Previous Article | Next Article 
Infection and Immunity, June 2005, p. 3402-3407, Vol. 73, No. 6
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.6.3402-3407.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Host Cytokine Production, Lymphoproliferation, and Antibody Responses during the Course of Ancylostoma ceylanicum Infection in the Golden Syrian Hamster
Susana Mendez,1*
Jesus G. Valenzuela,2
Wenhui Wu,1 and
Peter J. Hotez1
Department of Microbiology and Tropical Medicine, The George Washington University Medical Center and The Sabin Vaccine Institute, 2300 Eye Street NW, Washington, DC 20037,1
Laboratory of Malaria and Vector Research, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, Maryland 208522
Received 21 December 2004/
Accepted 7 February 2005

ABSTRACT
The Syrian Golden hamster (
Mesocricetus auratus) has been used
to model infections with the hookworm
Ancylostoma ceylanicum.
New molecular immunological reagents to measure cellular immune
responses in hamsters were developed and used to determine the
impact of
A. ceylanicum hookworm infection on host cytokine
responses and lymphoproliferation. Initial larval infection
with 100 third-stage
A. ceylanicum larvae resulted in predominant
Th1 responses (upregulation of proinflammatory cytokines) that
lasted for the duration of larval migration and continued up
to 14 days postinfection (prepatency). Subsequently, development
of larvae into egg-laying adult hookworms (patency) coincided
with a switch to Th2 predominant responses (interleukin-4 [IL-4])
as well as a marked increase in IL-10 production. This switch
also concurred with reduced host lymphoproliferative responses
to hookworm antigens. The findings demonstrate a similarity
in immune responses between hamsters and humans infected with
hookworms, suggesting that hamsters will be a useful animal
model species for examining host immunity to human hookworm
infections.

INTRODUCTION
Hookworm infection is one of the most prevalent parasitic diseases
infecting over 700 million people in tropical and subtropical
regions of the world (
16). Clinical symptoms of human hookworm
infection include iron-deficiency anemia (
18) and protein-losing
enteropathy (
14) that may lead to physical, mental and cognitive
growth retardation effects (
25,
42,
43). Although chemotherapy
is effective at eliminating existing adult parasites, reinfection
can occur rapidly after treatment (
1,
38). This observation,
together with the unique epidemiology of hookworm infection,
in which the worm burdens increase with age in endemic regions
(
6), have led to the suggestion that hookworms can either evade
or suppress host immune responses (
28,
35). Therefore, characterization
of the immune response to hookworm in animal models would constitute
a valuable tool to understand the underlying immunological mechanisms
of human hookworm infections.
The Syrian Golden hamster (Mesocricetus auratus) has been developed as a model to study hookworm infection caused by the dog and cat hookworm, Ancylostoma ceylanicum. A. ceylanicum is also a minor cause of human hookworm infection in parts of Asia (11). Unlike mice, which do not permit the development of adult hookworms (12, 41), hamsters are permissive hosts for the hookworm A. ceylanicum (19, 24, 32, 40, 46). In most studies to date, hamsters have been infected with A. ceylanicum third-stage infective larvae (L3) via oral gavage. As the human hookworm A. duodenale is both orally infective as well as infective through the percutaneous route, this approximates a natural route of infection. More importantly, this model reproduces weight and blood loss that result from human infection with A. duodenale.
In addition to modeling the host-parasite relationship for human hookworm infection, the hamsters have been used with some success for investigating protective immunity from a new generation of recombinant anti hookworm vaccines (2, 8, 9, 13, 22, 33). However, detailed immunological investigations have not been conducted in this model due of the lack of available immunological reagents. Cloning of the Syrian Golden hamster cytokine DNAs (31) has made it possible to develop cytokine reagents for this species. In our laboratory, we have developed RT-PCR to detect hamster cytokine mRNA expression. We report here the first immunological profile of cytokines produced in response to ancylostomiasis in the hamster. Additionally, we examined the intensity of the humoral response over the course of the infection to larval and adult extracts and the intensity of local and systemic lymphoproliferative responses. These studies provide a basis to address mechanisms of parasite-associated immune dysregulation in ancylostomiasis as well as for protective immunity associated with recombinant vaccines.

MATERIALS AND METHODS
Hamster infection with A. ceylanicum.
Six- to 8-week-old outbred Syrian Golden hamsters (
Mesocricetus auratus) were obtained from Harlan (Indianapolis, IN) and maintained
in a specific-pathogen-free facility. Animals were handled according
to local and federal regulations; research protocols were approved
by the Institutional Animal Care and Use Committee of The George
Washington University Medical Center.
