IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schwan, W. R.
Right arrow Articles by McCormick, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schwan, W. R.
Right arrow Articles by McCormick, J.
Infection and Immunity, January 2006, p. 399-409, Vol. 74, No. 1
0019-9567/06/$08.00+0     doi:10.1128/IAI.74.1.399-409.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Transcriptional Activation of the Staphylococcus aureus putP Gene by Low-Proline-High Osmotic Conditions and during Infection of Murine and Human Tissues

William R. Schwan,1* Lynn Lehmann,1 and James McCormick2

University of Wisconsin—La Crosse, La Crosse, Wisconsin,1 Gundersen Lutheran Hospital, La Crosse, Wisconsin2

Received 15 July 2005/ Returned for modification 15 August 2005/ Accepted 19 October 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Staphylococcus aureus can grow virtually anywhere in the human body but needs to import proline through low- and high-affinity proline transporters to survive. This study examined the regulation of the S. aureus putP gene, which encodes a high-affinity proline permease. putP::lacZ and putP::lux transcriptional fusions were constructed and integrated into the genomes of several S. aureus strains. Enzyme activity was measured after growth in media with various osmolyte concentrations. As osmolarity rose, putP expression increased, with a plateau at 2 M for NaCl in strain LL3-1. Proline concentrations as low as 17.4 µM activated expression of the putP gene. The putP::lux fusion was also integrated into the genomes of S. aureus strains that were either SigB inactive (LL3-1, 8325-4, and SH1003) or SigB active (Newman and SH1000). SigB inactive strains showed increased putP gene expression as NaCl concentrations rose, whereas SigB active strains displayed a dramatic decrease in putP expression, suggesting that the alternative sigma factor B plays a negative role in putP regulation. Mice inoculated with S. aureus strains containing the putP::lux fusion exhibited up to a 715-fold increase in putP expression, although levels in the various murine organs differed. Moreover, urine from human patients infected with S. aureus showed elevated putP levels by use of a PCR procedure, whereas blood and some abscess material had no significant increase. Thus, putP is transcriptionally activated by a low-proline and high osmotic environment both in growth media and in murine or human clinical specimens.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The species Staphylococcus aureus is a significant cause of morbidity and mortality in humans and animals. With the rise of antibiotic-resistant strains (e.g., methicillin- and vancomycin-resistant strains), treatments for this common pathogen are increasingly problematic (5, 6, 7, 24, 29, 47). This species is able to infect virtually every tissue in the human body (14), but little is known about the metabolic changes within the bacteria found in vivo during this time. To survive in the human body, some strains of S. aureus need to import proline because of proline auxotrophy (17). This species has at least two transport systems to import proline into the cell, a low-affinity system that may be linked to a proP homolog gene and a high-affinity system encoded by the putP gene (2, 37, 49, 51).

In many bacteria, proline is needed as an osmoprotectant in growth environments with high osmotic stress (52). Several proline transporters within the bacteria serve to bring proline into the bacterial cell. A review of gram-negative bacteria has demonstrated that at least three proline transporters are able to transport proline into the bacterial cell; these include the low-affinity ProP and ProU proteins as well as the high-affinity PutP protein (52). Similar proteins have also been identified for gram-positive bacteria, such as Bacillus subtilis (48, 50).

The putP gene, encoding the high-affinity proline transporter, has been identified for S. aureus, and some characterization of the role of PutP in proline transport (45, 46, 51) and survival during animal infections (3, 45, 46) has been performed. Because most S. aureus strains are proline auxotrophs, there may be a dual need for proline: as a source for carbon and nitrogen and as an osmoprotectant. Human (21, 22) and animal (13, 45) specimens typically contain low proline concentrations. Moreover, our prior examination of the putP gene has demonstrated that proline transport is a key part of S. aureus survival in tissues that are low in proline (3, 45, 46), suggesting that proline transport itself is a vital cog in the survival and growth of S. aureus during human infection.

For gram-negative bacterial species, the regulation of the putP gene has been examined (18, 30, 32, 38), but only limited analyses of putP regulation have been done for gram-positive bacterial species (36, 48, 50). Presently, no study has looked at the transcriptional regulation of the putP gene in S. aureus.

In this study, we tested whether the concentration of either proline or specific osmolytes affected transcription of the S. aureus putP gene. The putP promoter region of the S. aureus strain RN6390 genome was ligated to promoterless lacZ and lux operons, and these fusions were eventually moved into the genome of S. aureus. Strains with the putP::lacZ or putP::lux fusion were tested in media with various concentrations of either proline or an osmolyte (e.g., NaCl, sorbitol, or sucrose). In addition, murine models of infection were utilized to examine putP expression in S. aureus infecting various organs. Moreover, human clinical samples containing S. aureus were processed to determine whether transcriptional activation of the putP gene occurred in the S. aureus cells found in those clinical samples.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial strains and plasmids. A list of strains is shown in Table 1. Escherichia coli strain DH5{alpha} was used for construction of the initial putP::lacZYA fusion, strain SOLR was used for plasmid transformation, and strain MC4100 was used for the E. coli ß-galactosidase assays. Staphylococcus aureus strain RN4220 was used for growth medium characterization of the putP gene in S. aureus, and S. aureus strains RN6390 (35) and Newman (34) (the latter provided by Jean Lee, Channing Laboratory, Boston, MA) were used for characterization of putP gene expression in murine models of infection. Strains 8325-4 (provided by Jean Lee) as well as SH1000 and SH1003 (provided by Simon Foster, Sheffield University) (19) were used to assess the role of SigB in putP regulation. Plasmid pPWC-1 (Karen Miller, Penn State University, College Station, PA) (51) was utilized as the template for PCR amplification of the putP promoter region. The pUJ9 plasmid (11) served as the source for the promoterless lacZYA operon. Shuttle vector pMOD-1 (9, 46) served as the backbone vector for the putP::lacZYA fusion, which was then shuttled between E. coli and S. aureus. The promoterless lux operon was provided by the pXen5 plasmid (Xenogen Corp, Alameda, CA) (16). This pXen5 plasmid has a temperature-sensitive origin of replication in S. aureus, an erythromycin resistance gene, and a Tn4100 transposon that has had a promoterless luxABCDE operon engineered into it as well as a kanamycin resistance gene.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains and plasmids used in the study

 
PCR amplification of the S. aureus putP promoter region. Plasmid DNA from pPWC-1 isolated with a QIAGEN kit (QIAGEN Corp., Valencia, CA) was PCR amplified with the oligonucleotide primer pair SaputP1A (5' CACGCGAATTCCAGTCTCTTCAATTGCAT 3') and SaputP2A (5' CGAGGATCCACGAAACCAGAATGTGTATAT 3'), which were synthesized by Integrated DNA Technologies (Coralville, IA). The amplification conditions were as follows: initial denaturation at 94°C for 4 min and then 35 cycles of 94°C for 30 s, 57°C for 45 s, and 72°C for 1 min. Amplifications were done with Taq polymerase (Promega Corp., Madison, WI), and the resulting 1,150-bp product was verified on a 0.8% agarose gel. The DNA was washed and concentrated using a Microcon 30 filter (Millipore, Bedford, MA) and resuspended in sterile deionized water for further processing.

Construction of putP::lacZ fusions for use in E. coli and S. aureus. Aliquots of the PCR-amplified S. aureus putP promoter region DNA and pUJ9 plasmid DNA were digested with the restriction endonucleases EcoRI and BamHI, ligated together, and then used to transform E. coli DH5{alpha} cells (41). One of the resulting clones, pLL1-1, was verified to have the putP::lacZYA fusion and screened for ß-galactosidase activity in E. coli by growth in Luria broth (LB) (data not shown).

