Previous Article | Next Article ![]()
Infection and Immunity, January 2006, p. 382-389, Vol. 74, No. 1
0019-9567/06/$08.00+0 doi:10.1128/IAI.74.1.382-389.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Laboratório de Biologia Molecular, Instituto de Ciências Biológicas, Universidade Federal de Goiás, Goi
nia, Goiás, Brazil,1
Universidade de Brasília, Distrito Federal, Brazil,2
Universidade Estadual Júlio de Mesquita Filho, Araraquara, São Paulo, Brazil,3
Universidade Federal de São Paulo, São Paulo, Brazil4
Received 1 September 2005/ Returned for modification 14 September 2005/ Accepted 24 October 2005
|
|
|---|
|
|
|---|
The development of PCM depends on interactions between fungal and host components. P. brasiliensis can parasitize various tissues. The ability of pathogens to bind to components of the extracellular matrix (ECM) has been described as an important mechanism in the invasion of host tissues (18, 21). Just as with many pathogenic microorganisms, adhesion of P. brasiliensis to the host surface is thought to be a crucial step in the pathogenic process and a prerequisite for host colonization. P. brasiliensis expresses proteins that interact in various ways with the extracellular environment. For instance, the glycoprotein gp43 has been described as a mediator molecule in the binding of P. brasiliensis to laminin (37). A 30-kDa protein which is highly expressed in P. brasiliensis isolated from animals, presenting a high capacity to adhere to and invade Vero cells, has properties of an adhesin (2). A protein of 32 kDa present in the cell wall and characterized as a hypothetical molecule from P. brasiliensis was recently described as able to interact with the ECM components (17). Despite those few descriptions, the regulation and mechanistic details of P. brasiliensis in vitro and in vivo cellular adhesion and infection remain poorly understood.
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) constitutes a protein family which displays diverse activities in different subcellular locations, in addition to its well-characterized role in glycolysis (35). Specific intracellular interactions seem to be related to the new activities of GAPDH. Accordingly, membrane-bound GAPDH of group A streptococci has been reported to bind fibronectin, lysozyme, and the cytoskeletal proteins myosin and actin, indicating that it may function in the colonization of those bacteria (30). Also, GAPDH of Streptococcus oralis was described as a dominant receptor for Porphyromonas gingivalis fimbriae, contributing to host colonization by the latter microorganism (24).
Cell wall-associated GAPDHs have been described for fungi. With Candida albicans, it has been demonstrated that an immunogenic and enzymatically active GAPDH is found at the cell surface (16) and that clinical strains express this surface antigen both in vitro and in infected tissues (15). In addition, the cell wall-associated GAPDH of C. albicans is a fibronectin and laminin binding protein (19). Proteomic and biochemical analysis indicated that GAPDH is also a cell surface plasminogen binding protein of C. albicans, which could potentially increase the fungus capacity for tissue invasion and necrosis (8).
We have previously identified by immunoproteomic sequencing and microsequencing of peptides two isoforms of 36 kDa, with pIs of 6.8 and 7.0, of the P. brasiliensis GAPDH (3, 13). We have also characterized the cDNA and genomic clones encoding the homologue of GAPDH. We have previously provided insights into the structure, function, and potential regulation of GAPDH, a single-copy gene of P. brasiliensis which is conserved across species. We have also demonstrated that the expression of GAPDH and its transcript are more abundant in the parasitic yeast phase of P. brasiliensis (3). According to these data, this protein seems to play a role in the fungus parasitic yeast phase and thus should be better characterized.
In the present study, we report the heterologous overexpression of P. brasiliensis recombinant GAPDH and its purification. In addition, we demonstrate for the first time the presence of this protein in the glycolytic pathway in the cell wall of P. brasiliensis. We have also demonstrated that cell wall-associated GAPDH is able to bind to extracellular matrix components. The protein seems to mediate the processes of adherence and internalization of P. brasiliensis to in vitro-cultured cells, as suggested by the abilities of the anti-GAPDH polyclonal antibody and the recombinant protein to interfere with both processes. These data suggest that GAPDH may play a role in mediating the attachment and internalization of the fungus to host tissues, potentially playing a role in the establishment of disease.