Hookworm infections and parasite recovery.
Hamsters were infected with 100 A. ceylanicum L3. The larvae were introduced directly into the stomach by use of a gavage tube. To determine parasite burden, quantitative hookworm egg counts (counted using the McMaster technique) were obtained, beginning on day 14 after infection. Groups of three hamsters were sacrificed 7 days after infection (prepatency), 17 days after infection (patency), and 32 days postinfection (late patency). Blood, spleens, and mesenteric lymph nodes were collected, and adult hookworms were recovered and counted from the small and large intestines.
Hookworm antigens.
Larval extract and adult extracts were obtained by homogenizing previously frozen A. ceylanicum larvae and adults recovered in phosphate-buffered saline (PBS) (10). Worms were freeze-thawed three times and then homogenized for 5 min with a hand tissue grinder. The protein content was assayed by using the bicinchoninic acid system (Pierce Chemical Co., Rockford, IL) with a bovine serum albumin standard curve, and the proteins were stored at 80°C until use.
Analysis of antibody responses by enzyme-linked immunosorbent assay (ELISA).
Hamsters were bled by intracardial puncture prior to sacrifice, and their total immunoglobulin G (IgG) antibody responses to larval and adult antigens were measured by enzyme-linked immunosorbent assay (ELISA) as described previously (34) using anti-hamster IgG conjugated with horseradish peroxidase (Rockland Inc., Gilbertsville, PA) as a secondary antibody. ELISA plates were developed with o-phenylenediamine substrate, and the optical density (OD) was determined at 450 nm. Serum antibody titers were determined by measuring the last dilution that resulted in three standard deviations above background (22).
Analysis of antibody responses by Western immunoblotting.
Adult and larval samples (2.5 µg per well) were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 4 to 20% acrylamide, Tris-glycine-buffered minigel (Invitrogen, Carlsbad, CA), and separated proteins were blotted onto 0.45-µm-pore-size nitrocellulose membranes (Bio-Rad, Hercules, CA). The membranes were blocked for 30 min by using blocking buffer (Invitrogen) at room temperature. Membranes were incubated for 1 h 30 min at room temperature with pooled sera diluted 1:500 (to test with L3 extracts) and 1:2,000 (to test with adult extracts) in blocking buffer and washed three times with washing buffer (Invitrogen), followed by a 1.5-h incubation with horseradish peroxidase-conjugated goat anti-hamster (Rockland Inc., Gilbertsville, PA) IgG diluted 1:1,000 in blocking buffer. Membranes were again washed three times, and bound secondary antibody was detected by using ECL Plus Western blotting detection system (Amersham, Piscataway, NJ). The resulting chemiluminescent signal was detected by exposure to BioMax film (Kodak, Rochester, NY).
RNA isolation and RT-PCR.
The in situ cytokine expression in mesenteric lymph nodes was analyzed by reverse transcription-PCR (RT-PCR). mRNA was extracted from the frozen tissue using the Micro Fast Track mRNA isolation kit (Invitrogen). First-stranded RNA was obtained using the SMART cDNA Library construction kit reagents according to the manufacturer's instructions (Clontech, Palo Alto, CA). The primers used were IFN-
forward (5'ACTCAAGTAGCTTAGATGTCGTGA) and reverse (5'TCGTGACAGGTGAGGCATCACACT), interleukin-2 (IL-2) forward (5'TCCAGTGCCTGGAAGAAGAACTTG) and reverse (5'ACAGTTACTGTCCCTCTAAGTCCAGCA), IL-4 forward (5'ACGGAGAAAGACCTCATTTGCAG) and reverse (5'TCACATTGCAGCTCTTCTGAGGAA), tumor necrosis factor alpha (TNF-
) forward (5' ACCACAGAAAGCATGATCDGDGA) and reverse (5'AGATGATCTGAGTGTGAGTGTCT), IL-10 forward (5' TGGACAACATACTACTCAGTCATC) and reverse (5'TCACAGGGGAGAAATCGATGACA), and hypoxanthine phosphoribosyltransferase (HPRT) forward (5'ACAGGACTGAAAGACTTGCTTGCG) and reverse (5'ATCGTTACAGTAGCTCTTCAGTCT). RT-PCR was performed using 48 µl of the Platinum PCR Supermix (Invitrogen), 0.5 µl of each primer, and 1 µl of first-stranded DNA. Amplification was performed in a PCT-200 Pelthier thermal cycler (MJ Research, Watertown, MA). DNA was amplified (40 cycles) using the primers described above. Annealing temperature was 59.9°C. To quantify the intensity of autoradiographic signals, we employed a desktop digital imaging method with an optical scanner. Briefly, photographs were scanned by standard video imaging equipment and the image was analyzed using an NIH Image 1.59 analysis software package with an integrated density program. The area analyzed for each band was kept constant for all the bands in an autoradiogram. Background density on the autoradiogram was subtracted from the densitometric data of each band. The results were expressed as a ratio of specific gene to that of corresponding HPRT expression to normalize to the quantity of RNA loaded.