An aliquot of pLL1-1 plasmid DNA was digested with NotI and then blunted with T4 DNA polymerase (New England Biolabs). This blunt-ended DNA fragment was ligated to SmaI-cut pMOD-1 plasmid DNA and transformed into strain MC4100 cells. Transformants were selected for with ampicillin and screening was done with X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) containing Luria agar, generating pUB1-1. Plasmid DNA from pUB1-1 was electroporated into competent S. aureus strain RN4220 cells (20). After successful transfer into strain RN4220, the temperature was raised to 43°C, and transposition of Tn917 into the genome of the S. aureus strain RN4220 cells occurred. The resulting strain with the chromosomal insertion of the putP::lacZYA fusion was labeled LL-1.

Construction of a putP::luxABCDE fusion in S. aureus. Plasmid DNA from pXen5 was digested with BamHI and then oriented with the luxABCDE operon. Next, the plasmid DNA was cut with SstI, blunted with T4 DNA polymerase (41), and then digested with EcoRI. This double-cut DNA was ligated to the SaputP1A/SaputP2A 1,150-bp PCR amplification product cut with EcoRI and used to transform E. coli strain SOLR cells. Erythromycin-resistant colonies were grown in LB containing erythromycin, and 1-ml aliquots of each were analyzed in a Femtomaster FB12 luminometer (Zylux Corp., Pforzheim, Germany). From this screen, one clone containing the pLL5-25 plasmid was used for further characterization. Purified plasmid DNA from pLL5-25 was electroporated into S. aureus strain RN4220. Once the plasmid was verified in strain RN4220, the temperature of the culture was increased to 43°C, which allowed Tn4100 transposition into the chromosome. One of the resulting clones was used in transductions as described below. A promoterless lux operon transposon mutant isolate of strain RN6390 was also generated to serve as a control.

Transduction of S. aureus. The staphylococcal bacteriophage {phi}80{alpha} was provided by Ambrose Cheung, Dartmouth University. This phage was used to infect S. aureus strain RN4220 containing the putP::lux fusion in the genome, and the ensuing lysate was used to transduce S. aureus strains (25), selecting for transductants on brain heart infusion (BHI) agar containing kanamycin.

ß-Galactosidase assays. Overnight cultures of strain LL-1 or strain RN6390 were grown in brain heart infusion broth and then passaged in defined staphylococcal growth media (40, 45) with either various NaCl concentrations (0 to 1,000 mM) or various proline levels (1.74 µM to 1.74 mM). The cells were grown on a shaker at 37°C to mid-logarithmic phase. The procedure of Miller (33) was used. Aliquots were analyzed on a spectrophotometer, and ß-galactosidase activity (Miller units) was calculated. At least three separate runs were done per condition tested.

Assessment of luciferase activity. S. aureus strains with the putP::lux operon were grown overnight in the media to be tested, and then an aliquot was used to inoculate fresh media the next day. The cultures were grown on a shaker at 37°C to mid-logarithmic phase. One-milliliter aliquots were taken out for spectrophotometric analysis at 600 nm and for analysis in a luminometer. The relative luminescence units (RLU) were divided by the optical density at 600 nm readings to get the final corrected RLU.

Murine infection models. Three murine models of infection were used to test the putP::lux fusion in strains LL3-1 and Newman putP. The first was a systemic model of infection (9), where 100 µl of the recombinant S. aureus strain LL3-1 grown to mid-logarithmic phase set at 5 x 105 CFU/ml was intraperitoneally injected into five female 4- to 6-week-old Swiss Webster mice (Harlan) per time point. After 0, 4, 8, and 18 h postinoculation, the livers and spleens were collected, organs were homogenized in 1 ml of phosphate-buffered saline (41), and the entire homogenate from each organ was placed into a 1.5-ml microfuge tube and read in a luminometer for the RLU. Aliquots (100 µl) of the organ homogenates were plated onto BHI agar with kanamycin to get viable counts. The RLU per bacterial cell was calculated by taking the RLU number, subtracting the background, and then dividing by the viable count.

A murine urinary tract infection model was also used to assess regulation of the putP gene in S. aureus cells infecting murine urinary tract tissues (42). Fifty microliters of mid-logarithmic-phase-grown bacteria set at 108 CFU/ml in phosphate-buffered saline was injected into the bladder, and results at time points of 0, 4, 8, and 18 h postinoculation were analyzed. Five mice per time point per strain of bacteria were used. The same process as described above was used.

The murine thigh abscess model of infection was also tested (4). Bacteria grown in BHI broth to mid-logarithmic phase were diluted to 106 CFU/ml and mixed 1:1 with Cytodex beads (Sigma). Five or six female Swiss Webster mice were injected intramuscularly in the thigh with 100 µl of the inoculum. Mice were sacrificed and organs processed as described above.

Human abscess, blood, and urine samples. Abscess samples were collected from separate human patients. One was collected within 18 h of abscess formation from a patient with a furuncle on the back, whereas several other samples were collected more than 24 h after onset of abscess from patients with surgical-wound infections. A midstream clean-catch urine sample was also collected from a patient with an S. aureus urinary tract infection of the bladder. Last, a blood sample was taken from a patient with S. aureus bacteremia. All of the samples were confirmed to have S. aureus by being cultured on sheep blood agar plates and then being tested for ß-hemolysis on sheep blood agar plates. Colonies that were beta-hemolytic were verified as S. aureus by Gram stain showing gram-positive cocci in irregular clusters as well as being both catalase positive and tube coagulase positive. Each sample was kept at –80°C until processed.

Extraction of total RNAs and conversion to cDNAs. Total RNAs were extracted from S. aureus strain RN6390 cells grown in BHI broth as well as defined staphylococcal growth medium containing 400 mM NaCl and formulated with 17.4 µM proline, as well as from abscesses, urine, and blood from human patients infected with S. aureus. For all of these RNA extractions, a QIAGEN RNA extraction kit (QIAGEN) was used, with a 30-min lysostaphin treatment added as part of the first step. The cDNAs used for PCR amplification were each synthesized from 3 µg of total RNA as previously described (43) by using the random hexamer primers from a reverse transcription (RT)-PCR ProStar kit and primers specific to putP and ftsZ (Stratagene, La Jolla, CA).

LD RT-PCR. Limiting-dilution RT-PCR (LD RT-PCR) amplification was performed as previously described (43, 44) with the following modifications. A Perkin-Elmer 9700 thermocycler was used under the following PCR conditions: initial denaturation at 95°C for 5 min; 40 cycles consisting of denaturation at 95°C for 1 min, annealing at 55°C for 1 min, and elongation at 72°C for 1 min; and a 10-min elongation at 72°C after the last cycle. The primers used were SaPutP5, 5' GATGCTACCTAAAGCTAGACG 3', and SaPutP6, 5' TCTTCCGTTAGTGAACTAGATG 3', which generated a 264-bp product, and SaFtsZ1, 5' GGTGTAGGTGGTGGCGGTAA 3', and SaFtsZ2, 5' TCATTGGCGTAGATTGTC 3', which produced a 484-bp product. The putP primers were derived from the S. aureus putP sequence (46, 51), and the ftsZ sequence was obtained from the S. aureus strain N315 genome sequencing project (27). The cDNAs of in vitro-grown S. aureus as well as the human patient sample cDNAs were standardized by LD RT-PCR with the SaFtsZ1/SaFtsZ2 primer set. Serial twofold dilutions were performed, followed by amplification of each dilution. Each respective cDNA sample was diluted so that amplification with SaFtsZ1/SaFtsZ2 resulted in equivalent levels of ftsZ expression in the S. aureus cells. These same dilutions were also used to amplify putP. RNA that had not been converted to cDNA was also tested from each sample.