|
|
|---|
Cloning cDNA containing the complete coding region of GAPDH into expression vector. The cloned cDNA containing the complete coding region of GAPDH (GenBank accession number AY061958) (3) was amplified by PCR using oligonucleotide sense (5' CACCATGGTCGTCAAGGTTGG 3') and antisense (5' GCTGCGAATTCCTATTTGCCAGC 3') primers. The sequence CACC (underlined) was incorporated at the 5' end of the sense primer. The amplification parameters were as follows: an initial denaturation step at 94°C for 2 min, followed by 30 cycles of denaturation at 94°C for 15 s, annealing at 55°C for 30 s, and extension at 68°C for 1 min and 30 s. A final elongation step was performed at 68°C for 1 min. The resulting 1,000-bp product was subcloned into the TOPO pET100 expression vector (Invitrogen, Life Technologies) to yield the TOPO-pET100-GAPDH construct. The recombinant plasmid was used to transform Escherichia coli XL1-Blue competent cells by the heat shock method (34). Ampicillin-resistant transformants were cultured, and plasmid DNA was analyzed by PCR.
Heterologous expression of P. brasiliensis GAPDH and recombinant protein purification. Bacteria transformed with the TOPO-pET-100-GAPDH construct were grown in LB medium supplemented with ampicillin (100 µg/ml) at 37°C until the optical density at 600 nm reached 0.6. Synthesis of the recombinant protein was then initiated by adding IPTG (isopropyl-ß-D-thiogalactopyranoside) to a final concentration of 0.8 mM to the growing culture. After 2 h, the bacterial cells were harvested by centrifugation at 3,000 x g and lysis was achieved by incubation of the cells with guanidinium lysis buffer (6 M guanidine hydrochloride, 20 mM NaPO4, pH 7.8, 500 mM NaCl) and sonication. The recombinant protein containing the His tag at its N-terminal end was purified on Ni-nitrilotriacetic acid resin (Invitrogen) under hybrid conditions, as follows. The cell lysate was passed through a Ni-nitrilotriacetic acid column equilibrated with denaturing binding buffer (8 M urea, 20 mM NaPO4, pH 7.8, 500 mM NaCl). The column was washed sequentially with denaturing binding buffer, denaturing wash buffer (8 M urea, 20 mM NaPO4, pH 6.0, 500 mM NaCl), and finally native wash buffer (50 mM NaPO4, 0.5 M NaCl, 20 mM imidazole). The bound proteins were eluted with native elution buffer (40 mM NaPO4, 0.4 M NaCl, 600 mM imidazole) to refold the protein, by following the manufacturer's instructions. The purity and size of the protein were evaluated by running the purified molecule through 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by Coomassie blue staining.
Antibody production. The purified recombinant GAPDH was used to generate specific rabbit polyclonal serum. Rabbit preimmune serum was obtained and stored at 20°C. The purified protein (300 µg) was injected into rabbit with Freund's adjuvant three times at 2-week intervals. The obtained serum, containing monospecific anti-GAPDH polyclonal antibodies, was sampled and stored at 20°C.
Preparation of P. brasiliensis cell extracts.
Yeast and mycelium protein crude extracts were obtained by disruption of frozen cells in the presence of protease inhibitors N
-p-tosyl-L-lysine chloromethyl ketone (TLCK) (50 µg/ml), 4-chloromercuribenzoic acid (1 mM), leupeptin (20 mM), phenylmethylsulfonyl fluoride (20 mM), and iodoacetamide (5 mM) in homogenization buffer (20 mM Tris-HCl, pH 8.8, 2 mM CaCl2). The mixture was centrifuged at 12,000 x g at 4°C for 10 min, and the supernatant was used for further analysis of proteins by one-dimensional gel electrophoresis.
Obtaining cell extracts. Cell extracts were prepared from yeast cells, as described elsewhere (2, 5). In brief, yeast cells of P. brasiliensis were grown for 7 days in solid medium as described above. Cells (300 mg) were resuspended in 1.0 ml of 10 mM phosphate-buffered saline (PBS), pH 7.2, and vortexed for 30 s. The cells were centrifuged for 1 min at 560 x g, and the supernatant was collected and used for further analysis.