Proliferation experiments.
Mesenteric lymph nodes and spleens were harvested from the different groups and homogenized and filtered through at 70-µm cell strainer (Falcon). Erythrocytes were lysed with cold ACK lysing buffer (Cellgro, Herndon, VA) for 5 min, and the cell suspension was washed with complete medium. Splenocytes were then labeled with 0.1 µM 5-(and 6)-carboxyfluorescein diacetate succinimidyl ester (CFSE; Molecular Probes, Eugene, OR) at room temperature for 10 min. After the incubation, cells were washed twice in complete medium to sequester any free CFSE. Cells were then resuspended in 10% RPMI medium in 24-well plates and supplemented with medium alone or 25 µg/ml of either larval or adult extract or 2 µg/ml concanavalin A (ConA) (Sigma). Cells were incubated at 37°C for 5 days, harvested, fixed with 4% paraformaldehyde, and analyzed by flow cytometry.
Statistical analysis.
Data are presented in the text and figures as means ± standard deviation (SD). Significance testing was conducted by using the StatCalc software package, version 5.3 (AcaStat Software, Ashburn, VA). Pairwise comparisons were conducted using Student's t test.

RESULTS
Hookworm parasite burden.
Hookworm eggs were detected in the feces of hamsters beginning
on day 14 following infection with 100
A. ceylanicum L3. Fecal
egg counts continued rising up to day 24 and then declined (Fig.
1A). After necropsy on day 32 postinfection, live adult hookworms
(51.6% of the original inoculum) were recovered from the intestines.
Figure
1B shows the distribution of worms by gender and location.
The average recovery in the small intestine was 15 ±
12.4 male parasites and 19.3 ± 7.7 female worms. The
average number of worms present in the colon was 6.5 ±
3.7 for males and 7.6 ± 5.0 for females. In infections
carried out by other routes, such as subcutaneous and intradermal,
adult recovery was only 1 to 2% of the original inoculum (data
not shown).
Hookworm-specific humoral immune responses.
The humoral and cellular antibody responses of hamsters were
characterized during prepatency (prior to postinfection day
14) or patency (from day 14 until day 32). Figure
2 shows hookworm-specific
total IgG responses to larval and adult extracts in hamsters
as measured by ELISA. Anti-larval antibodies were first detected
in infected hamsters at day 7 (mean titer, 1:121,500), gradually
decreasing with the onset of patency (day 17), when the larvae
have already maturated into egg-laying adult worms (mean titer,
1:13,500 in late patency). Anti-adult responses increased after
day 17, with titers 1:1,093,500 that were maintained until the
end of the study at day 32. These titers were significantly
higher than that detected with larval antigens (
P < 0.002).
No hookworm-specific antibody titers were detectable in uninfected
hamsters.
To characterize the antigen recognition profile of sera from
infected animals, immunoblotting against adult and larval extracts
was conducted using pooled sera collected at 7, 14, and 32 days
postinfection. Figure
3 shows larval antigens recognized by
pooled sera at different time points. The most immunodominant
antigens migrated with an apparent molecular weight of 100,
60, 39, 32, and 24 kDa, and antigen recognition pattern did
not change during the duration of the experiment. As shown in
Fig.
3, no adult antigens were recognized 7 days after infection.
Fourteen days after infection, however, pooled sera from infected
animals recognized five adult hookworm high-molecular-mass antigens
(
ca. 50 to 100 kDa). Later, at 32 days postinfection, the reaction
pattern increased and some antigens of lower molecular mass
(between 25 and 43 kDa) were also recognized. These data indicate
that the high-molecular-weight adult antigens are increasingly
recognized as the infection progresses, whereas the recognition
of larval antigens remains unchanged during the course of the
infection.