Northern blot analysis. Northern blot hybridizations were then performed with S. aureus strain RN4220 grown to mid-logarithmic phase in defined staphylococcal medium with various NaCl concentrations (0, 400 mM, 800 mM, or 1 M) or proline concentrations (1,734 µM and 17.4 µM). Total RNAs were isolated from the samples as previously described. Ten micrograms of total RNA from each population was loaded on a 1% denaturing agarose gel, processed, and hybridized with a radiolabeled putP PCR product as described previously (Schwan). Following a 4-day exposure on a phosphorimager screen (Amersham Biosciences, Piscataway, NJ), the results were assessed with ImageQuant 5.2 software for each band.

Statistics. Student's t test was used for statistical analyses of the in vitro growth conditions. P values of ≤0.05 were considered significant. A repeated-measures analysis of variance with a Bonferroni correction was used for assessing significance of strain LL3-1 in the animal studies, whereas a nonparametric Friedman test with a Bonferroni correction was used for strain Newman putP.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Examination of the putP::lacZYA fusion in S. aureus under different osmotic conditions. A putP::lacZYA fusion, named pUB1-1, was constructed in the shuttle plasmid pMOD1. ß-Galactosidase assays were done and LacZ expression was noted (data not shown), suggesting that the fusion was active. To determine the regulation of the putP gene in S. aureus, the putP::lacZYA fusion was moved into the chromosome of S. aureus strain RN4220 via Tn917 transposition as previously described (9, 46). Several transposon insertion mutants were recovered, each with a different insertion point in the chromosome as measured by Southern blot analysis (reference 41 and data not shown). One of the transposon insertion clones, labeled LL-1, was used for analyzing putP expression in various growth media. First, strain LL-1 was grown in defined staphylococcal growth media with NaCl concentrations that ranged from 0 to 1,000 mM. ß-Galactosidase activity levels were measured on mid-logarithmic-phase cells. As the osmolarity increased from 0 mM NaCl (12 Miller units) to 1,000 mM, the ß-galactosidase activity from the putP::lacZYA fusion tripled (34 Miller units), without reaching a threshold at 1,000 mM NaCl (P < 0.0049) (Fig. 1).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 1. Effects of osmolarity on S. aureus strains LL-1 (putP::lacZYA) and RN4220 as determined with a lacZYA transcriptional fusion. The ß-galactosidase (ß-Gal) activity (expressed in Miller units) was determined after 60 min; means ± standard deviations from at least three separate runs are indicated. Osmolarity effects were tested by using NaCl as the osmolyte. Strain RN4220 served as a negative control.

 
Effects of proline concentration on the putP::lacZYA fusion in S. aureus. Another environmental factor that was tested with the putP::lacZYA fusion in S. aureus strain RN4220 was the concentration of proline in the media. Four proline concentrations were tested: 1,740 µM (standard concentration for the defined staphylococcal growth medium [37, 42]), 174 µM, 17.4 µM, and 1.74 µM. In defined growth medium with 1,740 µM proline, ß-galactosidase activity was measured at 12 Miller units (Fig. 2). A decrease in the proline concentration to 174 µM resulted in an increase in putP expression to 16 Miller units, and there was an additional increase to 23 Miller units when the proline concentration dipped to 17.4 µM (P < 0.011). When the proline concentration was lowered further to 1.74 µM, there was a slight dip in expression (18 Miller units) compared to that at 17.4 µM, but the level was still significantly higher than expression at 1,740 µM proline (P < 0.035). Strain RN4220 served as a negative control and exhibited no ß-galactosidase activity. These results indicate that the proline concentration in defined growth media affects expression of the putP gene in S. aureus.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 2. Effects of proline concentration on S. aureus strains LL-1 (putP::lacZYA) and RN4220 as determined with a lacZYA transcriptional fusion. The ß-galactosidase (ß-Gal) activity (expressed in Miller units) was determined after 60 min; means ± standard deviations from at least three separate runs are indicated. Strain RN4220 served as a negative control.

 
Examination of putP expression using a putP::lux fusion within S. aureus cells grown under different osmotic conditions. As described above, the putP::lacZYA fusion demonstrated that osmolarity and proline concentration affected the expression of putP in S. aureus. To ascertain putP regulation in S. aureus cells growing in murine tissues, a putP::lux fusion was created using the Xenogen Corporation's pXen5 plasmid as a backbone (16). The promoterless lux operon has been adapted for use in staphylococci (15) and does not require an external substrate. Once the pLL5-25 plasmid was generated, the putP::lux fusion was placed into the chromosome by random insertion of the Tn4001 transposon into strain RN4220. Several transposon mutants resulted, each verified by Southern blot hybridization to have an insertion into a different part of the genome (data not shown). Three of the resulting clones were transduced into strain RN6390, a SigB inactive strain, by using {phi}80{alpha} phage. One clone, LL3-1, was used for further analysis. The Newman strain, a SigB active strain, was also transduced with the same phage preparation, resulting in strain Newman putP. A transposon mutagenesis was also done with the pXen5 plasmid without a promoter inserted to serve as a control. One of the resulting transposon mutants was transduced into S. aureus strain RN6390, creating strain RN6390 Tn 1.

To determine if the putP::lux fusion in strains LL3-1 and Newman putP displayed the same type of regulation as S. aureus strain LL-1, both strains were grown in BHI broth with additions of NaCl ranging from 0 to 3,000 mM. After the cells had grown to mid-logarithmic phase, 1-ml aliquots were analyzed in a luminometer for RLU. As the osmolarity of the medium increased, the number of RLUs also rose threefold in strain LL3-1, from 2,106 at 0 mM NaCl to 6,786 with 1 M NaCl BHI medium (P < 0.00005) (Fig. 3A). However, strain Newman putP exhibited RLU counts of 57,625 at 0 mM NaCl but a significant decline to 5,615 when the osmolarity was increased to 1 M (P < 0.002) (Fig. 3B). Other nonionic osmolytes were also tested. Increasing concentrations of sucrose led to a 2.5- to 4.5-fold-greater activation of putP in both strain LL3-1 (2,256 in 0 mM to 9,878 in 1 M [P < 0.0001]) and strain Newman putP (58,930 in 0 mM to 140,770 in 1 M [P < 0.012]). Similarly, the addition of higher concentrations of sorbitol also caused a significant 3.5- to 4.5-fold-greater putP expression in both strain LL3-1 (2,033 in 0 mM to 9,258 in 1 M [P < 0.00001]) and Newman putP (42,072 in 0 mM to 154,000 in 1 M [P < 0.035]). These results verified that the putP::lux fusion was functional in several S. aureus strains and suggested a role for SigB in putP expression.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 3. Effects of osmolarity on S. aureus strains (A) LL3-1 and (B) Newman as determined with a putP::luxABCDE transcriptional fusion. RLU/bacterial cell were measured with a luminometer and then divided by viable counts; means ± standard deviations from at least three separate runs are indicated. Osmolarity effects were tested by using sucrose, sorbitol, or NaCl as the osmolyte.

