IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parsons, D. A.
Right arrow Articles by Heffron, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parsons, D. A.
Right arrow Articles by Heffron, F.

 Previous Article  |  Next Article 

Infection and Immunity, July 2005, p. 4338-4345, Vol. 73, No. 7
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.7.4338-4345.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

sciS, an icmF Homolog in Salmonella enterica Serovar Typhimurium, Limits Intracellular Replication and Decreases Virulence

Duncan A. Parsons* and Fred Heffron

Department of Molecular Microbiology and Immunology, Oregon Health and Science University, Portland, Oregon 97201

Received 21 December 2004/ Returned for modification 1 February 2005/ Accepted 10 March 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Salmonella enterica serovar Typhimurium utilizes macrophages to disseminate from the intestine to deeper tissues within the body. While S. enterica serovar Typhimurium has been shown to kill its host macrophage, it can persist intracellularly beyond 18 h postinfection. To identify factors involved in late stages of infection, we screened a transposon library made in S. enterica serovar Typhimurium for the ability to persist in J774 macrophages at 24 h postinfection. Through this screen, we identified a gene, sciS, found to be homologous to icmF in Legionella pneumophila. icmF, which is required for intracellular multiplication, is conserved in several gram-negative pathogens, and its homolog appears to have been acquired horizontally in S. enterica serovar Typhimurium. We found that an sciS mutant displayed increased intracellular numbers in J774 macrophages when compared to the wild-type strain at 24 h postinfection. sciS was maximally transcribed at 27 h postinfection and is repressed by SsrB, an activator of genes required for promoting intracellular survival. Finally, we demonstrate that an sciS mutant is hypervirulent in mice when administered intragastrically. Taken together, these data indicate a role for SciS in controlling intracellular bacterial levels at later stages of infection and attenuating virulence in a murine host


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Salmonella enterica serovar Typhimurium is an enteric pathogen that causes a self-limiting gastroenteritis in humans and a systemic typhoid-like disease in mice. Macrophages are an essential vehicle for the pathogenesis of S. enterica serovar Typhimurium, which utilizes them to disseminate from the intestine to the spleen and liver. S. enterica serovar Typhimurium survives inside and eventually kills its host macrophage. Much has been published on how S. enterica serovar Typhimurium manipulates the macrophage phagosome to facilitate survival (15, 19, 25, 37, 41) as well as how it kills macrophages (2, 5, 17, 20, 27, 39), but little is known about the factors that allow it to persist intracellularly beyond 24 h. This study provides evidence that a horizontally acquired gene, sciS, limits intracellular replication of S. enterica serovar Typhimurium in macrophages at late stages of infection.

Pathogenicity islands, which are horizontally acquired pieces of DNA that confer virulence traits, are especially crucial for the interaction of S. enterica serovar Typhimurium with eukaryotic host cells. S. enterica serovar Typhimurium contains two highly studied pathogenicity islands on its chromosome—Salmonella pathogenicity islands 1 and 2 (SPI1 and -2)—which encode separate type III secretion systems (TTSS) that facilitate invasion and survival, respectively. In the absence of SPI1, infected macrophages are not killed at early time points (1 to 6 h postinfection) (23, 39). A second killing pathway, mediated by SPI2, results in host cell death at 18 to 24 h postinfection (39). Despite this second killing pathway, bacteria can still persist inside intact macrophages beyond 24 h. To identify factors involved in the long-term persistence of S. enterica serovar Typhimurium in macrophages, we isolated mutants with enhanced survival in macrophages at 24 h postinfection. One of the mutants identified was sciS, a homolog of icmF that is contained in several gram-negative pathogens.

icmF was first studied in L. pneumophila, where it is part of the Dot/Icm cluster of genes that form a type IV secretion system (T4SS) required for host cell killing and intracellular multiplication (29, 34). Three recent studies have shown icmF to be critical for allowing L. pneumophila to replicate in its own modified vacuole by maintaining an intact T4SS. IcmF was shown to be "partially required" for replication in human macrophages and essential for intracellular growth in amoeba (44). Another study showed that DotU and IcmF are required for the formation of replicative vacuoles and the translocation of the T4SS substrate, SidC (40). Additionally, DotU and IcmF serve to prevent degradation of type IV secretion components, indicating a role in stabilizing the T4SS (35).

A conserved cluster of 15 genes surrounding icmF in Vibrio cholerae has been designated IcmF-associated homologous proteins (IAHP) (9). Gram-negative pathogens containing the icmF homolog have from 6 to 14 of the 15 genes in this cluster, but there is some variability in the composition and arrangement between the species. icmF in V. cholerae is induced under in vivo conditions as measured in a rabbit ileal loop model (8). An icmF insertion mutant showed a nearly twofold increase in interleukin-8 mRNA levels in V. cholerae-infected intestinal epithelial cells when compared with the wild type (32). The same insertion mutant showed reduced motility, increased adherence to epithelial cells, and a higher conjugation frequency, leading to speculation that it is involved in bacterial cell surface reorganization (7). The importance of icmF homologs is highlighted by their conservation in nine different gram-negative pathogenic species (9); however, their exact function remains unclear. Most bacteria that contain an icmF homolog are pathogenic and maintain close contact with eukaryotic cells. Therefore, it is likely that icmF homologs and associated proteins play an important role in bacterial pathogenesis.

The icmF homolog in S. enterica serovar Typhimurium, sciS, named for salmonella centisome 7 island, is located within a 44-kb genomic island, which contains 9 of the 15 IAHP genes. A deletion of the entire island causes a defect in the ability of S. enterica serovar Typhimurium to enter Hep-2 cells (12). The only individual genes studied in this island constitute the Salmonella atypical fimbrial (saf) operon that was not required for mouse virulence (11). The remaining open reading frames in this island have not been characterized, but several encode putative proteins with homology to known virulence proteins.