Cytokine response during the course of the infection.
The profile of cytokine expression in mesenteric lymph nodes
of hookworm-infected hamsters showed a transient Th1 profile
cytokine mRNAs during prepatency (7 days after infection). During
this period, mRNAs of proinflammatory cytokines such as IL-2,
IFN-

, and TNF-

were upregulated when compared to the basal expression
levels (
P < 0.003 for IL-2 and IFN-

), whereas the level of
IL-4 decreased moderately. IL-10 mRNA started to increase (
P < 0.05) during prepatency (Fig.
4). At patency, we observed
a change in cytokine expression, with upregulation of IL-4 (
P < 0.05) and especially IL-10 (
P < 0.003) mRNAs in the
lymph nodes draining the infection site. mRNA expression of
all the other cytokines was downregulated.
Local and systemic lymphoproliferative responses.
The effect of hookworm infection on local (mesenteric lymph
node) and systemic (spleen) lymphoproliferative responses to
the different stages of the parasite was determined by CFSE
staining. Figure
5A shows the lymphoproliferative response to
larval extracts before infection, during prepatency, and during
late patency. Lymphocytes from mesenteric lymph nodes and splenocytes
from hamster spleens proliferated in response to larval antigens
and ConA 7 days after the infection, and the difference in proliferative
capacity was significant when compared to the RPMI control group
(
P < 0.003 for the spleen and
P < 0.005 for the lymph
node, respectively). However, lymphoproliferation in response
to larval antigens was reduced at day 32. Therefore, the peak
in lymphoproliferation paralleled host Th1 cytokine expression.
When lymphoproliferation was carried out employing adult antigens
(Fig.
5B), no positive proliferative response was detected during
prepatency, likely due to the lack of exposure to adult antigens.
Conversely, a positive response to ConA was detected that was
statistically significant if compared to the RPMI control (
P < 0.005 for the spleen and
P < 0.0002 for the lymph node
cells). Finally, the lymphoproliferative response to adult antigens
or ConA was negative at late patency. Taken together, these
findings suggest that lymph node and spleen cells are able to
proliferate in response to specific or unspecific stimuli up
until the period when larvae develop into mature adults.

DISCUSSION
Despite the public health importance of hookworm infection in
humans and animals, very little is known about the immune responses
in permissive animal models in which larvae develop to egg-laying
adult hookworms. The hamster is an excellent host to model many
features of human hookworm infection, including anemia, weight
loss, retardation of growth, and chronicity of infection. An
additional advantage is its relatively low cost compared to
other animal models for ancylostomiasis, such as dogs. Other
inexpensive animal models, such as mice or rats, extensively
employed to study other helminth infections, such as
Trichinella,
Strongyloides, or
Nippostrongylus, cannot be employed to study
hookworm infections. When the model hamster of
A. ceylanicum was developed several decades ago (
19,
24,
32,
40,
46), few
immunological reagents were available, and a meticulous characterization
of the immunological components of this model could not be accomplished.
In this paper, we developed reagents and methods in order to
provide a first description of the humoral and cellular immune
response after
A. ceylanicum infections in the hamster model,
and we discuss its relevance as a model for human hookworm infections.
The recent development of molecular probes specific for hamster cytokines and its use in other experimental models (31, 45) enabled us to determine the cytokine patterns associated with hookworm infections. We chose a panel of cytokines which promote Th1 (IL-2, IFN-
, and TNF-
) or Th2 (IL-4) cell expansion as well as the anti-inflammatory cytokine IL-10. Primers were designed from regions that were unique for each cytokine. Using RT-PCR, we found that during prepatency (period of larval establishment and development to adults), an inflammatory response occurs, as evidenced by the highly elevated levels of IL-2, IFN-
, and moderate TNF-
. This Th1-type response lasted only during the prepatency period. The significance of the transient nature of the observed Th1 response is unknown, although it may be due to inflammation caused by the larval establishment in the host's mucosa. Serum IgG responses to larval antigens were also observed during prepatency, but these also disappeared with larval development and patency. The significance of observing only transient humoral responses to larval antigens, the nature of the antigens recognized by the hamster sera, and whether this observation is related to the Th1 response seen during prepatency is under investigation.