Electrophoretic analysis. Electrophoresis of native proteins and SDS-PAGE were performed according to O'Farrell (29) and Laemmli (23), respectively. The proteins were precipitated by addition of 10% (wt/vol) trichloroacetic acid, and the pellets were washed in 10% (vol/vol) cold acetone. The samples were resuspended in lysis buffer containing 9.5 M urea, 2% (vol/vol) Nonidet P-40, 5% (vol/vol) ß-mercaptoethanol, and ampholines at pH ranges of 5.0 to 8.0 and 3.5 to 10.0 (ratio 4:1). The proteins were Coomassie blue or silver stained.
Western blot analysis. The protein extracts were resolved by one- or two-dimensional gel electrophoresis. The proteins were electrophoretically transferred to a nylon membrane and checked by Ponceau S to determine equal loading. GAPDH was detected with the polyclonal antibody raised to the recombinant protein. After reaction with alkaline phosphatase anti-rabbit immunoglobulin G (IgG), the reaction was developed with 5-bromo-4-chloro-3-indolylphosphate-nitroblue tetrazolium (BCIP-NBT). Negative controls were obtained with rabbit preimmune serum.
Transmission electron microscopy of P. brasiliensis yeast cells and immunocytochemistry of the GAPDH protein. Yeast cells of P. brasiliensis were fixed overnight at 4°C in solution containing 2% (vol/vol) glutaraldehyde, 2% (wt/vol) paraformaldehyde, and 3% (wt/vol) sucrose in 0.1 M sodium cacodylate buffer at pH 7.2. After fixation, the yeast cells were rinsed in the same buffer and postfixed for 1 h in solution containing 1% (wt/vol) osmium tetroxide, 0.8% (wt/vol) potassium ferricyanide, and 5 mM CaCl2 in sodium cacodylate buffer, pH 7.2. The material was dehydrated in a series of ascending acetones (30 to 100%) (vol/vol) and embedded in Spurr resin (Electron Microscopy Sciences, Washington, Pa.). Ultrathin sections were stained with uranyl acetate, 3% (wt/vol), and lead citrate (33). The material was observed with a Jeol 1011 transmission electron microscope (Jeol, Tokyo, Japan).
For ultrastructural immunocytochemistry studies, yeast cells were fixed in a mixture containing 4% (wt/vol) paraformaldehyde, 0.5% (vol/vol) glutaraldehyde, and 0.2% (wt/vol) picric acid in 0.1 M sodium cacodylate buffer at pH 7.2 for 24 h at 4°C. The cells were rinsed several times using the same buffer, and free aldehyde groups were quenched with 50 mM ammonium chloride for 1 h, followed by block staining in solution containing 2% (wt/vol) uranyl acetate in 15% (vol/vol) acetone for 2 h at 4°C (4). The material was dehydrated in a series of ascending concentrations of acetone (30 to 100%) (vol/vol) and embedded in LR Gold resin (Electron Microscopy Sciences, Washington, Pa.).
The ultrathin sections were collected on nickel grids, preincubated in 10 mM PBS containing 1.5% (wt/vol) bovine serum albumin (BSA) and 0.05% (vol/vol) Tween 20, (PBS-BSA-T), and subsequently incubated for 1 h with the polyclonal antibody against the recombinant GAPDH (diluted 1:100). After being washed with PBS-BSA-T, the grids were incubated for 1 h with the labeled secondary antibody (rabbit IgG, Au conjugated, 10 nm; diluted 1:20). Subsequently, the grids were washed with the buffer described above, followed by a wash with distilled water; stained with uranyl acetate, 3% (wt/vol), and lead citrate (33); and observed with a Jeol 1011 transmission electron microscope (Jeol, Tokyo, Japan). Controls were incubated with rabbit preimmune serum at 1:100, followed by incubation with the labeled secondary antibody.
The gold particles were quantified in five independent preparations of yeast cells. The particles were counted in total cell distribution, as well as in the cell wall and cytoplasm. Results were expressed as the number of gold particles, represented as the means of the counts performed three times with standard deviations included.