In this study, we identified sciS in a transposon mutant screen and investigated its role in the long-term persistence of S. enterica serovar Typhimurium inside macrophages. We determined that SciS limits intracellular growth in macrophages only at late stages of infection and attenuates the lethality of S. enterica serovar Typhimurium in a murine host. Together, these data constitute a unique example of a horizontally acquired, temporally regulated gene that controls S. enterica serovar Typhimurium virulence in mice.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial strains, plasmids, and DNA manipulations. All strains were grown in Luria-Bertani (LB) broth overnight at 37°C. Antibiotics, when added, were used at the following concentrations: choramphenicol (Cm), 30 µg/ml; kanamycin (Kan), 60 µg/ml; carbenicillin (Carb), 100 µg/ml; and tetracycline (Tet), 20 µg/ml. All strains and plasmids used or constructed in this study are listed in Table 1. The construction of the sciS nonpolar deletion (DP103) was performed using the pMAK705 temperature-sensitive plasmid-based system (1). A fragment containing the mutation in sciS, plus at least 2 kb of flanking DNA on either side was cloned into suicide plasmid pMAK705. The two fragments were amplified from the chromosome using primers TCTAGAGCATCCAGCTTCATGAATGTCGATGAG and CTGCAGGATACTCAACTGGTCGGCCAC for fragment 1 and primers CTGCAGCAGATCGCTTCGCTGCTGACC and AAGCTTGCACATAGTCGCGCTGGTCCG for fragment 2. Fragment 1 contains an N-terminal XbaI restriction site and a C-terminal PstI restriction site and ends 1,413 bp into the SciS open reading frame. Fragment 2 contains an N-terminal Pst1 restriction site and a C-terminal HindIII site and begins 2,959 bp into the 3,871-bp SciS open reading frame. These two fragments were cloned separately into pCRBlunt (Invitrogen, Carlsbad, CA), excised, and ligated together into pMAK705, creating a 1,545-bp deletion in sciS. The resulting plasmid, pMAKf12, was transformed into 14028 at 30°C on LB-Cam plates. Resulting colonies were then selected for growth on Cam plates at the nonpermissive temperature 42°C, which forces the integration of the plasmid into the chromosome via homologous recombination. To select the rare double crossover event, ampicillin enrichment was used to remove those colonies that still contained the plasmid. Any chloramphenicol-sensitive bacteria remaining were then screened via PCR for the correct mutation. The resulting strain, DP103, contains a 1,546-bp nonpolar deletion spanning bp 1413 to 2959 in the 3,870-bp sciS open reading frame.


View this table:
[in this window]
[in a new window]
 
TABLE 1. S. enterica serovar Typhimurium strains used in this study

 
The sciS chromosomal lacZ fusion (DP137) was also made using pMAK705, but the resulting cointegrate was not resolved, leaving an sciS upstream fragment transcriptionally fused to lacZ and an intact sciS gene. A DNA fragment covering the promoter region of sciS was amplified from the chromosome via PCR using the primers GGTACCCCCTGTCAGAGGACAGACTCC and GGATCCCAGCGGCCCGACAAACCAGAC. The sciS promoter fragment spanning positions –1000 through +95 was ligated into the suicide plasmid pSC433(pMAK705::lacZ), generating plasmid pDP136(sciS::lacZ). This plasmid was electroporated into 14028, and the resulting colonies were grown at 42°C to select for single crossovers into the chromosome. The resulting chromosomal construct was transferred into a new 14028 background by P22 transduction. The resulting strain was confirmed via PCR before use in intracellular ß-galactosidase assays.

Eukaryotic cells and infection procedure. The murine macrophage cell line, J774A0.1 (American Type Culture Collection [ATCC], Manassas, Va.), was maintained in Dulbecco's modified Eagle medium (DMEM; Gibco-BRL, Rockville, Md.) supplemented with 10% fetal bovine serum (FBS; Gibco-BRL), 0.2 mM MEM sodium pyruvate (Gibco-BRL), and 0.1 mM nonessential amino acids (Gibco-BRL). J774 macrophages in tissue culture plates were infected with overnight cultures grown rolling at 37°C. Prior to infection, cultures were adjusted to an optical density at 600 nm (OD600) of 1.0 and resuspended in phosphate-buffered saline (PBS). After the addition of bacteria, the plates were centrifuged at 25°C for 5 min and placed in a 37°C incubator with CO2 for 25 min. Cells were then washed three times with PBS to remove extracellular bacteria, and fresh DMEM containing 100 µg/ml gentamicin was added for 1 h at 37°C to kill extracellular bacteria. The plates were washed once with PBS and then incubated with 20 µg/ml gentamicin at 37°C.

Selection and screen for persistent mutants in J774 macrophages. A mutant bank was generated in DP101 (invA::cam) using MudJ transposon mutagenesis with P22 (21). The bank was plated on large M9 minimal media agar plates to reduce the number of auxotrophs. Approximately 50,000 mutants were generated on 12 separate plates. Each plate was scraped, and the bacteria resuspended in 2 ml of LB with 10% glycerol and frozen at –80°C. An overnight culture was grown from each pool and J774 macrophages in 6-well plates were infected (as described above) at a multiplicity of infection (MOI) of 1 bacterium to 10 macrophages. After 24 h of infection, the 12 infected wells were washed with PBS and the remaining macrophages were lysed with 1% Triton X-100 (Sigma Chemical, St. Louis, MO). These lysates were used to start overnight cultures, and 12 new wells were infected. This process was repeated three times to enrich for mutants that remained inside the macrophage. Four of the 12 pools showed a sharp increase in bacterial numbers after three passages. Individual mutants from these pools were scored for cytotoxicity on J774 macrophages in 96-well plates. Three candidate mutants from each of the four pools were selected and their MudJ insertions were sequenced by inverse PCR, and the results are listed in Table 2.