Multiple investigators have noted the development of rodent and human Th2 responses to nematode infections (3, 4, 28). This is particularly true for chronic human infections with hookworms (21). Our experimental animal model showed that the low levels of IL-4 and IL-10 found in the hamster during larval migration increased at patency in the lymph nodes draining the infection site. Therefore, we were able to monitor the development of Th2 responses coinciding with patency, concomitant with diminishing Th1 responses. The data obtained in the hamster model therefore confirms what was previously found in murine models using other nematodes: (i) a transient Th1 response during larval migration of Nippostrongylus braziliensis larvae, probably due to destruction of tissue during migration and establishment (27); (ii) establishment of a Th2 response (mainly by increase in IL-4 production) to favor worm expulsion (17); (iii) upregulation of IL-10 during infection, as shown in N. braziliensis and Schistosoma mansoni infections (30, 47). Moreover, the cytokine profile observed in A. ceylanicum hamster infections during patency was similar to the peripheral blood cytokine responses in chronic human hookworm infections, in which IFN-
and IL-12 are suppressed but IL-10, IL-4, IL-5, and IL-13 are elevated (21, 37). The prepatency/patency dichotomy in cytokine responses was also reflected in host lymphoproliferative responses. We found that lymphoproliferation diminished at the onset of patency. A similar phenomenon was observed previously in cells from mesenteric lymph nodes and spleens of A. ceylanicum-infected hamsters, which became less responsive to hookworm antigens in the latter stages of infection following an initial period of increased blast cell activity (20). In human hookworm infections, there is a paucity of data regarding T-cell reactivity in humans during primary infection. In two different human experimental infections with N. americanus, it was reported that peripheral blood lymphocytes reacted poorly to hookworm antigens or mitogens (29, 44). Several other reports have also described hookworm-related immunosuppression in endemic populations (5, 28, 35, 36, 39). Given the results found by us in the experimental model, a possible explanation for the observed immunosuppression could reflect the onset of Th2 responses and host IL-10 production following the establishment of adult hookworms with patency. To date, several immunomodulatory molecules from adult hookworms have been characterized, including a T-cell apoptotic factor (15) and an NK binding ligand (26) among others (7). In addition, Ancylostoma hookworms were shown previously to release a tissue inhibitor of metalloproteases in abundance (48). Mammalian tissue inhibitor of metalloproteases were show previously to stimulate the host cell production of IL-10 (23). Therefore, the possibility remains that adult hookworms directly stimulate host IL-10 production, which in turn suppresses proliferative responses (21, 23).
Our studies here suggest that the hamster model of A. ceylanicum could become useful for dissecting out the mechanisms of host-parasite interactions that lead to immunomodulation during hookworm infection. Interrupting parasite-induced immunodulation could develop into a strategy for immunotherapies against hookworm, such as vaccination.

ACKNOWLEDGMENTS
This work was supported by the Human Hookworm Vaccine Initiative
of the Sabin Vaccine Institute and the Bill and Melinda Gates
Foundation.
We would like to acknowledge Mariam Ameri and Adrienne Antoine for technical assistance, Stephanie Constant for manuscript discussion, and Reshad Dobardzic for providing the A. ceylanicum larvae.

FOOTNOTES
* Corresponding author. Mailing address: Department of Microbiology and Tropical Medicine, The George Washington University Medical Center, Ross Hall, Rm 726, 2300 Eye St. NW, Washington, DC 20037. Phone: (202) 994-2150. Fax: (202) 841-2913. E-mail:
mtmsxm{at}gwumc.edu.

Editor: J. L. Flynn

REFERENCES
1 - Albonico, M., P. G. Smith, E. Ercole, A. Hall, H. M. Chwaya, K. S. Alawi, and L. Savioli. 1995. Rate of reinfection with intestinal nematodes after treatment of children with mebendazole or albendazole in a highly endemic area. Trans. R Soc. Trop. Med. Hyg. 89:538-541.[CrossRef][Medline]
2 - Ali, F., A. Brown, P. Stanssens, L. M. Timothy, H. R. Soule, and D. I. Pritchard. 2001. Vaccination with neutrophil inhibitory factor reduces the fecundity of the hookworm Ancylostoma ceylanicum. Parasite Immunol. 23:237-249.[Medline]
3 - Allen, J. E., and R. M. Maizels. 1996. Immunology of human helminth infection. Int. Arch. Allergy Immunol. 109:3-10.[Medline]
4 - Bancroft, A. J., and R. K. Grencis. 1998. Th1 and Th2 cells and immunity to intestinal helminths. Chem. Immunol. 71:192-208.[Medline]
5 - Bentwich, Z. 2003. Concurrent infections that rise the HIV viral load. J. HIV Ther. 8:72-75.[Medline]
6 - Bethony, J., J. Chen, S. Lin, S. Xiao, B. Zhan, S. Li, H. Xue, F. Xing, D. Humphries, W. Yan, G. Chen, V. Foster, J. M. Hawdon, and P. J. Hotez. 2002. Emerging patterns of hookworm infection: influence of aging on the intensity of Necator infection in Hainan Province, People's Republic of China. Clin. Infect. Dis. 35:1336-1344.[Medline]
7 - Brooker, S., J. M. Bethony, and P. J. Hotez. Human hookworm infection in the 21st century. Adv. Parasitol., in press.