Affinity ligand assays. Far-Western assays were carried out as previously described (20). Recombinant GAPDH was submitted to SDS-PAGE and blotted onto nitrocellulose membranes. Blotted protein was assayed for laminin, fibronectin, and type I collagen binding as follows. After being blocked overnight with 1.5% (wt/vol) BSA in 10 mM PBS, the membranes were incubated with laminin (30 µg/ml), fibronectin (30 µg/ml), or type I collagen (20 µg/ml) diluted in PBS-BSA-T for 90 min and then washed three times (for 10 min each time) in 10 mM PBS containing 0.05% (vol/vol) Tween 20 (PBS-T). The membranes were incubated for 1 h with rabbit antibodies antilaminin, antifibronectin, or anti-type I collagen in PBS-BSA-T (diluted 1:100). The blots were washed with PBS-T and incubated with peroxidase-labeled goat anti-rabbit immunoglobulin (diluted 1:1,000). The blots were washed with PBS-T, and the reactive bands were developed with hydrogen peroxide and diaminobenzidine (Sigma-Aldrich Co.) as the chromogenic reagent. As controls, the blots were incubated only with antilaminin, antifibronectin, and anti-type I collagen antibodies, in the absence of the ECM proteins (laminin, fibronectin, and type I collagen). The positive control was obtained by incubating the recombinant GAPDH with the anti-GAPDH polyclonal antibody (diluted 1:500), and the reaction was developed as described above. Additional controls were obtained with BSA fractionated by SDS-PAGE, blotted onto nitrocellulose membranes, and incubated with the ECM proteins and the respective antibodies, as described above.
Binding assays of the recombinant GAPDH to pneumocytes. Type II pneumocyte line A549 was obtained from the American Type Culture Collection (Manassas, VA). The cells were seeded overnight in Dulbecco's modified Eagle's medium (DMEM) and supplemented with 10% (vol/vol) heat-inactivated fetal calf serum. The cells were washed three times with 10 mM PBS, and DMEM not containing fetal calf serum was added. Monolayers of cells were incubated with 50 µg/ml of recombinant GAPDH at 37°C for 5 h and washed with 10 mM PBS to remove unbound protein. Next, double-distilled water was added and the cells were incubated for 4 h at room temperature to obtain total lysis. The lysates were centrifuged at 1,400 x g for 5 min, and the supernatant was submitted to SDS-PAGE. Proteins in the gel were transferred to membranes and incubated overnight with blocking buffer (PBS-BSA-T). The secondary antibody was alkaline phosphatase coupled with anti-rabbit IgG (Sigma-Aldrich Co.). The reactions were developed with BCIP-NBT. Negative controls were obtained by analyzing the supernatant of lysed pneumocytes not preincubated with the recombinant protein GAPDH, as well as by coating the cell culture flask with 50 µg/ml of GAPDH.
Interaction of P. brasiliensis with in vitro-cultured pneumocytes: inhibition of adherence and infection by GAPDH and by the antibody anti-GAPDH. A549 pneumocytes were incubated for 1 h at 37°C with the recombinant GAPDH protein (25 µg/ml), diluted in 10 mM PBS. After this incubation period, the cells were washed three times in DMEM and 108 yeast forms of P. brasiliensis were added to the epithelial cells. Incubation was performed for 2 and 5 h at 37°C to allow the processes of adhesion and infection, respectively, as described previously (2, 22, 27). Additionally, 108 yeast cells of P. brasiliensis were incubated for 1 h at 37°C with the polyclonal antibody anti-GAPDH (diluted 1:100). After that, the cells were washed three times in 10 mM PBS and allowed to interact with the A549 pneumocytes. Control experiments were performed with A549 cells not preincubated with the recombinant GAPDH protein, P. brasiliensis yeast cells not preincubated with the anti-GAPDH antibody, and pneumocytes preincubated with BSA (25 µg/ml). The percentages of infected cells were determined by randomly counting a minimum of 300 cells on each triplicate coverslip. The adhesion and infection indices were calculated as described previously (11, 27). Results are presented as the means of counts performed three times with standard deviations included. The adhesion index was obtained by multiplying the mean number of attached yeast cells per pneumocyte by the percentage of infected cells. The infection index (adherence plus internalization) was determined by the number of total fungi interacting with the epithelial cells 5 h after addition of the yeast cells, as previously described (22, 27). All experiments were performed in triplicate.