View this table:
[in this window]
[in a new window]
 
TABLE 2. MudJ transposon insertions from selection for persistent mutants

 
Cytotoxicity assays. These assays were performed as previously described by van der Velden et al. (39). Briefly, J774 macrophages seeded in 96-well plates were infected with overnight stationary-phase cultures of S. enterica serovar Typhimurium at an MOI of approximately 50. At the indicated time points, the supernatant was removed and used to determine the release of cytoplasmic lactate dehydrogenase (LDH) using the CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega, Madison, WI). Cytotoxicity was determined for each strain by calculating the LDH released as a percentage of the maximal release from lysed macrophages.

Microscopy. J774 macrophages were grown on glass coverslips placed in 6-well plates prior to infection with Salmonella strains containing the plasmid pEGFP. Cells were infected at an MOI of 80 or 10. After 24 h of infection, cells were washed with PBS and fixed with 3.6% paraformaldehyde in PBS for 15 min at 25°C. The coverslips were then stained with either 4',6-diamidino-2-phenylindole (DAPI; Sigma Chemical) alone or with FM4-64 (Molecular Probes, Eugene, OR) and 4N,6N-diamidino-2-phenylindole at 25°C for 1 h. Ten fields were randomly chosen for each coverslip, and images were taken using an Applied Precision Image Restoration System (Advanced Precision Instruments, Issaquah, WA). All images were taken at 60x. Image stacks of 5 steps spaced 0.2 microns apart were taken and deconvolved. Selected images were saved in TIFF format and imported into Adobe Photoshop to be formatted for publication. The number of bacteria per infected macrophage was counted double blind for each field.

Intracellular ß-galactosidase assays. Activity of ß-galactosidase was assayed as described previously (26). To measure the ß-galactosidase activity from intracellular bacteria, macrophages were grown in 6-well plates and infected with DP137 at an MOI of 50, as described above. Cells were collected from 3 wells and lysed with 1% Triton X-100 at the indicated time points. Lysates were serially diluted and plated to determine the number of intracellular bacteria. ß-Galactosidase activity was expressed in Miller units per 109 bacteria.

Screen for regulators of SciS. A modified tetracycline-inducible transposon (T-POP) was constructed by replacing the original Tn10 ends with Tn5 ends (30). The T-POP transposon used the primers 5'-CAGCTGTCTCTTATACACATCTCCATTAAGGTTACCATCACGGA-3' and 5'-CAGCTGTCTCTTATACACATCTGTGATCTCGGGAAAAGCGTTGGTGA-3'. The resulting fragment was cloned into the pCR2.1-TOPO (Invitrogen) to yield a vector containing the Tn5 T-POP. The transposon was excised from the vector with PvuII and purified. This Tn5 T-POP transposon was used to mutagenize the sciS::lacZ strain (DP137). A complex containing the Tn5 T-POP transposon and purified transposase was electroporated into electrocompetent DP137. Transposition of the transposon then occurred randomly within the bacterial chromosome. Bacteria containing transposon insertions were then selected by plating on tetracycline and 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside (X-Gal) plates. Those mutations that caused a color change from DP137 (light blue) were transduced into DP137 and retested for color change. Chromosomal DNA was purified from those colonies that retained a color change and the transposon insertion site was sequenced.

Real-time PCR analysis. Total RNA from S. enterica serovar Typhimurium-infected J774 macrophages (MOI of 50) was isolated using hot phenol extraction and cleaned with an RNeasy Mini column (QIAGEN, Valencia, CA) and used as a template to make cDNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Quantitative real-time PCR was performed on the cDNA using primers to sciS and gyrB as a control. rpoD was initially used as a control in our real-time PCR assays, as this gene has been established as a steadily transcribed housekeeping gene for use as an internal control (33). However, the primers to this gene seem to cross-react with eukaryotic cDNA, so rpoD could not be used as an internal control for real-time PCR performed on cDNA from infected macrophages. gyrB was suggested as a housekeeping gene to use as an internal control (personal communication with Ferric Fang). Primers to gyrB were tested in real-time PCR experiments on cDNA from bacterial cultures in parallel with rpoD primers and both genes were transcribed equally in all conditions tested. Each real-time PCR was run in quadruplicate and values were expressed as fold induction to gyrB. The fold induction of wild-type-infected macrophages at 5 h was set to 1. Values are the average of three separate experiments.

Mouse studies. Mice were inoculated intragastrically with 200 µl of an overnight culture of either 14028 or {Delta}sciS that was resuspended and diluted in PBS. The following doses were given to groups of 4 mice: 3.1 x 104, 3.1 x 105, 3.1 x 106 for 14028 and 3.3 x 104, 3.3 x 105, 3.3 x 106 for {Delta}sciS. This experiment was repeated with groups of 8 mice with the following doses: 3.64 x 104, 3.64 x 105, 3.64 x 106 for 14028 and 3.70 x 104, 3.70 x 105, 3.70 x 106 for {Delta}sciS. Mice were monitored for 28 days for survival, and 50% lethal dose (LD50) values were calculated according to the method of Reed and Muench (31).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A selection and screen for mutants that persist in macrophages identified sciS. To investigate the contribution of S. enterica serovar Typhimurium genes at late stages of infection, MudJ transposon mutants that survived in J774 macrophages for 24 h without causing host cell lysis were selected. The bacteria used to infect the macrophages were from a bank of 50,000 MudJ transposon mutants divided into 12 separate pools. To prevent early killing of the macrophages, mutants were generated in a strain deleted for invA. The SPI1 TTSS has been shown to induce rapid apoptosis in macrophages, and InvA is required for its formation (24, 38). J774 macrophages were infected at an MOI of 0.1, and at 25 min postinfection gentamicin was added to the extracellular media to eliminate those bacteria that didn't invade or escaped their host cell via lysis. By infecting at an MOI of 0.1, the majority of infected macrophages would contain a homogeneous population of replicating bacteria derived from a single progenitor. Following 24 h of infection, the remaining macrophages were lysed with 1% Triton X-100 and the intracellular bacteria were recovered, used to start an overnight culture and infect new macrophages. This process of serial passaging was repeated three times, enriching the pools for persistent mutants. Four of the original 12 pools showed an increase in bacteria recovered from infected macrophages after three passages. Individual mutants from each of these four "enriched" pools were then isolated and screened in J774 macrophages for persistence. Three MudJ insertions from each pool were sequenced giving a total of 12 individual sequences (Table 2). These sequences included sciS as well as genes involved in DNA repair and propanediol metabolism. Based on its homology to a known virulence gene in L. pneumophila and its location in a genomic island, sciS was chosen for further characterization.