8 - Bungiro, R. D., Jr., J. Greene, E. Kruglov, and M. Cappello. 2001. Mitigation of hookworm disease by immunization with soluble extracts of Ancylostoma ceylanicum. J. Infect. Dis. 183:1380-1387.[CrossRef][Medline]
9 - Bungiro, R. D., Jr., C. V. Solis, L. M. Harrison, and M. Cappello. 2004. Purification and molecular cloning of and immunization with Ancylostoma ceylanicum excretory-secretory protein 2, an immunoreactive protein produced by adult hookworms. Infect. Immun. 72:2203-2213.[Abstract/Free Full Text]
10 - Carroll, S. M., and D. I. Grove. 1985. Ancylostoma ceylanicum: immunization with soluble worm extract and responses to challenge infection of dogs. Exp. Parasitol. 60:263-269.[Medline]
11 - Carroll, S. M., and D. I. Grove. 1986. Experimental infection of humans with Ancylostoma ceylanicum: clinical, parasitological, haematological and immunological findings. Trop. Geogr. Med. 38:38-45.[Medline]
12 - Carroll, S. M., D. I. Grove, H. J. Dawkins, G. F. Mitchell, and L. K. Whitten. 1983. Infections with a Malaysian dog strain of Ancylostoma ceylanicum in outbred, inbred and immunocompromised mice. Parasitology 87:229-238.
13 - Chu, D., R. D. Bungiro, M. Ibanez, L. M. Harrison, E. Campodonico, B. F. Jones, J. Mieszczanek, P. Kuzmic, and M. Cappello. 2004. Molecular characterization of Ancylostoma ceylanicum Kunitz-type serine protease inhibitor: evidence for a role in hookworm-associated growth delay. Infect. Immun. 72:2214-2221.[Abstract/Free Full Text]
14 - Cooper, E. S., C. A. Whyte-Alleng, J. S. Finzi-Smith, and T. T. MacDonald. 1992. Intestinal nematode infections in children: the pathophysiological price paid. Parasitology 104(Suppl.):S91-S103.
15 - Cooper, P. J., M. E. Chico, G. Losonsky, C. Sandoval, I. Espinel, R. Sridhara, M. Aguilar, A. Guevara, R. H. Guderian, M. M. Levine, G. E. Griffin, and T. B. Nutman. 2000. Albendazole treatment of children with ascariasis enhances the vibriocidal antibody response to the live attenuated oral cholera vaccine CVD 103-HgR. J. Infect. Dis. 182:1199-1206.[CrossRef][Medline]
16 - de Silva, N. R., S. Brooker, P. J. Hotez, A. Montresor, D. Engels, and L. Savioli. 2003. Soil-transmitted helminth infections: updating the global picture. Trends Parasitol. 19:547-551.[CrossRef][Medline]
17 - Finkelman, F. D., T. Shea-Donohue, J. Goldhill, C. A. Sullivan, S. C. Morris, K. B. Madden, W. C. Gause, and J. F. Urban, Jr. 1997. Cytokine regulation of host defense against parasitic gastrointestinal nematodes: lessons from studies with rodent models. Annu. Rev. Immunol 15:505-533.[CrossRef][Medline]
18 - Fleming, A. F. 1982. Iron deficiency in the tropics. Clin. Haematol. 11:365-388.[Medline]
19 - Garside, P., and J. M. Behnke. 1989. Ancylostoma ceylanicum in the hamster: observations on the host-parasite relationship during primary infection. Parasitology 98:283-289.
