. avium strains is not consistently associated with the absence of strong macrophage activation. Conversely, the lowest levels of TNF-
induction or MAP kinase phosphorylation need not necessarily correlate with a pronounced capacity of a given strain to multiply. Overall, the quantity of macrophage responses, such as the level of TNF-
secretion, after stimulation with individual M. avium isolates is governed by the magnitude of signal events, such as MAP kinase activation, occurring very early after infection.
Gene expression profiles of human macrophages induced by different strains of M. avium. In order to investigate whether the macrophage response after infection with individual mycobacterial isolates might also differ qualitatively (i.e., in terms of the kind of transcriptional response), we applied a systematic approach using microarray analyses. Macrophages of different donors were infected with each of the four M. avium strains at a ratio of 10 bacteria per macrophage. Total RNA was isolated 4 h postinfection. We and other workers have previously noted the donor-dependent variability of macrophage responses to M. avium (9, 28). To minimize donor-dependent confounding effects, equal amounts of total RNA obtained from cells of five individual donors were pooled to perform biotin-labeled target synthesis for array hybridization. The entire experimental approach was repeated with a second donor pool comparable in terms of the distribution of the ages, genders, and purified protein derivative reactivities of the individuals. Only genes that were differentially expressed compared to unstimulated control macrophages with a change in the expression level of at least twofold (induced or repressed) in both donor pools were considered for further in-depth analysis and are included in the tables if the statistical criteria described in Materials and Methods were met.
TMC724 induced differential expression of 57 genes (51 genes induced, 6 genes repressed) compared to uninfected macrophages (Fig. 3). 2151SmT induced regulation of 113 macrophage genes (95 genes induced, 18 genes repressed), whereas 175 genes (123 genes induced, 52 genes repressed) were regulated in response to 2151SmO. SE01 induced differential expression of 224 genes (145 genes induced, 79 genes repressed) (Fig. 3). Thus, the numbers of differentially expressed genes in response to these different M. avium isolates reflect the individual capacity of each strain to activate macrophages, as measured by MAP kinase phosphorylation or TNF-
release (Fig. 2 and 3).
![]() View larger version (33K): [in a new window] |
FIG. 3. Numbers of differentially expressed genes in human macrophages after infection with four M. avium strains. Human macrophages were infected with M. avium strains TMC724, 2151SmT, 2151SmO, and SE01 (MOI, 10) for 4 h. Differential gene expression was compared to expression in uninfected control cells using microarray technology. An array analysis was performed with two independent donor pools, each comprising five individuals. The total number of differentially expressed genes (induction or suppression) found in both donor pools is indicated.
|
, lymphotoxin
), chemokines (RANTES, IL-8, monocyte chemoattractant protein 1, macrophage inflammatory protein 1
[MIP-1
], MIP-1ß, MIP-2
, MIP-2ß, MIP-3
, etc.), cytokine and chemokine receptors (IL-7 receptor, CCR2, CXCR4), and adhesion molecules (ICAM-1) (Table 1). The changes in the expression levels of genes in these functional categories were more pronounced than the changes in the expression levels of genes having a different functional background. Additionally, a number of genes whose products are involved in signaling cascades, transcriptional events, the cell cycle, and antiapoptosis, as well as genes encoding metabolic enzymes, were differentially expressed in response to infection with all M. avium strains (Table 1). In general, for the majority of genes, the magnitude of regulation in response to the individual M. avium strains could be directly correlated with the TNF-
-inducing capacity of each isolate (Fig. 2). |
View this table: [in a new window] |
TABLE 1. Shared pattern of differentially expressed macrophage genes in response to M. avium strains TMC724, 2151SmT, 2151SmO, and SE01
|
(Fig. 4A), the chemokine RANTES (Fig. 4B), and the ancestral pattern recognition receptor PTX3 (Fig. 4C) induced by each strain indeed were the same order of magnitude as the expression levels observed in the microarray analyses (Fig. 4 and Table 1).
![]() View larger version (22K): [in a new window] |
FIG. 4. Expression of TNF- , RANTES, and PTX3 mRNA in human monocyte-derived macrophages after infection with M. avium. Human MDM were incubated with M. avium isolates TMC724, 2151SmT, 2151SmO, and SE01 (MOI, 10) for 4 h. Total RNA was isolated, reverse transcribed, and used for quantitative RT-PCR of TNF- (A), RANTES (B), and PTX3 (C) mRNA normalized to beta-2-microglobulin mRNA levels. The values indicate the fold induction compared to untreated cells for duplicate determinations for five different donors. The boxes indicate the 25th and 75th percentiles. The whiskers above and below the boxes indicate the highest and lowest values. The medians are marked and indicated above the boxes. ctrl., control.
|
secretion, quantity of genes regulated) pointed to a macrophage-activating capacity that was intrinsic to each M. avium strain but partially disparate from its virulence properties. We therefore sought to determine whether there are any transcriptional signatures that allow categorization of isolates according to their intracellular replicating characteristics. The two morphotypes of M. avium strain 2151 have a common genotype, yet they differ profoundly in intracellular growth. Therefore, they provided an excellent starting point to study the macrophage responses to virulent and nonvirulent M. avium isolates in a comparison of the host cell gene expression profiles induced by them. In addition to the general macrophage response signature for infection with M. avium as described above, direct comparison indeed identified genes that were individually regulated following infection with these two morphotypes (Table 2). The individual responses to 2151SmT and 2151SmO covered 9% (10 genes; 5 genes induced and 5 genes repressed) and 39% (68 genes; 31 genes induced and 37 genes repressed), respectively, of all genes differentially expressed after infection with the individual morphotypes (Table 2).
|
View this table: [in a new window] |
TABLE 2. Individual patterns of differentially expressed macrophage genes in response to two morphotypes of M. avium strain 2151
|
IL-12 is well known to be a critical factor in controlling mycobacterial infections (reviewed in references 13, 19, and 53). In contrast, there have been no reports on the role of either LY64 or myosin X for modulating mycobacterial growth. To independently confirm the differential expression of the genes encoding these three molecules, human macrophages of five individuals were infected with M. avium 2151SmT or 2151SmO for 4 h, and total RNA was isolated and used for quantitative RT-PCR.
2151SmO significantly induced expression of IL-12p40 mRNA in macrophages of all five donors compared to unstimulated control cultures (Fig. 5A). The closely related SmT morphotype of strain 2151 also induced IL-12p40 mRNA expression in four of five donors (Fig. 5A), albeit to a significantly lower extent. Stimulation of human macrophages with 2151SmO as well as 2151SmT significantly reduced LY64 mRNA expression in all individuals (Fig. 5B), and the inhibition was more pronounced in response to SmO than in response to SmT (Fig. 5B). Expression of myosin X mRNA was significantly enhanced in response to 2151SmT and, in contrast to the microarray results, also after stimulation with 2151SmO (Fig. 5C). Furthermore, 2151SmO consistently induced myosin X mRNA expression to a significantly higher extent than 2151SmT.
![]() View larger version (17K): [in a new window] |
FIG. 5. Expression of IL-12p40, LY64, and myosin X mRNA in human monocyte-derived macrophages after infection with M. avium. Human MDM were incubated with M. avium isolates 2151SmT and 2151SmO (MOI, 10) for 4 h. Total RNA was isolated, reverse transcribed, and used for quantitative RT-PCR of IL-12p40 (A), LY64 (B), and myosin X (C) mRNA normalized to beta-2-microglobulin mRNA levels. The values are the means for duplicate determinations for five different donors. The boxes indicate the 25th and 75th percentiles. The whiskers above and below the boxes indicate the highest and lowest values. The medians are marked. Significant differences are indicated; an asterisk indicates that the P value is <0.05. n.s., not significant; ctrl, control; b2m, beta-2-microglobulin.
|
Finally, we scrutinized the macrophage gene expression profiles induced by TMC724 and SE01, two genetically completely unrelated M. avium strains with highly discrepant intracellular growth properties. The private macrophage expression signature evoked by TMC724 (compared to all other isolates) contained only two genes, the proto-oncogene c-Myc (twofold induction) and the vaccinia-related kinase 2 gene (twofold repression), once more reflecting the overall weak potential of this M. avium strain to activate macrophages. In contrast, the individual signature of differentially expressed macrophage genes in response to SE01 consisted of 87 genes (38 genes induced, 49 genes suppressed) (Table 3), the highest number of privately regulated genes in this series.