An sciS mutant is more numerous in J774 macrophages at 24 h postinfection. Surprisingly, none of the mutants isolated had measurable defects in cytotoxicity on J774 macrophages (data not shown) as measured by LDH release and crystal violet staining (39). Because the mutants were cytolytically normal, their persistence suggested that they had differences in intracellular numbers that led to their selection. Mutations that caused reduced intracellular replication could lead to an inability to break out of the phagosome, thus leading to a persistent state that would allow their selection. Conversely, mutations that cause overgrowth could be preferentially selected due to a higher representation of this population. To determine the effect of an sciS mutation on intracellular bacterial numbers we constructed a nonpolar deletion of sciS (DP103) and infected J774 macrophages to determine its effect on intracellular replication. We used two methods to enumerate intracellular bacteria: (i) quantitation of intracellular bacteria and (ii) visual inspection of bacteria per infected macrophage via microscopy. The first method is standard for measuring intracellular replication and involves lysing macrophages at 24 h postinfection and plating intracellular bacteria. The wild-type strain and DP103 had similar intracellular numbers of viable bacteria at 6 h postinfection. However, Salmonella 14028-infected macrophages contained two- to threefold less CFU than DP103-infected macrophages past 24 h postinfection (Fig. 1A). DP103 was also retested for cytotoxicity on J774 macrophages and showed no significant difference from wild type at 6 or 24 h postinfection (Fig. 1B). To more directly visualize what was occurring in individual host cells, wide-field deconvolution fluorescence microscopy was used to enumerate intracellular bacteria. For these studies, 14028 and DP103 were transformed with the green fluorescent protein (GFP)-containing plasmid pEGFP, resulting in strains DP148 and DP114, respectively. J774 macrophages were infected with either DP148 or DP114 for 24 h, fixed, and then stained with DAPI (DNA; blue) and FM4-64 (membrane; red). Microscopy experiments were then performed using MOIs of 10 and 80 (Fig. 2A to D). In each experiment, the number of bacteria per infected cell was determined double blind for each strain in 10 separate fields (Fig. 2E). The results show that macrophages infected with an sciS mutation at an MOI of 10 had 63% more intracellular bacteria than the wild type at 24 h postinfection, while an MOI of 80 showed a 94% increase. All experimental MOIs in this study fall within the range of 10 to 80 established with the microscopy results. Differences in intracellular bacterial numbers were not evident between the strains at 6 h postinfection, as macrophages infected with an sciS mutation showed 7.9 bacteria per infected cell versus 8.4 for wild type at an MOI of 80 (data not shown). However, the sciS mutant had significantly increased intracellular bacterial numbers when measured at 24 h postinfection, correlating well with the selection procedure.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 1. An sciS mutant displays increased intracellular numbers at late stages of infection in J774 macrophages but shows no difference in cytotoxicity. (A) Cells were infected with 14028 (diamonds) and DP103 (squares) at an MOI of 35. At the indicated time points, the macrophages were lysed with 1% Triton X-100 and intracellular bacterial numbers were determined. Each data point is the average of three individual wells. The asterisks indicate a P value of <0.10 as measured by a Student's t test. (B) Cytotoxicity to J774 macrophages by 14028 or sciS was quantified by measuring LDH release at 6 and 24 h postinfection. The differences between the strains in panel B were not statistically significant. Data from panels A and B are the average of three independent experiments with each time point measured in triplicate. Error bars indicate the standard deviations of the mean. w/t, wild type.

 


View larger version (40K):
[in this window]
[in a new window]
 
FIG. 2. An sciS mutant is more numerous in J774 macrophages at 24 h postinfection. These images are representative fields from experiments performed at two separate MOIs. (A and B) Macrophages were infected on glass coverslips in 6-well plates for 24 h at an MOI of 80 and stained with DAPI (DNA stain; blue). (C and D) Macrophages were infected on glass coverslips in 6-well plates for 24 h at an MOI of 10 and stained with DAPI and FM4-64 (membrane stain; red). Macrophages were infected with 14028 (A and C) and {Delta}sciS (B and D). (E) The average number of bacteria per infected cell for 10 individual fields (P < 0.01, Student's t test). Data from the graph in panel E represent results from three separate experiments. w/t, wild type.