20 - Garside, P., J. M. Behnke, and R. A. Rose. 1989. The immune response of male DSN hamsters to a primary infection with Ancylostoma ceylanicum. J. Helminthol. 63:251-260.[Medline]
21 - Geiger, S. M., C. L. Massara, J. Bethony, P. T. Soboslay, and R. Correa-Oliveira. 2004. Cellular responses and cytokine production in post-treatment hookworm patients from an endemic area in Brazil. Clin. Exp. Immunol. 136:334-340.[Medline]
22 - Goud, G. N., B. Zhan, K. Ghosh, A. Loukas, J. Hawdon, A. Dobardzic, V. Deumic, S. Liu, R. Dobardzic, B. C. Zook, Q. Jin, Y. Liu, L. Hoffman, S. Chung-Debose, R. Patel, S. Mendez, and P. J. Hotez. 2004. Cloning, yeast expression, isolation, and vaccine testing of recombinant Ancylostoma-secreted protein (ASP)-1 and ASP-2 from Ancylostoma ceylanicum. J. Infect. Dis. 189:919-929.[CrossRef][Medline]
23 - Guedez, L., A. Mansoor, B. Birkedal-Hansen, M. S. Lim, P. Fukushima, D. Venzon, W. G. Stetler-Stevenson, and M. Stetler-Stevenson. 2001. Tissue inhibitor of metalloproteinases 1 regulation of interleukin-10 in B-cell differentiation and lymphomagenesis. Blood 97:1796-1802.[Abstract/Free Full Text]
24 - Gupta, S., J. K. Srivastava, and J. C. Katiyar. 1987. Ancylostoma ceylanicum: migratory behaviour in golden hamsters after oral and parenteral infection. Ann. Trop. Med. Parasitol. 81:421-428.[Medline]
25 - Hotez, P. J. 2000. Pediatric geohelminth infections: trichuriasis, ascariasis, and hookworm infections. Semin. Pediatr. Infect. Dis. 11:236-244.[CrossRef]
26 - Hsieh, G. C., A. Loukas, A. M. Wahl, M. Bhatia, Y. Wang, A. L. Williamson, K. W. Kehn, H. Maruyama, P. J. Hotez, D. Leitenberg, J. Bethony, and S. L. Constant. 2004. A secreted protein from the human hookworm Necator americanus binds selectively to NK cells and induces IFN-gamma production. J. Immunol. 173:2699-2704.[Abstract/Free Full Text]
27 - Lawrence, R. A., C. A. Gray, J. Osborne, and R. M. Maizels. 1996. Nippostrongylus brasiliensis: cytokine responses and nematode expulsion in normal and IL-4-deficient mice. Exp. Parasitol. 84:65-73.[CrossRef][Medline]
28 - Loukas, A., and P. Prociv. 2001. Immune responses in hookworm infections. Clin. Microbiol. Rev. 14:689-703.[Abstract/Free Full Text]
29 - Maxwell, C., R. Hussain, T. B. Nutman, R. W. Poindexter, M. D. Little, G. A. Schad, and E. A. Ottesen. 1987. The clinical and immunologic responses of normal human volunteers to low dose hookworm (Necator americanus) infection. Am. J. Trop. Med. Hyg. 37:126-134.
30 - McKee, A. S., and E. J. Pearce. 2004. CD25+CD4+ cells contribute to Th2 polarization during helminth infection by suppressing Th1 response development. J. Immunol. 173:1224-1231.[Abstract/Free Full Text]
31 - Melby, P. C., V. V. Tryon, B. Chandrasekar, and G. L. Freeman. 1998. Cloning of Syrian hamster (Mesocricetus auratus) cytokine cDNAs and analysis of cytokine mRNA expression in experimental visceral leishmaniasis. Infect. Immun. 66:2135-2142.[Abstract/Free Full Text]
32 - Menon, S., and M. K. Bhopale. 1985. Ancylostoma ceylanicum (Looss, 1911) in golden hamsters (Mesocricetus auratus): pathogenicity and humoral immune response to a primary infection. J. Helminthol. 59:143-146.[Medline]
33 - Menon, S., and M. K. Bhopale. 1985. Efficacy of UV-irradiated larval vaccine of Ancylostoma ceylanicum (Looss, 1911) in golden hamsters (Mesocricetus auratus). J. Helminthol. 59:287-293.[Medline]
34 - Monsalve, R. I., G. Lu, and T. P. King. 1999. Expressions of recombinant venom allergen, antigen 5 of yellowjacket (Vespula vulgaris) and paper wasp (Polistes annularis), in bacteria or yeast. Protein Expr. Purif. 16:410-416.[Medline]
35 - Olatunde, B. O., and G. C. Onyemelukwe. 1994. Immunosuppression in Nigerians with hookworm infection. Afr. J. Med. Sci. 23:221-225.