Statistical analysis. The means and standard deviations of at least three distinct experiments were determined. Statistical analysis was performed by using analysis of variance (F test followed by Duncan test). P values of 0.05 or less were considered statistically significant.
|
|
|---|
![]() View larger version (28K): [in a new window] |
FIG. 1. Expression and purification of recombinant GAPDH and generation of rabbit polyclonal antibody. (A) SDS-PAGE analysis of P. brasiliensis recombinant GAPDH. E. coli cells harboring the TOPO-pET-100 GAPDH plasmid were grown at 37°C to an A600 of 0.6 and harvested before (lane 2) and after (lane 3) a 2-h incubation with 0.8 mM IPTG. The cells were lysed by extensive sonication. Lane 1, control E. coli cells; lane 4, affinity-isolated GAPDH. SDS-12% PAGE was carried out, and the proteins were stained by Coomassie blue R-250. (B) Electrophoretic analysis of P. brasiliensis proteins and recombinant GAPDH. The protein extracts were fractionated by one-dimensional gel electrophoresis and stained by Coomassie blue. Lane 1, protein extracts from yeast cells (30 µg); lane 2, protein extracts from mycelium (30 µg); lane 3, recombinant GAPDH (2.0 µg). (C and D) Western blot analysis of native and recombinant GAPDH. The same samples as for panel B were run in parallel, blotted onto a nitrocellulose membrane, and detected by using (C) rabbit polyclonal anti-recombinant GAPDH antibody or (D) rabbit preimmune serum. After reactions with the anti-rabbit IgG alkaline phosphatase-coupled antibody (diluted 1:1,000), the reactions were developed with BCIP-NBT. Molecular size markers are indicated.
|
Detection of GAPDH protein in P. brasiliensis cell extracts. The cell extracts of yeast cells were analyzed by two-dimensional gel electrophoresis (Fig. 2A). The characterized isoforms of GAPDH, with pIs of 6.8 and 7.0, are shown in this cellular fraction. The polyclonal antibody was used for immunodetection of the native GAPDH. This antibody recognized both isoforms of the native protein in the cell extracts, which correspond to the most superficial components of the cell wall (Fig. 2B).
![]() View larger version (26K): [in a new window] |
FIG. 2. Two-dimensional gel electrophoresis of P. brasiliensis cell extracts. Cell extracts from yeast cells of P. brasiliensis were obtained, and 50 µg of total proteins was loaded on two-dimensional gels. (A) SDS-PAGE gel stained with silver. (B) Reactivity of the GAPDH isoforms analyzed by Western blotting with the polyclonal antibody produced to the recombinant protein. Arrows point to the two characterized isoforms of GAPDH. Numbers to the left of both figures refer to the molecular mass of the characterized GAPDH. At the top are indicated the isoelectric points of both protein isoforms.
|
![]() View larger version (118K): [in a new window] |
FIG. 3. Immunoelectron microscopy detection of GAPDH in P. brasiliensis yeast cells. (A) Transmission electron microscopy of P. brasiliensis yeast cells, showing the nucleus (n), intracytoplasmic vacuoles (v), and mitochondria (m). The plasma membrane (arrow) and cell wall (w) are also shown. (B and C) Gold particles (arrowheads) are observed at the fungus cell wall (w) and in the cytoplasm (double arrowheads). (D) Negative control exposed to the rabbit preimmune serum. Bars, 1 µm (A), 0.5 µm (B and D), and 0.2 µm (C).
|
![]() View larger version (11K): [in a new window] |
FIG. 4. Mean gold labeling of yeast cells of P. brasiliensis. Results, which are representative of five independent preparations, are expressed as the mean gold particles in total cells, cell wall, and cytoplasm. *, P of <0.05 in a comparison of gold labeling in the cell wall and cytoplasm. Vertical bars indicate standard deviations.