 
sciS is maximally expressed in host macrophages at 27 h postinfection. The difference in intracellular numbers at late but not early time points suggested that sciS might not be expressed until late during the infection process. To investigate the temporal expression of sciS inside cells, we constructed an sciS promoter fusion to lacZ(DP137). Macrophages were infected with DP137 and ß-galactosidase activity was measured at seven time points between 10 and 34 h postinfection (Fig. 3). In vitro, sciS was transcribed at undetectable levels above background; it was also minimally transcribed inside macrophages before 10 h postinfection (data not shown). sciS induction is markedly different than that of SPI2 genes as expression levels for seven SPI2 genes encoding effectors or structural proteins have either peaked or leveled off at 8 h postinfection (6). We found that sciS was maximally transcribed inside macrophages at 27 h postinfection. The timing of sciS transcription correlates well with the finding that an sciS mutant selected at 24 h postinfection shows increased intracellular numbers at the same time but not at 6 h postinfection. To verify this finding, we isolated total RNA from 14028-infected macrophages at 5 and 24 h postinfection. We measured sciS mRNA levels using quantitative real-time PCR. We found that sciS mRNA levels were sevenfold higher at 24 h than at 5 h postinfection, in agreement with our previous observations (Fig. 4).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 3. sciS is maximally expressed in host macrophages at 27 h postinfection. J774 macrophages were infected with DP137 at an MOI of 50. Intracellular ß-galactosidase activity was determined at the indicated time points. Miller units are expressed per 109 intracellular bacteria. In vitro cultures of DP137 showed ß-galactosidase activity below background. Data shown represent arithmetic means of three independent experiments. Error bars indicate the standard deviations of the mean.

 


View larger version (10K):
[in this window]
[in a new window]
 
FIG. 4. sciS is more highly transcribed at 24 h postinfection and is negatively regulated by SsrB. sciS RNA levels were quantified via real-time PCR with total RNA isolated from wild-type- and {Delta}ssrB-infected J774 macrophages (MOI = 50). Values were normalized to the levels of gyrB RNA and subsequently to the 5-h time point from the wild-type-infected J774s. sciS is 7.5-fold more highly transcribed at 24 h postinfection than at 5 h. An ssrB mutant shows a 5.5-fold increase in sciS message at 5 h postinfection over the wild-type strain. Data shown represent arithmetic means of three independent experiments. Error bars indicate the standard deviations of the mean. w/t, wild type.

 
SsrB negatively regulates SciS. The late transcription of sciS in host cells raised questions as to how it was regulated. To identify genes that affected expression of sciS, DP137 (sciS::lacZ promoter fusion) was mutagenized with a modified T-POP transposon. The 6,000 colonies from the mutagenesis procedure were screened for differences in transcription of sciS from the parental strain. The parental strain (DP137) appears light blue on an LB plate containing X-Gal, so those colonies that were white or dark blue were selected for further analysis. A dark blue colony was isolated containing a transposon insertion within ssrB. It was predicted to be a negative regulator of sciS, as the transposon insertion within ssrB leads to increased expression of sciS. To verify this, real-time PCR was performed on total RNA isolated from macrophages infected with either an ssrB mutant or wild-type S. enterica serovar Typhimurium at 5 h postinfection. There were not sufficient numbers of intracellular bacteria at 24 h postinfection to provide the RNA necessary to do real-time PCR, as an ssrAB mutation impairs intracellular replication in macrophages (6). Real-time PCR showed a fivefold increase in sciS transcription in an ssrB mutant when compared to wild type at 5 h postinfection, confirming that SsrB negatively regulates sciS (Fig. 4). However, it is not known if SsrB directly or indirectly regulates sciS.

A sciS mutant is hypervirulent in mice. Having shown that sciS is important in S. enterica serovar Typhimurium pathogenesis of tissue culture macrophages, we tested its contribution to S. enterica serovar Typhimurium virulence in an in vivo mouse model. Groups of eight BALB/c mice were injected intragastrically with either 14028 or DP103({Delta}sciS) and monitored for survival over a 28-day period. Mice began dying at approximately the same day, regardless of the inoculating strain; however, only half of the wild-type inoculated mice had died by day 9 while all of the DP103 inoculated mice died by day 11 (Fig. 5). The LD50 calculated for DP103 was eightfold lower than that of 14028, indicating that the mutant was hypervirulent. This experiment was also done with groups of 4 mice, showing a ninefold reduction in LD50 for DP103 (data not shown). This was an unexpected result, given that only two other mutations in S. enterica serovar Typhimurium (grvA, pcgL) have shown an increase in virulence (18, 28).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 5. An sciS mutant is hypervirulent in BALB/c mice when administered intragastrically. Groups of 8 mice were inoculated with either 14028 or DP103 and monitored for 28 days. The graphed results are from the groups inoculated with the 106 doses.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To identify genes associated with the later stages of S. enterica serovar Typhimurium infection of macrophages, mutants were selected that persisted inside macrophages at 24 h postinfection. This selection isolated a gene, sciS, which limits replication in host macrophages and decreases virulence in mice. The increase in bacterial numbers seen with an sciS mutant at 24 h postinfection was not observed in macrophages at 6 h postinfection or in epithelial cells at any time. In addition to sciS, several other genes were identified in this study that were primarily involved in DNA repair and propanediol metabolism. These genes were most likely selected because the mutations attenuated bacterial growth, preventing them from lysing their host cells.

There are homologs of sciS in several other gram-negative pathogens, but the first identified and best characterized is icmF in L. pneumophila. Recently, icmF was isolated in a screen for mutants that have a growth defect because of an inability to lyse out of their host macrophage at the end of an infection cycle (40). It is interesting that icmF was isolated in much the same way that sciS was identified by enriching pools of mutagenized bacteria in macrophages with gentamicin in the extracellular media. Previous studies have implicated icmF as being partially required for survival in human macrophages, which would seem to contradict the phenotype for sciS reported in this study. However, differences in the way the multiplication assays are performed can explain this discrepancy. Multiplication assays performed in L. pneumophila typically measure numbers of bacteria in the supernatant, while replication assays in S. enterica serovar Typhimurium typically measure only the bacteria residing intracellularly. A delay or inability of bacteria to escape their host phagosome would result in a decreased bacterial load in the supernatant. It is tempting to speculate that sciS could play this role in S. enterica serovar Typhimurium, and this would help explain the increased bacterial loads in infected macrophages. While there is an abundance of studies on S. enterica serovar Typhimurium-induced host cell killing, egress of the bacteria from the phagosome and events during the latter stages of infection of macrophages have not been studied extensively.