36 - Onyemelukwe, G. C., and B. O. Musa. 2001. T-lymphocyte subsets in patients with hookworm infection in Zaria, Nigeria. Afr. J. Med. Sci. 30:255-259.
37 - Quinnell, R. J., D. I. Pritchard, A. Raiko, A. P. Brown, and M. A. Shaw. 2004. Immune responses in human necatoriasis: association between interleukin-5 responses and resistance to reinfection. J. Infect. Dis. 190:430-438.[CrossRef][Medline]
38 - Quinnell, R. J., A. F. Slater, P. Tighe, E. A. Walsh, A. E. Keymer, and D. I. Pritchard. 1993. Reinfection with hookworm after chemotherapy in Papua New Guinea. Parasitology 106:379-385.
39 - Quinnell, R. J., M. E. Woolhouse, E. A. Walsh, and D. I. Pritchard. 1995. Immunoepidemiology of human necatoriasis: correlations between antibody responses and parasite burdens. Parasite Immunol. 17:313-318.[Medline]
40 - Ray, D. K., and K. K. Bhopale. 1972. Complete development of ancylostoma ceylanicum (Looss, 1911) in golden hamsters, mesocricetus auratus. Experientia 28:359-361.[CrossRef][Medline]
41 - Ray, D. K., K. K. Bhopale, and V. B. Shrivastava. 1975. Development of Ancylostoma ceylanicum Looss, 1911 (hamster strain) in the albino mouse, Mus musculus, with and without cortisone. Parasitology 71:193-197.[Medline]
42 - Sakti, H., C. Nokes, W. S. Hertanto, S. Hendratno, A. Hall, D. A. Bundy, and Satoto. 1999. Evidence for an association between hookworm infection and cognitive function in Indonesian school children. Trop. Med. Int. Health 4:322-334.[CrossRef][Medline]
43 - Stoltzfus, R. J. 2001. Iron-deficiency anemia: reexamining the nature and magnitude of the public health problem. J. Nutr. 131:697S-701S.[Abstract/Free Full Text]
44 - Taylor, M. M., and J. A. Turton. 1976. Antigen-induced lymphocyte blastogenesis in a hookworm (Necator americanus) infection in man. Trop. Med. Parasitol. 27:89-92.
45 - Travi, B. L., Y. Osorio, P. C. Melby, B. Chandrasekar, L. Arteaga, and N. G. Saravia. 2002. Gender is a major determinant of the clinical evolution and immune response in hamsters infected with Leishmania spp. Infect. Immun. 70:2288-2296.[Abstract/Free Full Text]
46 - Visen, P. K., J. C. Katiyar, and A. B. Sen. 1984. Studies on infectivity, longevity and fecundity of Ancylostoma ceylanicum in golden hamsters. J. Helminthol. 58:159-163.[Medline]
47 - Wohlleben, G., C. Trujillo, J. Muller, Y. Ritze, S. Grunewald, U. Tatsch, and K. J. Erb. 2004. Helminth infection modulates the development of allergen-induced airway inflammation. Int. Immunol. 16:585-596.[Abstract/Free Full Text]
48 - Zhan, B., Y. Liu, M. Badamchian, A. Williamson, J. Feng, A. Loukas, J. M. Hawdon, and P. J. Hotez. 2003. Molecular characterisation of the Ancylostoma-secreted protein family from the adult stage of Ancylostoma caninum. Int. J. Parasitol. 33:897-907.[Medline]
Infection and Immunity, June 2005, p. 3402-3407, Vol. 73, No. 6
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.6.3402-3407.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Dondji, B., Bungiro, R. D., Harrison, L. M., Vermeire, J. J., Bifulco, C., McMahon-Pratt, D., Cappello, M.
(2008). Role for Nitric Oxide in Hookworm-Associated Immune Suppression. Infect. Immun.
76: 2560-2567
[Abstract]
[Full Text]
-
Rama Iniguez, S., Dea-Ayuela, M. A., Sanchez-Brunete, J. A., Torrado, J. J., Alunda, J. M., Bolas-Fernandez, F.
(2006). Real-Time Reverse Transcription-PCR Quantification of Cytokine mRNA Expression in Golden Syrian Hamster Infected with Leishmania infantum and Treated with a New Amphotericin B Formulation.. Antimicrob. Agents Chemother.
50: 1195-1201
[Abstract]
[Full Text]