 
Strains RN6390 and Newman have significant differences in their respective genomes that could have affected putP in a manner unrelated to SigB. To verify that SigB was the reason for the difference, one background strain, strain 8325-4, was used. The 8325-4 strain has a mutation in the rsbU gene, which renders it SigB inactive (19). Strain SH1000 had the rsbU mutation reconstituted in strain 8325-4, making it SigB active. Moreover, a directed sigB mutation was created in strain 8325-4, creating strain SH1003 (SigB inactive). Strains SH1003 (SigB inactive), 8325-4 (SigB inactive), and SH1000 (SigB active) were transduced with the same phage preparation noted above, resulting in strains WRS4-2, WRS5-2, and WRS6-4, respectively. All three strains were grown in BHI broth supplemented with 0 mM, 400 mM, or 1 M NaCl. As the osmolarity increased, the expression of putP increased in both SigB inactive strains (WRS4-2 and WRS5-2) but went down in the SigB active strain (WRS6-4) (Fig. 4). The findings confirm that SigB modulates putP expression following the stress of a high-Na-concentration environment.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 4. Role of SigB in regulation of the putP gene. Recombinant S. aureus strains were created by transduction, inserting the putP::lux fusion into the genome, creating WRS4-2 (SH1003 background), WRS5-2 (8325-4 background), and WRS6-4 (SH1000 background). All strains were grown in BHI broth media with 0 mM, 400 mM, or 1 M NaCl. RLU/bacterial cell were measured with a luminometer and then divided by viable counts; means ± standard deviations from at least three separate runs are indicated.

 
To substantiate the fusion results from strain RN4220, Northern blot hybridizations were performed on RNAs extracted from wild-type-strain RN4220 cells grown in regular defined staphylococcal medium (0 mM NaCl, 1,740 µM proline) as well as medium with 400 mM NaCl, 800 mM NaCl, and 1 M NaCl. In addition, normal-formulation defined staphylococcal medium (1,740 µM proline) and medium with only 17.4 µM proline were used to grow the bacteria. The results showed a 1.8-fold increase in the RNA from the bacteria grown in 400 mM medium compared to that grown in 0 mM medium (Fig. 5). As the NaCl concentrations increased to 800 mM and 1 M, the levels of putP transcripts increased 2.2- and 2.7-fold, respectively. Moreover, a lowering of proline to 17.4 µM also led to an increase in putP transcription (1.4-fold). These results support the transcriptional-fusion findings for strain RN4220.



View larger version (54K):
[in this window]
[in a new window]
 
FIG. 5. Northern blot analysis of putP expression following growth of S. aureus strain RN4420 in defined staphylococcal medium with various concentrations of NaCl and proline. Ten micrograms of total RNA from each bacterial population was probed with a putP DNA fragment. After 4 days, the blot was developed with a phosphorimager and the amounts of putP transcripts were compared between lanes by using ImageQuant 5.2 software. The samples were loaded as follows: lane 1, defined medium (1,740 µM proline); lane 2, defined medium with 400 mM NaCl; lane 3, defined medium with 800 mM NaCl; lane 4, defined medium with 1 M NaCl; lane 5, defined medium (1,740 µM proline); and lane 6, defined medium with 17.4 µM proline.

 
Growth curves were done next to plot putP activation over time and optical density. The Newman putP strain was grown in BHI broth with no added NaCl or in BHI broth with 800 mM NaCl added. In regular BHI broth, optimal transcriptional activation of putP occurred after 2 h (Fig. 6A). However, the Newman putP strain grown in BHI broth containing 800 mM NaCl displayed a shift in optimal activation 1 hour later and the growth was slower (Fig. 6B) than the growth in plain BHI broth. This suggests that under high osmotic conditions, it takes slightly longer to maximally activate putP than with growth in a low-osmolarity environment.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 6. Growth stage and osmolarity effects on S. aureus strain Newman putP as determined with a putP::luxABCDE transcriptional fusion. The conditions tested were (A) BHI broth plus 0 mM NaCl and (B) BHI broth plus 800 mM NaCl. Both RLUs and optical density (OD) at 600 nm readings were measured. Means ± standard deviations from at least three separate runs are indicated.

 
Testing the putP::lux fusion in S. aureus injected into mice. The growth medium experiment with various proline or osmolyte concentrations indicated that a low-proline and high-osmolarity environment transcriptionally activated putP expression. To try to tie these observations to what may be going on during human infections, several animal models of infection were used to elucidate the regulation of putP in S. aureus cells present in different murine tissues. These model systems included a systemic model of infection (45, 46) to assay putP expression in S. aureus present in spleens and livers, a urinary tract infection model for determining putP levels in bladders and kidneys (42), and an abscess model to ascertain putP transcription in abscesses within murine thighs (4). Time courses of 0, 4, 8, and 18 h were used for all infection models.

Using the murine urinary tract infection model, putP expression in S. aureus cells infecting bladders and kidneys was examined. In murine bladders, RLUs increased in strain LL3-1 from 0.00053 at 0 h to 0.2254 after 4 h, representing a 426-fold increase (Fig. 7A). Similarly, the Newman putP strain exhibited a slight increase in putP expression as measured by RLUs, showing a slight increase from 0.004 to 0.021, a fivefold rise. After 8 h, the RLUs dropped for strain LL3-1, but the difference was still 136-fold compared to values at 0 h. On the other hand, strain Newman putP RLU values rose even further, to 0.049, or a 12.2-fold activation compared to 0 h. At 18 h, putP expression in strain LL3-1 increased to 0.342, or a 719-fold increase compared to the value at the 0-h time point. An 87.2-fold increase in putP expression was also observed for the Newman putP strain after 18 h in murine bladders (0.271). Strain LL3-1 bacterial counts changed from 6.05 x 103 at 4 h to 3.30 x 103 at 8 h and finally to 9.40 x 102 after 18 h, representing a slight decline in viable counts over the time course tested. Newman putP also exhibited similar viable count changes (data not shown). For all of the time points that were compared to the 0-h time point, there was a significant increase in RLUs in strain LL3-1 (P < 0.0005) but not in strain Newman putP (P < 0.086).





View larger version (37K):
[in this window]
[in a new window]
 
FIG.7. Expression of putP in murine tissues after infection with S. aureus strains LL3-1, Newman putP, and RN6390 Tn 1 as determined with a putP::luxABCDE transcriptional fusion after 0, 4, 8, and 18 h postinoculation. Murine tissues included (A) bladder, (B) kidney, (C) liver, (D) spleen, and (E) thigh abscess. RLU were measured with a luminometer and then divided by viable counts; means ± standard deviations are indicated. Five animals per time were examined. Strain RN6390 Tn 1 served as a negative control.

 
In murine kidneys, putP expression in strain LL3-1 changed 105-fold from the 0-h to the 4-h time point (Fig. 7B), but expression fell at 8 h (only 53-fold) and again at 18 h (1.3-fold), resulting in a significant difference at 4 and 8 h compared to 0 h (P < 0.002). For the Newman putP strain, RLUs rose at 4 h (0.0129), 8 h (0.032), and again at 18 h (0.130), but the differences were not significant (P < 0.334). Viable bacterial counts in the kidneys dropped from 4.95 x 103 at 0 h to 1.09 x 103 at 8 h but then increased to 8.57 x 103 by 18 h. The RN6390 Tn 1 strain had only background levels of luminescence. A second putP::lux fusion transductant of strain RN6390 also displayed kinetics similar to that of strain LL3-1 (data not shown).

A murine systemic model of infection testing putP expression in S. aureus growing in murine livers and spleens showed substantial RLU increases in both organs. Murine livers infected with strain LL3-1 had a 39-fold elevation in expression after 4 h and an additional rise to 45-fold after 8 h (Fig. 7C). Once strain LL3-1 remained in the murine livers for 18 h, putP expression fell to 18-fold. No significant differences were noted compared to the 0-h time point (P < 0.086). The bacterial numbers changed from 1.37 x 104 at 4 h to 3.25 x 103 at 8 h and then to 7.40 x 102 after 18 h. Expression in murine spleens changed 45-fold at 4 h postinoculation, with an additional increase to 81-fold after 8 h (Fig. 7D). By 18 h, putP expression had fallen to only a threefold difference compared to the 0-h time point; thus, no significant difference was demonstrated (P < 0.200). Bacterial counts in the spleens were 1.47 x 104 at 4 h, falling to 2.50 x 103 by 8 h with another drop to 3.30 x 102 after 18 h. The second putP::lux fusion transductant of strain RN6390 also displayed similar kinetics (data not shown).

The third animal model of infection generated abscesses in the thighs of the mice by using S. aureus cells mixed with Cytodex beads. Bacterial counts rose from 2.05 x 105 at 4 h to 4.37 x 106 after 18 h postinoculation, a 21-fold increase in bacterial number. The S. aureus putP expression increased 39.5-fold after 4 h (0.148 [P < 0.015]) and 29-fold at 8 h (0.099) but exhibited a 1.5-fold decrease after 18 h (0.0023) compared to the initial inoculum (0.0037) (Fig. 7E). After 8 h and 18 h, there was no significant difference observed in the RLU values.

Analysis of S. aureus putP expression in human patient samples. From the animal models of infection, considerable transient increases in putP expression were observed, much greater than the results following growth in various growth media. To further examine whether putP expression in S. aureus infecting human tissues was affected, abscess material was collected from six patients, urine from a seventh patient, and a blood sample from an eighth patient to test for putP expression within S. aureus found in these clinical samples. Total RNAs were extracted from each clinical sample, converted to cDNAs, and then standardized between samples by using the expression of the housekeeping gene ftsZ. This standardization procedure was based on the presence of similar ftsZ levels from BHI-grown and minimal-medium-grown cDNA populations as well as from observations noted from past E. coli work (44). Once the cDNA samples were standardized, putP transcript levels were assayed using LD RT-PCR on twofold-diluted cDNA samples from each tissue sample as well as BHI broth and defined staphylococcal growth medium cDNA populations. The putP expression in each sample was compared to that of the BHI broth-grown S. aureus cDNA. Using this benchmark, an eightfold increase in putP transcription was observed in cDNA from S. aureus grown in defined staphylococcal growth medium with moderate osmolarity and low proline (Fig. 8). In the human clinical sample analysis shown in Fig. 8, expression of putP ranged from no increase for the blood sample to a twofold increase for the old-abscess sample to an eightfold increase in a young-abscess sample and up to a 64-fold increase in the human urine sample, compared to the amplification from the BHI broth-grown S. aureus cDNA population. Four other human abscess samples infected with S. aureus had PCR amplification of putP cDNAs that ranged from no activation up to a fourfold increase compared to BHI broth-grown cDNA (data not shown). RNAs that had not been converted to cDNA did not PCR amplify in this procedure, serving as a negative control for DNA contamination (data not shown). These results suggest that putP expression in S. aureus may be more important in certain parts of the body and at certain times during infection within humans.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 8. Quantitative determination of mRNA regulation by LD RT-PCR analysis of cDNAs of S. aureus found in human abscesses (fresh and old), blood, and urine compared to those of S. aureus strain RN6390 grown in BHI broth or minimal medium with 17.4 µM proline and an addition of 400 mM NaCl. The PutP5/PutP6 and SaFtsZ1/SaFtsZ2 primer pairs were used to amplify serially twofold-diluted cDNAs targeting putP and ftsZ transcripts, respectively. All PCR products were electrophoresed on 1.5% agarose gels. The following dilutions of cDNAs were used: undiluted (lanes 1), 1/2 (lanes 2), 1/4 (lanes 3), 1/8 (lanes 4), 1/16 (lanes 5), 1/32 (lanes 6), 1/64 (lanes 7), 1/128 (lanes 8), 1/256 (lanes 9), and 1/512 (lanes 10). Results represent at least two runs per sample per primer pair.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Many S. aureus strains have a requirement for external proline. Human urine (21, 22) and animal tissues (13, 45) have been shown to have low proline concentrations. Our previous analyses of PutP, a high-affinity proline transporter, have indicated that this proline transporter is critical for survival of some S. aureus strains in low-proline growth media and when injected into animals (3, 45, 46); thus, the ability to transport proline may aid S. aureus during an infection within mice or humans.

Proline is used by both gram-negative and gram-positive bacteria to provide osmoprotection, as building blocks for protein synthesis, and as a source of carbon and nitrogen (52). Low-affinity and high-affinity proline transporters within the bacteria serve to bring proline into the bacterial cell. In gram-negative bacteria, like E. coli and Salmonella enterica serovar Typhimurium, several proline transporters serve in this capacity, including the low-affinity ProP and ProU proteins as well as the high-affinity PutP protein (10, 52). However, the gram-positive species Bacillus subtilis has OpuD (23) and OpuE serving in proline transport roles similar to those noted for the gram-negative species above (48, 50). Although PutP homologs may be structurally similar across different bacterial species, regulation of the corresponding putP genes can differ. The putP gene in E. coli (18) and that in Salmonella enterica serovar Typhimurium (12) are not osmotically regulated, but the opuE (the putP homolog) gene in B. subtilis is up-regulated after an osmotic shock, and SigB, an alternative sigma factor that is important during stationary phase and general stress conditions, affects transcription from one of two opuE promoters (48, 50). The putP gene is important for S. aureus pathogenesis (3, 45, 46), but no one has previously examined the regulation of any of the proline transport genes found in S. aureus, including putP.

In this study, we have constructed two putP reporter systems to monitor regulation of the putP gene in growth media as well as after injection of S. aureus cells into mice. Construction of the putP::lacZYA fusion and testing it in one S. aureus strain (RN4220) demonstrated that the S. aureus putP gene is activated by environmental cues like osmotic stress and low proline concentrations. Northern blot hybridizations supported the fusion results for strain RN4220. The native putP genes in E. coli and S. enterica serovar Typhimurium are not osmoregulated (12, 18). Moreover, enteric bacteria are less halotolerant than S. aureus (1, 31). What was surprising was the extent of activation of the S. aureus putP gene in an S. aureus background following growth in media with increasing levels of ionic and nonionic osmolytes by using the putP::lux fusion. Several clones were initially tested with different insertion points of the fusion in a strain RN6390 background. All of the clones displayed the same type of putP activation regardless of where the fusion was inserted, demonstrating that regulation of putP was not being influenced by genes around the fusion that may themselves be affected by osmolarity or proline level. Moreover, the same activation trend was observed regardless if it was a putP::lacZ or a putP::lux fusion and despite the background of the putP transcriptional fusions (RN4420, RN6390, or Newman). No threshold was reached with strain LL3-1 until 2 M NaCl was used, and no plateau was observed for the other two osmolytes (sucrose or sorbitol). In a Newman strain background, thresholds for sucrose and sorbitol were obtained at 2 M. In B. subtilis (another gram-positive species), proline is maximally transported in 600 mM NaCl medium (50), but an opuE mutant strain did not show this elevated proline transport. Furthermore, as NaCl concentrations in the media rose, the opuE gene was transcriptionally activated (48). S. aureus is capable of growing in high concentrations of an osmolyte, and the PutP protein may serve to bring proline into the cell both for osmoprotection and as a nutrient source. Other studies have indicated that S. aureus accumulates proline as part of an essential osmoregulation strategy (1, 26).