sciS was induced only in host cells and its expression peaked at 27 h postinfection, correlating well with the selection procedure and the increased bacterial loads seen only at 24 h of infection. Interestingly, sciS transcription is negatively regulated by SsrB, a two-component regulator that activates salmonella pathogenicity island 2 (SPI2) genes and additional genes outside of SPI2 that are primarily involved in promoting systemic infection of the host (4, 6, 13, 41, 43). Soon after uptake of S. enterica serovar Typhimurium in macrophages, SsrB is expressed and induces several proteins that facilitate intracellular replication (10, 36, 42). ssrB RNA levels are reduced later during infection of macrophages (J. Rue, unpublished data), leading to the derepression of sciS at 24 h postinfection. The early expression of SsrB and its subsequent downregulation possibly could help explain the delayed expression of SciS. Previously reported SsrB-regulated genes are activated, making this the first evidence for SsrB-mediated repression. However, it isn't clear if repression of sciS by SsrB is direct or if there are intermediate factors involved. SsrB facilitates S. enterica serovar Typhimurium survival and replication inside macrophages following uptake, and perhaps its subsequent downregulation allows sciS to be expressed, limiting the bacteria from overgrowing their host cell or allowing for escape from the vacuole.

To our knowledge, sciS is the first example of a gene involved in limiting intracellular replication of S. enterica serovar Typhimurium in macrophages. Previously, several genes were identified that prevent overgrowth of S. enterica serovar Typhimurium in fibroblasts (3). The master regulator PhoP-PhoQ had the most profound effect on controlling replication, which was unexpected because in other cell types, PhoP-PhoQ is associated with promoting survival and replication. These differences in replication were measured at 24 h postinfection, paralleling what was seen with sciS in macrophages. While S. enterica serovar Typhimurium replicates more efficiently in macrophages than in fibroblasts, our results provide evidence that sciS is involved in attenuating bacterial growth in host macrophages at later stages of infection.

It is important for pathogens to limit their effects upon the cells they infect in order to achieve a balance with their host. An example of this phenomenon on a cellular level of S. enterica serovar Typhimurium pathogenesis is demonstrated with its invasion process. S. enterica serovar Typhimurium injects SopE and SopE2 into epithelial cells to activate Cdc42 and Rac1 which induces ruffling and promotes uptake of the bacteria into host cells (16). Another secreted protein, SptP, reverses these effects to restore a normal actin cytoskeleton once the bacterium is inside of the cell (14). These proteins are delivered simultaneously in equal amounts; however, the SptP protein is degraded much more slowly than SopE, allowing it to reverse the effects of SopE (22). It is interesting that this process is temporally regulated, as a process set in motion by the bacterium can be purposely modulated at a later time. This is a recurring theme in pathogenesis and one that is further illustrated with sciS.

The attenuation of deleterious effects upon a host cell can be further extended to an animal model, as a sciS deletion showed an eightfold increase in lethality with a mouse model. This hypervirulent phenotype in mice was initially a surprise, given that almost all known S. enterica serovar Typhimurium mutations reduce virulence. Only two other S. enterica serovar Typhimurium mutations have been shown to increase virulence in mice (18, 28). A null mutation in grvA increased virulence, as measured by competitive index experiments in mouse spleens and small intestine. Interestingly, grvA is carried on the lamdoid phage Gifsy-2 near srfH, which was shown to be activated by the SsrAB regulon (42). However, it is not known whether SsrB regulates GrvA. Another study determined that inactivation of the dipeptidase pcgL led to an accumulation of D-Ala-D-Ala, which caused an increase in bacterial numbers in mouse liver and spleen 24 h postinoculation. The occurrence of the phenotype within 24 h of inoculation suggested that the accumulation of D-Ala-D-Ala somehow compromised the innate immune system leading to faster bacterial growth in host tissues. Both of these studies demonstrate that it is possible for an inactivated gene to lead to an increase in bacterial numbers in host tissues. Increased bacterial loads in a murine host would likely lead to more rapid sepsis and toxic shock, thus increasing lethality. The increased intracellular numbers observed in an sciS mutant appear to be consistent with this idea, as an sciS mutant is hypervirulent in orally infected mice. Most studies in bacterial pathogenesis are directed toward finding genes that promote virulence in the host. sciS is a unique example of a horizontally acquired gene that is temporally regulated and limits S. enterica serovar Typhimurium virulence.


    ACKNOWLEDGMENTS
 
This work was supported by Public Health Service grant AI022933 to F.H. from the National Institutes of Health.

We thank the OHSU Core Facility and Aurelie Snyder for sequencing and microscopy assistance. The Tn5 T-POP transposon was a kind gift from Kaoru Geddes. We thank members of the Heffron laboratory and Scott Wetzel for helpful comments on the manuscript.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Molecular Microbiology and Immunology, Oregon Health and Science University, 3181 SW Sam Jackson Park Rd., L220, Portland, OR 97201. Phone: (503) 494-6841. Fax: (503) 494-6862. E-mail: parsonsd{at}ohsu.edu. Back