|
View this table: [in a new window] |
TABLE 3. Individual pattern of differentially expressed macrophage genes in response to M. avium strain SE01
|
) signaling (38), was accompanied by repression of IFN-
receptor 1 (twofold). In addition, the anti-inflammatory cytokine IL-10 was significantly induced (sixfold) only by SE01 (Table 3). |
|
|---|
secretion, and size of infection-induced transcriptome) showed consistent results with four different isolates, we found no straightforward association of a specific macrophage response signature with the pathogenicities of the infecting strains, as measured by their intracellular replication rates in vitro. Therefore, the virulence of the species M. avium is not mirrored by a stereotypic, species-specific macrophage response, as previously suggested (28). Nor is virulence of M. avium invariably a unique failure to activate macrophages, as hypothesized previously (24, 49). Rather, our data imply that virulence must be explained at the level of the individual isolate of M. avium; while some isolates may modulate host defenses by manipulating specific host defense genes (such as the gene encoding IL-12p40, LY64, SOCS-1, or IL-10, as identified in this study), other isolates may simply rely on their intrinsic resistance to antimycobacterial effector mechanisms. Our data corroborate previous findings from microarray analyses performed with macrophages infected with mycobacteria or stimulated with mycobacterial components (10, 14, 42). In particular, they support the concept that following interaction with mycobacteria, a prewired infection-related gene expression program is induced in macrophages, consisting of signaling components, transcriptional machinery, and mediators and receptors necessary to enhance myelomonocytic cell recruitment and activation. This program differs from that elicited by protozoan or helminth parasites in that, for example, many more interferon-inducible genes are triggered (14).
A previous study detailing the expression signature of macrophages in response to M. avium described the upregulation of approximately 150 genes involved in signal transduction, transcription, adhesion, apoptosis, protein turnover, homeostasis, detoxification, and general metabolism or coding for receptor-associated proteins, cytokines, and chemokines (28). While many of the genes described in that report are also listed in our M. avium-induced common signature (28) (Table 1), there are individual differences in both the number and the type of genes that were found to be regulated. These differences are most likely due to donor variability and different times of analysis, but they probably also reflect the use of yet another M. avium strain in that study (only described as a smooth transparent isolate). The fact that IL-12p40 and IL-10 were not appreciably induced but that a number of ras-associated signaling molecules were expressly regulated by that strain put it in a category not dissimilar to that shown here for 2151SmT (28).
The results of this study and a recent study (9) provide evidence that within minutes following exposure, the macrophage responses to M. avium strains already differ at the level of signal transduction. Virulent or persistent strains, such as M. avium 2151SmT or TMC724, induce much less phosphorylation of MAP kinases than avirulent isolates, such as 2151SmO, induce. Virulence may therefore be an intrinsic inability of certain isolates to activate macrophages (e.g., due to a lack of stimulating cell wall-associated structures). TMC724 and both morphotypes of strain 2151 contain the ser2 gene cluster, which is involved in glycosylation of glycopeptidolipids of the cell wall. Genetic characterization of this region revealed strain-specific variations in this region, indicating structural differences in the individual cell wall composition (7, 20). The quantity of receptor-ligating structures in individual strains of M. avium has, however, not been accurately determined thus far.
Alternatively, virulence may be the consequence of active suppression of early signaling events within the host cell (e.g., by activating phosphatases) (37). In this respect, it is noteworthy that the virulent SE01 strain significantly induced two dual-specificity phosphatases (phosphatases 1 and 8).
Highly stringent statistical evaluation of the microarray data initially showed strain-specific transcriptional activation of several macrophage genes, e.g., the genes encoding IL-12p40, LY64, and myosin X. Independent confirmation of the expression levels of these genes by quantitative RT-PCR revealed that rather than representing "exclusively" regulated genes, the genes were regulated in a more pronounced fashion by infection with 2151SmO than by infection with 2151SmT. Further analysis of this discrepancy showed that in the microarray-based screening these genes did in fact also show regulation following infection with other strains but that the magnitude was not sufficient to meet our statistical criteria.
The control of mycobacterial infections is known to depend on IL-12, which is essential for inducing an appropriate IFN-
response (2, 17, 39). Impaired and/or delayed expression of IL-12 may therefore be interpreted as a corollary of virulence in individual M. avium strains (such as 2151SmT or TMC724). Conversely, the high induction of IL-12 formation by the avirulent 2151SmO strain may be termed suicidal. However, it should be mentioned that the biology of the heterodimeric IL-12 family of cytokines is more complex and that excess IL-12p40 dimers can also antagonize IL-12p70 functions at the IL-12 receptor (12, 30).
The individual response to M. avium 2151SmO indicated profound downregulation of LY64 (CD180, RP105), a member of the Toll-like receptor (TLR) family, which mediates the LPS response in B lymphocytes (reviewed in reference 35). LY64 has previously been found to be differentially expressed in tumor-associated macrophages (26) but has not been linked to mycobacterial infections thus far. Interestingly, LY64 has functional similarities with TLR4. While there is a report that TLR4-defective mice are as susceptible to infection with M. avium as with wild-type controls, the role of TLR4 in the control of mycobacterial infections is controversial (1, 23, 47, 50). Elucidating the role of LY64 in M. avium pathogenesis might shed new light on the contribution of different members of the TLR family in the innate response against mycobacterial infection.
Collectively, our data show that for some strains, such as 2151SmT and 2151SmO, the overall magnitude of host cell activation, as determined by MAP kinase phosphorylation, TNF-
production, and the size of the induced transcriptome, is inversely correlated with the capacity to persist and grow inside macrophages. While there is no specific "virulence-associated" signature of the virulent 2151SmT strain, the strong regulation of some genes, such as the IL-12p40, myosin X, and LY64 genes, by 2151SmO may be a good corollary of this strain's lack of virulence. For TMC724, there is also no "persistence-associated," strain-specific macrophage gene expression signature. In fact, TMC724 induces only very little gene regulation, and therefore activation, in human host cells. This may reflect its avian origin, which endowed it with a heightened imperviousness to constitutively expressed effector molecules in human macrophages.
The macrophage transcriptome induced by M. avium SE01 is particularly enlightening, as it shows that the analysis of a strain-specific signature may help us understand this isolate's behavior inside the macrophage. Obviously, despite very strong activation of the innate immune response, this strain is able to persist in macrophages. Here, SE01 induces upregulation of SOCS-1/SSI-1, a negative feedback regulator of signaling events via janus kinases induced by cytokines (38). SOCS-1-mediated negative regulation of IFN-
-induced signals can be hypothesized as one mechanism by which SE01 promotes its survival inside macrophages. Moreover, infection with SE01 induces the transcriptional downregulation of IFN-
receptor 1, again indicating effective counteraction of IFN-
-mediated eradication (16, 18, 32). In addition, SE01 was the only strain found to induce very high IL-10 gene transcription, which may interfere with antimycobacterial effector mechanisms (45, 55). If the results are taken together, SE01 seems to be capable of tipping the scale of macrophage activation toward a net "anti-inflammatory" score which favors persistence.
In conclusion, microarray analyses of gene expression patterns of human macrophages in response to M. avium strains with different levels of virulence yielded a number of genes associated with a common antimicrobial macrophage response, consistent with previous reports. Overall, quantitative rather than qualitative differences of gene regulation were associated with the capacity of M. avium strains to grow inside macrophages. In particular, our data provide no evidence that the virulence and pathogenicity of M. avium as a species can be unequivocally deduced from the macrophage gene response signatures that individual isolates elicit. Instead, there are at least three distinct explanations for virulence at the level of the individual strain. First, isolates such as 2151SmT or TMC724 elicit only a low or delayed type of host response, which contributes to their escaping antimycobacterial effector mechanisms. Second, isolates such as SE01 induce a strong macrophage response in which the net balance of pro- and anti-inflammatory activities appears to be skewed towards suppressing antimycobacterial protection. Third, isolates such as TMC724 may be largely impervious to antimycobacterial effector molecules in human macrophages irrespective of the host response that they elicit.
We thank Svenja Kröger for expert technical assistance and acknowledge Robert Geffers for helpful discussions.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»