What was interesting about the growth medium experiments was that NaCl concentrations affected S. aureus strains differently depending on whether the strain was SigB inactive (RN6390, 8325-4, and SH1003) or SigB active (Newman and SH1000). First, the Newman putP strain had much higher levels of expression, as measured by the higher RLUs, than strain LL3-1, showing that expression can differ between S. aureus strains. Second, in media with high NaCl concentrations, the SigB active strains Newman putP and SH1000 exhibited down-regulation of putP, whereas the SigB inactive strains RN6390, 8325-4, and SH1003 showed greater putP transcription as the NaCl concentration rose. Previous work has shown that sigB is repressed when S. aureus cells are grown in 1 M NaCl (8), and strain 8325-4, from which strain RN6390 is derived, has a small deletion in the rsbU gene that renders the strain SigB negative (19). Previous whole-cell analysis of the high-affinity proline transport system in S. aureus showed no proline uptake stimulation in high-NaCl-concentration media (2), which might be influenced by SigB. SigB has been shown to play a role in transcription of opuE in B. subtilis (48), so one can surmise that SigB seems to be involved in regulating the transcription of putP when the S. aureus cells are in a general stress environment, such as high NaCl levels. Why the effect is only observed with NaCl and not the other osmolytes may be tied to the putative role of PutP as an Na/proline transporter (52). Proline is brought in and sodium is pumped into the cell. If the level of NaCl rises in the external environment, this may affect the ability to pump Na out of the cell because of the high level of sodium already in the external milieu. It is possible that the bacteria sense this change and thus shut down further in putP expression because sodium can no longer be pumped out in a cost-effective manner for the S. aureus cells. The other osmolytes, sucrose and sorbitol, are not tied to sodium, and the cell may still need PutP to bring proline in to main cell integrity in such a high osmotic environment.

Another environmental cue tested for its effect on putP gene regulation was proline concentration. S. aureus bacteria grown in media with various proline concentrations still exhibited some degree of putP expression, suggesting constitutive expression of the gene, even in media with high proline concentrations. However, optimal putP expression occurred in growth medium with 17.4 µM of proline, and a proline concentration as low as 1.74 µM still significantly activated the putP gene compared to passage in growth media with proline at 1.74 mM. Proline uptake in gram-negative bacteria is influenced by the proline concentration of the growth medium (18, 30, 32, 38, 53). Thus, it makes sense that putP transcription was activated in a low-proline growth environment if one considers that PutP is a high-affinity proline permease and would be useful in higher concentrations when proline concentrations are low.

Our working model brings together the results observed for osmolyte variation and proline concentration changes. In a growth environment that is high in proline and low in NaCl, there is constitutive expression of PutP (Fig. 9A). As the NaCl concentration rises, an NaCl-induced protein is activated, which in turn activates putP expression (Fig. 9B). However, if there is induction of SigB in the stress environment, the SigB protein binds and represses putP expression (Fig. 9C). In the absence of SigB repression in an environment with low-proline and high osmotic conditions, the putP gene is maximally transcribed through activation by both an NaCl-induced protein and a proline-induced protein, leading to more PutP protein present in the bacterial cell (Fig. 9D).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 9. Models of regulation for S. aureus putP expression. Environments with (A) a low-NaCl and high-proline concentration in a SigB inactive background, (B) a high-NaCl and high-proline concentration in a SigB inactive background, with activation by an NaCl-induced protein (NI), (C) a high-NaCl and high-proline concentration in a SigB active background, and (D) a high-NaCl and low-proline concentration in a SigB inactive background. PI, proline induced.

 
Although the growth medium analyses uncovered some new insights into the regulation of the S. aureus putP gene, the most striking observations came from the animal studies and analyses of human samples from patients with S. aureus infections. No one has previously looked at proline transporter gene transcript levels during the course of an infection. In all three animal models of infections and the five tissues that were tested, there was at least some activation of the putP gene. However, the extent of this activation and the kinetics of theactivation differed from one tissue to the next. Urinary tract tissues (bladders and kidneys) infected with S. aureus displayed the highest levels of activation. Over the entire time frame studied, putP expression was activated at least 87-fold or more in bacteria present in murine bladders. Previous work has shown that mutations in all of the proline transport genes in E. coli, including putP, significantly affected the survival of E. coli in murine urinary tracts, presumably because the gene products offered protection from osmotic stresses in an environment with a high osmolality (10). Human urine has low proline concentrations within the range that would mean optimal expression from the putP gene (21, 22). Furthermore, murine urine osmolalities can be as high 3 mol/kg of body weight (28). Taken together, murine urine would be assumed to have a combination of high osmolarity and a low proline concentration, conditions we have shown to cause maximal transcription of the putP gene. Even so, the magnitude of the activation of putP in murine bladders exceeded the transcriptional activation in growth media with low proline or high osmolarity by more than 10-fold, suggesting either that there are other signals in the murine urinary tract that may influence putP expression or that a combination of high osmolyte concentration and low proline levels has a synergistic effect in terms of transcription of putP. Previously, we have observed how two environmental cues when combined have a major impact in terms of fim gene expression in uropathogenic E. coli (44).

Activation of putP in S. aureus infecting murine livers and spleens would be expected because these organs were recently shown to have rather low proline concentrations (45). There was more activation of putP in the spleen than in the liver, and that may be tied to the total amount of proline in the spleen (7.5 µmol) versus in the liver (88.4 µmol). Moreover, there was greater expression after 8 h than after 4 h, which was different than the kinetics found in organs of the urinary tract. Some of the decline in putP expression within the liver and spleen can be attributed to lower bacterial counts in each organ that fall below the threshold limit for the lux system (15). Within murine abscesses, putP expression rose significantly early on after initiation of the infection and then fell back to the initial expression levels after 18 h. This decline was not due to lower bacterial counts because the bacterial number increased over time (Fig. 6E). Thus, in all murine tissues, there was a rapid increase in putP expression and then changes occurred within each respective tissue that likely depended on the proline concentration, the osmolarity of that microenvironment, and whether or not SigB was active.

The putP expression levels in murine tissues were far greater than those in the growth medium characterization experiments that were done. S. aureus is a potent pathogen of humans (29), and the samples collected from humans infected with S. aureus generated some additional observations that might have a bearing on human infections with S. aureus. Each human clinical sample that was analyzed gave rise to a putP PCR product, demonstrating that putP expression occurs during a human infection. However, tissue location may play a part in the magnitude of putP expression. In human urine, putP expression was much greater than in any other specimen, mirroring the murine results. Human urine has a low proline concentration (6.08 to 17.10 µM [21, 22]) and it can have a relatively high osmolality (38), two environmental signals that activated putP expression in growth media. In the one human blood sample, there was just background expression of putP within the S. aureus cells, possibly because the osmolality is not as high and the proline level is increased compared to levels in human urine (21, 22, 39). With human abscesses, the abscess age may play a role in putP expression. S. aureus cells in the young abscess had greater putP expression than those in older abscesses. Whether there is a time-dependent variable associated with putP expression is still unclear. Certainly, the sample size was limited, so the age of the abscess may not be the only factor involved. If age is truly a mitigating factor, one would expect putP expression to be needed because of low proline levels in the tissue. Over time, the virulence factors expressed by S. aureus will damage tissue within a wound or an abscess (29), leading to a likely release of proline from the damaged tissue, which in turn could lower putP expression. Obviously, more human clinical samples should be tested to reinforce the results presented in this study. Overall, our work offers great insight into what might be regulating the putP gene both in S. aureus cells in growth media and in S. aureus causing infections in humans and other animals.