Editor: F. C. Fang


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Blomfield, I. C., V. Vaughn, R. F. Rest, and B. I. Eisenstein. 1991. Allelic exchange in Escherichia coli using the Bacillus subtilis sacB gene and a temperature-sensitive pSC101 replicon. Mol. Microbiol. 5:1447-1457.[Medline]
2. Brennan, M. A., and B. T. Cookson. 2000. Salmonella induces macrophage death by caspase-1-dependent necrosis. Mol. Microbiol. 38:31-40.[CrossRef][Medline]
3. Cano, D. A., M. Martínez-Moya, M. G. Pucciarelli, E. A. Groisman, J. Casadesús, and F. García-Del Portillo. 2001. Salmonella enterica serovar Typhimurium response involved in attenuation of pathogen intracellular proliferation. Infect. Immun. 69:6463-6474.[Abstract/Free Full Text]
4. Chakravortty, D., I. Hansen-Wester, and M. Hensel. 2002. Salmonella pathogenicity island 2 mediates protection of intracellular Salmonella from reactive nitrogen intermediates. J. Exp. Med. 195:1155-1166.[Abstract/Free Full Text]
5. Chen, L. M., K. Kaniga, and J. E. Galan. 1996. Salmonella spp. are cytotoxic for cultured macrophages. Mol. Microbiol. 21:1101-1115.[CrossRef][Medline]
6. Cirillo, D. M., R. H. Valdivia, D. M. Monack, and S. Falkow. 1998. Macrophage-dependent induction of the Salmonella pathogenicity island 2 type III secretion system and its role in intracellular survival. Mol. Microbiol. 30:175-188.[CrossRef][Medline]
7. Das, S., A. Chakrabortty, R. Banerjee, and K. Chaudhuri. 2002. Involvement of in vivo induced icmF gene of Vibrio cholerae in motility, adherence to epithelial cells, and conjugation frequency. Biochem. Biophys. Res. Commun. 295:922-928.[CrossRef][Medline]
8. Das, S., A. Chakrabortty, R. Banerjee, S. Roychoudhury, and K. Chaudhuri. 2000. Comparison of global transcription responses allows identification of Vibrio cholerae genes differentially expressed following infection. FEMS Microbiol. Lett. 190:87-91.[CrossRef][Medline]
9. Das, S., and K. Chaudhuri. 2003. Identification of a unique IAHP (IcmF associated homologous proteins) cluster in Vibrio cholerae and other proteobacteria through in silico analysis. In Silico Biol. 3:287-300.[Medline]
10. Deiwick, J., T. Nikolaus, S. Erdogan, and M. Hensel. 1999. Environmental regulation of Salmonella pathogenicity island 2 gene expression. Mol. Microbiol. 31:1759-1773.[CrossRef][Medline]
11. Folkesson, A., A. Advani, S. Sukupolvi, J. D. Pfeifer, S. Normark, and S. Lofdahl. 1999. Multiple insertions of fimbrial operons correlate with the evolution of Salmonella serovars responsible for human disease. Mol. Microbiol. 33:612-622.[CrossRef][Medline]
12. Folkesson, A., S. Lofdahl, and S. Normark. 2002. The Salmonella enterica subspecies I specific centisome 7 genomic island encodes novel protein families present in bacteria living in close contact with eukaryotic cells. Res. Microbiol. 153:537-545.[Medline]
13. Freeman, J. A., C. Rappl, V. Kuhle, M. Hensel, and S. I. Miller. 2002. SpiC is required for translocation of Salmonella pathogenicity island 2 effectors and secretion of translocon proteins SseB and SseC. J. Bacteriol. 184:4971-4980.[Abstract/Free Full Text]
14. Fu, Y., and J. E. Galan. 1999. A Salmonella protein antagonizes Rac-1 and Cdc42 to mediate host-cell recovery after bacterial invasion. Nature 401:293-297.[CrossRef][Medline]
15. Garvis, S. G., C. R. Beuzon, and D. W. Holden. 2001. A role for the PhoP/Q regulon in inhibition of fusion between lysosomes and Salmonella-containing vacuoles in macrophages. Cell. Microbiol. 3:731-744.[CrossRef][Medline]
16. Hardt, W. D., L. M. Chen, K. E. Schuebel, X. R. Bustelo, and J. E. Galan. 1998. S. typhimurium encodes an activator of Rho GTPases that induces membrane ruffling and nuclear responses in host cells. Cell 93:815-826.[CrossRef][Medline]
17. Hersh, D., D. M. Monack, M. R. Smith, N. Ghori, S. Falkow, and A. Zychlinsky. 1999. The Salmonella invasin SipB induces macrophage apoptosis by binding to caspase-1. Proc. Natl. Acad. Sci. USA 96:2396-2401.[Abstract/Free Full Text]
18. Ho, T. D., and J. M. Slauch. 2001. Characterization of grvA, an antivirulence gene on the Gifsy-2 phage in Salmonella enterica serovar Typhimurium. J. Bacteriol. 183:611-620.[Abstract/Free Full Text]
19. Holden, D. W. 2002. Trafficking of the Salmonella vacuole in macrophages. Traffic 3:161-169.[CrossRef][Medline]
20. Hueffer, K., and J. E. Galan. 2004. Salmonella-induced macrophage death: multiple mechanisms, different outcomes. Cell. Microbiol. 6:1019-1025.[CrossRef][Medline]
21. Hughes, K. T., and J. R. Roth. 1988. Transitory cis complementation: a method for providing transposition functions to defective transposons. Genetics 119:9-12.[Abstract/Free Full Text]
22. Kubori, T., and J. E. Galan. 2003. Temporal regulation of Salmonella virulence effector function by proteasome-dependent protein degradation. Cell 115:333-342.[CrossRef][Medline]
23. Lindgren, S. W., I. Stojiljkovic, and F. Heffron. 1996. Macrophage killing is an essential virulence mechanism of Salmonella typhimurium. Proc. Natl. Acad. Sci. USA 93:4197-4201.[Abstract/Free Full Text]