|
![]() View larger version (23K): [in a new window] |
FIG. 5. Binding of P. brasiliensis recombinant GAPDH to extracellular matrix components and to pneumocytes in culture. (A) Recombinant GAPDH (0.5 µg) was subjected to SDS-PAGE and electroblotted. Membranes were reacted with laminin (lane 1), fibronectin (lane 2), and type I collagen (lane 3) and subsequently incubated with rabbit IgG antilaminin, antifibronectin, and anti-type I collagen antibodies, respectively. Use of peroxidase-conjugated anti-rabbit IgG revealed the reactions. The positive control was obtained by incubating the recombinant protein with anti-GAPDH polyclonal antibody (lane 4). (B) Recombinant GAPDH (0.5 µg) was subjected to SDS-PAGE and electroblotted. The membranes were reacted with rabbit IgG antilaminin, antifibronectin, and anti-type I collagen antibodies (lanes 1, 2, and 3, respectively). The recombinant protein was incubated just with the secondary antibody, peroxidase-labeled goat anti-rabbit IgG (lane 4). (C) BSA (0.5 µg) was subjected to SDS-PAGE and electroblotted. The membranes were reacted with laminin (lane 1), fibronectin (lane 2), and type I collagen (lane 3) and subsequently incubated with rabbit IgG antilaminin, antifibronectin, and anti-collagen type I antibodies, respectively. Use of peroxidase-conjugated anti-rabbit IgG revealed the reaction. BSA was incubated with anti-GAPDH polyclonal antibody, and the reaction was revealed by using anti-rabbit IgG alkaline phosphatase-coupled antibody (lane 4). (D) Cultured type II pneumocytes were incubated with 50 µg of recombinant GAPDH for 5 h at 37°C. After being washed with PBS to remove the unbound protein, the cells were lysed and the supernatant was fractionated by SDS-PAGE. After transference to membranes, immunodetection was performed by incubation with rabbit anti-GAPDH polyclonal antibody. After incubation with alkaline phosphatase-coupled anti-rabbit IgG, the reaction was developed with BCIP-NBT. Lane 1, supernatant of pneumocytes incubated with recombinant GAPDH; lane 2, pneumocytes not incubated with recombinant GAPDH; lane 3, recombinant protein added to the cell culture flask.
|
Inhibition of P. brasiliensis infection of pneumocytes, caused by recombinant GAPDH and by the polyclonal antibody anti-GAPDH. The infection index was determined by interactions between P. brasiliensis yeast cells and A549 pneumocytes, as shown in Fig. 6. P. brasiliensis yeast cells were treated with the antibody anti-GAPDH prior to interaction with the pneumocytes, or pneumocytes were treated with recombinant GAPDH prior to the interaction with P. brasiliensis. The controls (nontreated cells) were used to calculate the percentages of both adhesion and infection inhibitions. When P. brasiliensis yeast cells were incubated with the anti-GAPDH polyclonal antibody, a decrease of 63% in the adhesion index (P < 0.05) was observed to occur. Similarly, when the pneumocytes were treated with recombinant GAPDH the adhesion index was reduced by 68% (P < 0.05) compared to the values of nontreated cells (Fig. 6A). Additionally, the infection index was decreased by 80% (P < 0.0001) when P. brasiliensis yeast cells were treated with the anti-GAPDH polyclonal antibody and by 97% (P < 0.0001) when pneumocytes were treated with the recombinant protein (Fig. 6B). Controls were performed by incubating the pneumocytes with BSA prior to the addition of yeast cells (Fig. 6A and B).
![]() View larger version (10K): [in a new window] |
FIG. 6. Interaction of P. brasiliensis yeast forms with pneumocytes. Yeast cells were pretreated for 1 h with anti-GAPDH polyclonal antibody (diluted 1:100). In addition, A549 cells were pretreated for 1 h with 25 µg/ml of recombinant GAPDH. As a control, pneumocytes were pretreated for 1 h with 25 µg/ml of BSA. (A) Adhesion of P. brasiliensis to pneumocytes was analyzed 2 h after the treatments. (B) Infection (adhesion plus internalization) of P. brasiliensis to pneumocytes was analyzed 5 h after the treatments. Black bars, control; dark gray bars, P. brasiliensis cells treated with anti-GAPDH polyclonal antibody; light gray bars, pneumocytes treated with recombinant GAPDH; white bars, pneumocytes treated with BSA. The adhesion and infection index values represent the means ± standard deviations of three independent experiments. One asterisk denotes values statistically different from the control (P < 0.05), and two asterisks denote significance at a P value of <0.0001. Vertical bars indicate standard deviations.
|
|
|
|---|
To gain a better understanding of the host-parasite relationships with P. brasiliensis, we have demonstrated in this work that the P. brasiliensis GAPDH, previously characterized by microsequencing of its N terminus and of endoproteinase Lys-C digested peptides (3, 13), is located at the fungus cell wall. Western blot analysis of the cell extracts that correspond to the most superficial components of the fungal cell wall (5) was initially employed to define the cellular localization of GAPDH at the fungus cell wall. Subsequently, the polyclonal antibody produced against recombinant GAPDH allowed the definition of the protein subcellular localization by immunoelectron microscopy. In addition to its intracellular location, GAPDH was detected at the outermost layer of the cell wall in yeast forms of P. brasiliensis, in larger amounts than in the cytoplasm compartment. Cell surface expression of cytosolic enzymes is becoming increasingly recognized on the surfaces of both eukaryotic and prokaryotic cells (16, 30). The presence of GAPDH at the yeast cell surface of P. brasiliensis poses interesting questions, such as how its incorporation into the cell wall takes place in the absence of a conventional N-terminal signal sequence responsible for targeting the protein into the classical secretory pathway. In this sense, unusual signal sequences as well as unusual secretory pathways had been proposed for GAPDH. It has been shown that the N-terminal half of the C. albicans GAPDH polypeptide encoded by the TDH3 gene is able to direct its incorporation into the yeast cell wall (9). More studies are needed to identify putative signals related to P. brasiliensis cell wall targeting. Another interesting point is the larger amount of gold particles in the cell wall of the yeast form than in the cytoplasm compartment. It has been demonstrated that temperature upshift is one factor that can cause an increase in enzymatically active cell wall-associated GAPDH in Saccharomyces cerevisiae (10). The temperature experienced by the yeast cells of P. brasiliensis during the infective process has to be investigated to analyze the distribution of GAPDH in this organism.
A critical first step in the establishment of infection by pathogens is the attachment to host components. The recognition of host cells by the pathogen requires the presence of complementary molecules at the surface of the host cells. Some types of adhesins that interact with receptors seem to exist in a number of different pathogens, and host ECM components are of great importance in the modulation of migration, invasion, differentiation, and microbial proliferation. Thus, host proteins such as laminin, collagen, fibronectin, and fibrinogen have been proposed as the microbial cell ligands (31). Several molecules that are present in the ECM may be involved in the adhesion of P. brasiliensis. For this reason, it has been known for some time that P. brasiliensis exhibits affinity for laminin, fibronectin, and fibrinogen (1, 2, 17, 37).
Here, we introduce the adhesin properties of the cell wall-associated glycolytic enzyme GAPDH. A direct demonstration that surface GAPDH is involved in the interaction of P. brasiliensis with laminin, fibronectin, and type I collagen was obtained by adhesion experiments of those molecules to immobilized GAPDH. Laminin and fibronectin are candidate ligands which could mediate adherence of fungal pathogens to host tissues (26, 36). Moreover, epithelial damage caused by pathogens can lead to exposure of subepithelial basement membrane, increasing the accessibility of laminin, type IV collagen, and afterwards that of fibronectin and type I collagen present in the interstitial space to pathogens (6). If the fungus gains access to the intravascular space, it encounters fluid fibronectin. For PCM, it has been described that for the invasive process to start, P. brasiliensis has to attach to and pass through the basal membrane to reach blood and lymph capillaries (28). In this context, the binding of GAPDH to laminin, fibronectin, and type I collagen could elect the molecule as a putative virulence factor which could enhance the fungus invasiveness potential.
Studies have demonstrated the capacity of P. brasiliensis for adhesion and invasion (2, 22, 27). The GAPDH of P. brasiliensis seems to play a role in the early stages of the fungal infection. Both the treatment of pneumocytes with GAPDH and the incubation of P. brasiliensis yeast cells with the polyclonal anti-GAPDH antibody resulted in inhibition of adhesion and infection of the epithelial cells by P. brasiliensis. The results showed that the presence of the anti-GAPDH antibody resulted in 63% and 80% reductions, respectively, in the ability of P. brasiliensis to adhere to and infect pneumocytes. In addition, the treatment of those cells with recombinant GAPDH resulted, respectively, in 68% and 97% reductions in the fungus abilities of binding and infection. All of the data suggest the concept that GAPDH likely plays a role in P. brasiliensis adherence and colonization, triggering host cell processes involved in the pathogenesis of this fungal infection. Our data may lead to a better comprehension of P. brasiliensis interactions with host tissues and of PCM pathogenesis.
We thank Juliana Leal Monteiro da Silva for the helpful comments on the manuscript.
nia, Goiás, Brazil, 74001-970. Phone: 55-62-3521-1110. Fax: 55-62-3521-1110. E-mail: celia{at}icb.ufg.br. |
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»