    ACKNOWLEDGMENTS
 
We thank Xenogen Corporation for the pXen5 plasmid, Ambrose Cheung for the phage, Jean Lee for the Newman and 8325-4 strains, Simon Foster for strains SH1000 and SH1003, David Reineke and the UW-L Statistical Consulting Center for statistical assistance, William Agger and the staff of the clinical microbiology laboratory at Gundersen Lutheran Medical Center for the identification of S. aureus from patient samples.

This work was supported by an Undergraduate Research Grant to L.L. as well as grants from the NIH (AREA grant 1R15AI47801-01A2) and NFID and a Faculty Research Grant from the UW—La Crosse to W.R.S.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology, University of Wisconsin—La Crosse, 1725 State St., La Crosse, WI 54601. Phone: (608) 785-6980. Fax: (608) 785-6460. E-mail: schwan.will{at}uwlax.edu. Back

Editor: D. L. Burns


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Anderson, C. B., and L. D. Witter. 1982. Glutamine and proline accumulation by Staphylococcus aureus with reduction in water activity. Appl. Environ. Microbiol. 43:1501-1503.[Abstract/Free Full Text]
2. Bae, J.-H., and K. J. Miller. 1992. Identification of two proline transport systems in Staphylococcus aureus and their possible roles in osmoregulation. Appl. Environ. Microbiol. 58:471-475.[Abstract/Free Full Text]
3. Bayer, A. S., S. N. Coulter, C. K. Stover, and W. R. Schwan. 1999. Impact of the high-affinity proline permease gene (putP) on the virulence of Staphylococcus aureus in experimental endocarditis. Infect. Immun. 67:740-744.[Abstract/Free Full Text]
4. Beonton, B. M., J. P. Zhang, C. Pope, T. Christian, L. Lee, K. M. Winterberg, M. B. Schmid, and J. M. Buysse. 2004. Large-scale identification of genes required for full virulence of Staphylococcus aureus. J. Bacteriol. 186:8478-8489.[Abstract/Free Full Text]
5. Boyce, J. M. 1997. Epidemiology and prevention of nosocomial infections, p. 309-328. In K. B. Crossley and G. L. Archer (ed.), The staphylococci in human disease. Churchill Livingstone, New York, N.Y.
6. Centers for Disease Control and Prevention. 1997. Staphylococcus aureus with reduced susceptibility to vancomycin—United States, 1997. Morb. Mortal. Wkly. Rep. 46:765-766.[Medline]
7. Centers for Disease Control and Prevention. 1999. Four pediatric deaths from community acquired methicillin-resistant Staphylococcus aureus—Minnesota and North Dakota, 1997-1999. Morb. Mortal. Wkly. Rep. 48:707-710.
8. Chan, P. F., S. J. Foster, E. Ingham, and M. O. Clements. 1998. The Staphylococcus aureus alternative sigma factor {sigma}B controls the environmental stress response but not starvation survival or pathogenicity in a mouse abscess model. J. Bacteriol. 180:6082-6089.[Abstract/Free Full Text]
9. Coulter, S. N., W. R. Schwan, E. Y. Ng, M. H. Langhorne, H. D. Ritchie, S. Westbrock-Wadman, W. O. Hufnagle, K. R. Folger, A. S. Bayer, and C. K. Stover. 1998. Staphylococcus aureus genetic loci impacting growth and survival in multiple infection environments. Mol. Microbiol. 30:393-404.[CrossRef][Medline]
10. Culham, D. E., C. Dalgado, C. L. Gyles, D. Mamelak, S. MacLellan, and J. M. Wood. 1998. Osmoregulatory transporter ProP influences colonization of the urinary tract by Escherichia coli. Microbiology 144:91-102.[Abstract]
11. DeLorenzo, V., M. Herrero, U. Jakubzik, and K. N. Timmis. 1990. Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria. J. Bacteriol. 172:6568-6572.[Abstract/Free Full Text]
12. Dunlap, V. J., and L. N. Csonka. 1985. Osmotic regulation of L-proline transport in Salmonella typhimurium. J. Bacteriol. 163:296-304.[Abstract/Free Full Text]
13. Durack, D. T., and P. B. Beeson. 1972. Experimental bacterial endocarditis. II. Survival of bacteria in endocardial vegetations. Br. J. Exp. Pathol. 53:50-53.[Medline]
14. Easmon, C. S. F., and C. Adlam. 1983. Staphylococci and staphylococcal infections. Academic Press, New York, N.Y.
15. Francis, K. P., D. Joh, C. Bellinger-Kawahara, M. J. Hawkinson, T. F. Purchio, and P. R. Contag. 2000. Monitoring bioluminescent Staphylococcus aureus infections in living mice using a novel luxABCDE construct. Infect. Immun. 68:3594-3600.[Abstract/Free Full Text]
16. Francis, K. P., J. Yu, C. Bellinger-Kawahara, D. Joh, M. J. Hawkinson, G. Xiao, T. F. Purchio, M. G. Caparon, M. Lipitsch, and P. R. Contag. 2001. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect. Immun. 69:3350-3358.[Abstract/Free Full Text]
17. Gladstone, G. P. 1937. The nutrition of Staphylococcus aureus: nitrogen requirements. Br. J. Exp. Pathol. 19:208-226.
18. Grothe, S., R. L. Krogsrund, D. J. McClellan, J. L. Milner, and J. M. Wood. 1986. Proline transport and osmotic stress response in Escherichia coli K-12. Mol. Gen. Genet. 246:783-786.
19. Horsburgh, M. J., J. L. Aish, I. J. White, L. Shaw, J. K. Lithgow, and S. J. Foster. 2002. {sigma}B modulates virulence determinant expression and stress resistance: characterization of a functional rsbU strain derived from Staphylococcus aureus 8325-4. J. Bacteriol. 184:5457-5467.[Abstract/Free Full Text]
20. Iandolo, J. J., and G. R. Kraemer. 1990. High frequency transformation of Staphylococcus aureus by electroporation. Curr. Microbiol. 21:373-376.[CrossRef]
21. Inoue, H., H. Iguchi, A. Kono, and Y. Tsuruta. 1999. Highly sensitive determination of N-terminal prolyl dipeptides, proline and hydroxyproline in urine by high-performance liquid chromatography using a new fluorescent labeling reagent, 4-(5, 6-dimethoxy-2-phthalimidinyl)-2-methoxyphneylsulfonyl chloride. J. Chromatogr. 724:221-230.
22. Inoue, H., Y. Date, K. Kohashi, H. Yoshitomi, and Y. Tsuruta. 1996. Determination of total hydroxyproline and proline in human serum and urine by HPLC with fluorescence detection. Biol. Pharm. Bull. 19:163-166.[Medline]
23. Kappes, R. M., B. Kempf, and E. Bremer. 1996. Three transport systems for the osmoprotectant glycine betaine operate in Bacillus subtilis: characterization of OpuD. J. Bacteriol. 178:5071-5079.[Abstract/Free Full Text]
24. Kauffman, C. A., and S. F. Bradley. 1997. Epidemiology of community-acquired infection, p. 287-308. In K. B. Crossley and G. L. Archer (ed.), The staphylococci in human disease. Churchill Livingstone, New York, N.Y.
25. Kloos, W. E., and P. A. Pattee. 1965. Transduction analysis of the histidine region in Staphylococcus aureus. J. Gen. Microbiol. 39:195-207.[Medline]
26. Koujima, I., H. Hayashi, K. Tomochika, A. Okabe, and Y. Kanemasa. 1978. Adaptational change in proline and water content of Staphylococcus aureus after alteration of environmental salt concentration. Appl. Environ. Microbiol. 35:467-470.[Abstract/Free Full Text]
27. Kuroda, M., T. Ohta, I. Uchiyama, T. Baba, H. Yuzawa, I. Kobayashi, L. Cui, A. Oguchi, K. Aoki, Y. Nagai, J. Lian, T. Ito, M. Kanamori, H. Matsumaru, A. Maruyama, H. Murakami, A. Hosoyama, Y. Mizutani-Uti, N. K. Takahashi, T. Sawano, R. Inoue, C. Kaito, K. Dekimizu, H. Hirakawa, S. Kuhara, S. Goto, J. Yabuzaki, M. Kanehisa, A. Yamashita, K. Oshima, K. Furuya, C. Yoshino, T. Shiba, M. Hattori, N. Ogasawara, H. Hayashi, and K. Hiramatsu.2001. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet 357:1225-1240.[CrossRef][Medline]
28. Loeb, W. F., and F. W. Quimby. 1989. The clinical chemistry of laboratory animals. Pergamon Press, New York, N.Y.
29. Lowy, F. D. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 339:520-532.[Free Full Text]
30. Maloy, S. R., and J. R. Roth. 1983. Regulation of proline utilization in Salmonella typhimurium: characterization of put::Mu d(Ap, lac) operon fusions. J. Bacteriol. 154:561-568.[Abstract/Free Full Text]
31. Measures, J. C. 1975. Role of amino acids in osmoregulation of non-halophilic bacteria. Nature 257:398-400.[CrossRef][Medline]
32. Menzel, R., and J. R. Roth. 1981. Regulation of the genes for proline utilization in Salmonella typhimurium: autogenous repression by the putA gene product. J. Mol. Biol. 148:21-44.[CrossRef][Medline]
33. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
34. Miller, K. D., D. L. Hetrick, and D. J. Bielefeldt. 1977. Production and properties of Staphylococcus aureus (strain Newman D2C) with uniform clumping factor activity. Thromb. Res. 10:203-211.[CrossRef][Medline]
35. Novick, R. P. 1990. The Staphylococcus as a molecular genetic system, p. 1-40. In R. P. Novick (ed.), Molecular biology of the staphylococci. VCH Publishers, New York, N.Y.
36. Peter, H., A. Bader, A. Burkovski, C. Lambert, and R. Kramer. 1997. Isolation of the putP gene of Corynebacterium glutamicum and characterization of a low-affinity uptake system for compatible solutes. Arch. Microbiol. 168:143-151.[CrossRef][Medline]
37. Pourkomailian, B., and I. R. Booth. 1994. Glycine betaine transport by Staphylococcus aureus: evidence for feedback regulation of the activity of the two transport systems. Microbiology 140:3131-3138.[Abstract]
38. Ratzkin, B., M. Grabnar, and J. Roth. 1978. Regulation of the major proline permease gene of Salmonella typhimurium. J. Bacteriol. 133:737-743.[Abstract/Free Full Text]
39. Ross, D. L., and A. E. Neely. 1983. Textbook of urinalysis and bodily fluids. Appleton-Century-Crofts, Norwalk, Conn.
40. Rudin, L., J. E. Sjostrom, M. Lindberg, and L. Philipson. 1974. Factors affecting competence for transformation in Staphylococcus aureus. J. Bacteriol. 118:155-164.[Abstract/Free Full Text]
41. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
42. Schaeffer, A. J., W. R. Schwan, S. J. Hultgren, and J. L. Duncan. 1987. Relationship of type 1 pilus expression in Escherichia coli to ascending urinary tract infections in mice. Infect. Immun. 55:373-380.[Abstract/Free Full Text]
43. Schwan, W. R., and W. Goebel. 1994. Host cell responses to Listeria monocytogenes infection include differential transcription of host cell stress genes involved in signal transduction. Proc. Natl. Acad. Sci. USA 91:6428-6432.[Abstract/Free Full Text]
44. Schwan, W. R., J. L. Lee, F. A. Lenard, B. T. Matthews, and M. T. Beck. 2002. Osmolarity and pH growth conditions regulate fim gene transcription and type 1 pilus expression in uropathogenic Escherichia coli. Infect. Immun. 70:1391-1402.[Abstract/Free Full Text]
45. Schwan, W. R., K. J. Wetzel, T. S. Gomez, M. A. Stiles, B. D. Beitlich, and S. Grunwald. 2004. Low-proline environments impair growth, proline transport and in vivo survival of Staphylococcus aureus strain-specific putP mutants. Microbiology 150:1055-1061.[Abstract/Free Full Text]
46. Schwan, W. R., S. N. Coulter, E. Y. W. Ng, M. H. Langhorne, H. D. Ritchie, L. L. Brody, S. Westbrock-Wadman, A. S. Bayer, K. R. Folger, and C. K. Stover. 1998. Identification and characterization of the PutP proline permease that contributes to in vivo survival of Staphylococcus aureus in animal models. Infect. Immun. 66:567-572.[Abstract/Free Full Text]
47. Smith, T. L., M. L. Pearson, K. R. Wilcox, C. Cruz, M. V. Lancaster, B. Robinson-Dunn, F. C. Tenover, M. J. Zervos, J. D. Band, E. White, and W. R. Jarvis. 1999. Emergence of vancomycin resistance in Staphylococcus aureus. N. Engl. J. Med. 340:493-501.[Abstract/Free Full Text]
48. Spiegelhalter, F., and E. Bremer. 1998. Osmoregulation of the opuE proline transport gene from Bacillus subtilis: contributions of the sigma A- and sigma B-dependent stress-responsive promoters. Mol. Microbiol. 29:285-296.[CrossRef][Medline]
49. Townsend, D. E., and B. J. Wilkinson. 1992. Proline transport in Staphylococcus aureus: a high-affinity system and a low-affinity system involved in osmoregulation. J. Bacteriol. 174:2702-2710.[Abstract/Free Full Text]
50. von Blohn, C., B. Kempf, R. M. Kappes, and E. Bremer. 1997. Osmostress response in Bacillus subtilis: characterization of a proline uptake system (OpuE) regulated by high osmolarity and the alternative transcription factor sigma B. Mol. Microbiol. 25:175-187.[CrossRef][Medline]
51. Wengender, P. A., and K. J. Miller. 1995. Identification of a PutP proline permease gene homolog in Staphylococcus aureus by expression cloning of the high-affinity proline transport system in Escherichia coli. Appl. Environ. Microbiol. 61:252-259.[Abstract]
52. Wood, J. M. 1988. Proline porters effect the utilization of proline as nutrient or osmoprotectant for bacteria. J. Membr. Biol. 106:183-202.[CrossRef][Medline]
53. Wood, J. M., and D. Zadworny. 1979. Characterization of an inducible porter required for L-proline catabolism by Escherichia coli K12. Can. J. Biochem. 57:1191-1199.[Medline]


Infection and Immunity, January 2006, p. 399-409, Vol. 74, No. 1
0019-9567/06/$08.00+0     doi:10.1128/IAI.74.1.399-409.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article