24. Lundberg, U., U. Vinatzer, D. Berdnik, A. von Gabain, and M. Baccarini. 1999. Growth phase-regulated induction of Salmonella-induced macrophage apoptosis correlates with transient expression of SPI-1 genes. J. Bacteriol. 181:3433-3437.[Abstract/Free Full Text]
25. Meresse, S., K. E. Unsworth, A. Habermann, G. Griffiths, F. Fang, M. J. Martinez-Lorenzo, S. R. Waterman, J. P. Gorvel, and D. W. Holden. 2001. Remodelling of the actin cytoskeleton is essential for replication of intravacuolar Salmonella. Cell. Microbiol. 3:567-577.[CrossRef][Medline]
26. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
27. Monack, D. M., B. Raupach, A. E. Hromockyj, and S. Falkow. 1996. Salmonella typhimurium invasion induces apoptosis in infected macrophages. Proc. Natl. Acad. Sci. USA 93:9833-9838.[Abstract/Free Full Text]
28. Mouslim, C., F. Hilbert, H. Huang, and E. A. Groisman. 2002. Conflicting needs for a Salmonella hypervirulence gene in host and non-host environments. Mol. Microbiol. 45:1019-1027.[CrossRef][Medline]
29. Purcell, M., and H. A. Shuman. 1998. The Legionella pneumophila icmGCDJBF genes are required for killing of human macrophages. Infect. Immun. 66:2245-2255.[Abstract/Free Full Text]
30. Rappleye, C. A., and J. R. Roth. 1997. A Tn10 derivative (T-POP) for isolation of insertions with conditional (tetracycline-dependent) phenotypes. J. Bacteriol. 179:5827-5834.[Abstract/Free Full Text]
31. Reed, L. J., and H. Muench. 1935. A simple method of estimating fifty percent endpoints. Am. J. Hyg. 27:493-497.
32. Sarkar, M., and K. Chaudhuri. 2004. Association of adherence and motility in interleukin 8 induction in human intestinal epithelial cells by Vibrio cholerae. Microbes Infect. 6:676-685.[CrossRef][Medline]
33. Savli, H., A. Karadenizli, F. Kolayli, S. Gundes, U. Ozbek, and H. Vahaboglu. 2003. Expression stability of six housekeeping genes: a proposal for resistance gene quantification studies of Pseudomonas aeruginosa by real-time quantitative RT-PCR. J. Med. Microbiol. 52:403-408.[Abstract/Free Full Text]
34. Segal, G., M. Purcell, and H. A. Shuman. 1998. Host cell killing and bacterial conjugation require overlapping sets of genes within a 22-kb region of the Legionella pneumophila genome. Proc. Natl. Acad. Sci. USA 95:1669-1674.[Abstract/Free Full Text]
35. Sexton, J. A., J. L. Miller, A. Yoneda, T. E. Kehl-Fie, and J. P. Vogel. 2004. Legionella pneumophila DotU and IcmF are required for stability of the Dot/Icm complex. Infect. Immun. 72:5983-5992.[Abstract/Free Full Text]
36. Shea, J. E., C. R. Beuzon, C. Gleeson, R. Mundy, and D. W. Holden. 1999. Influence of the Salmonella typhimurium pathogenicity island 2 type III secretion system on bacterial growth in the mouse. Infect. Immun. 67:213-219.[Abstract/Free Full Text]
37. Shotland, Y., H. Kramer, and E. A. Groisman. 2003. The Salmonella SpiC protein targets the mammalian Hook3 protein function to alter cellular trafficking. Mol. Microbiol. 49:1565-1576.[CrossRef][Medline]
38. Sukhan, A., T. Kubori, J. Wilson, and J. E. Galán. 2001. Genetic analysis of assembly of the Salmonella enterica serovar Typhimurium type III secretion-associated needle complex. J. Bacteriol. 183:1159-1167.[Abstract/Free Full Text]
39. van der Velden, A. W. M., S. W. Lindgren, M. J. Worley, and F. Heffron. 2000. Salmonella pathogenicity island 1-independent induction of apoptosis in infected macrophages by Salmonella enterica serotype Typhimurium. Infect. Immun. 68:5702-5709.[Abstract/Free Full Text]
40. VanRheenen, S. M., G. Duménil, and R. R. Isberg. 2004. IcmF and DotU are required for optimal effector translocation and trafficking of the Legionella pneumophila vacuole. Infect. Immun. 72:5972-5982.[Abstract/Free Full Text]
41. Vazquez-Torres, A., Y. Xu, J. Jones-Carson, D. W. Holden, S. M. Lucia, M. C. Dinauer, P. Mastroeni, and F. C. Fang. 2000. Salmonella pathogenicity island 2-dependent evasion of the phagocyte NADPH oxidase. Science 287:1655-1658.[Abstract/Free Full Text]
42. Worley, M. J., K. H. Ching, and F. Heffron. 2000. Salmonella SsrB activates a global regulon of horizontally acquired genes. Mol. Microbiol. 36:749-761.[CrossRef][Medline]
43. Zaharik, M. L., B. A. Vallance, J. L. Puente, P. Gros, and B. B. Finlay. 2002. Host-pathogen interactions: host resistance factor Nramp1 up-regulates the expression of Salmonella pathogenicity island-2 virulence genes. Proc. Natl. Acad. Sci. USA 99:15705-15710.[Abstract/Free Full Text]
44. Zusman, T., M. Feldman, E. Halperin, and G. Segal. 2004. Characterization of the icmH and icmF genes required for Legionella pneumophila intracellular growth, genes that are present in many bacteria associated with eukaryotic cells. Infect. Immun. 72:3398-3409.[Abstract/Free Full Text]


Infection and Immunity, July 2005, p. 4338-4345, Vol. 73, No. 7
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.7.4338-4345.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parsons, D. A.
Right arrow Articles by Heffron, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parsons, D. A.
Right arrow Articles by Heffron, F.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals