IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, Y.
Right arrow Articles by Watanabe, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, Y.
Right arrow Articles by Watanabe, H.

 Previous Article  |  Next Article 

Infection and Immunity, October 2006, p. 5747-5755, Vol. 74, No. 10
0019-9567/06/$08.00+0     doi:10.1128/IAI.00724-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

A New Immunoglobulin-Binding Protein, EibG, Is Responsible for the Chain-Like Adhesion Phenotype of Locus of Enterocyte Effacement-Negative, Shiga Toxin-Producing Escherichia coli

Yan Lu,1 Sunao Iyoda,1* Hiromi Satou,1 Hitomi Satou,1 Kenichiro Itoh,2 Takehito Saitoh,2 and Haruo Watanabe1

Department of Bacteriology,1 Infectious Diseases Surveillance Center, National Institute of Infectious Diseases, Toyama 1-23-1, Shinjuku-ku, Tokyo 162-8640, Japan2

Received 4 May 2006/ Returned for modification 26 June 2006/ Accepted 12 July 2006


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Shiga toxin-producing Escherichia coli (STEC) are important enteropathogens causing severe diseases such as hemorrhagic colitis and hemolytic-uremic syndrome in humans. The majority of STEC strains of serogroups O157, O26, or O111 associated with severe cases of these diseases possess a pathogenicity island termed the locus of enterocyte effacement (LEE). LEE, which is responsible for the formation of attaching-and-effacing lesions on intestinal epithelial cells, is important for the full virulence of STEC. Nonetheless, LEE-negative STEC strains have repeatedly been reported to be associated with severe diseases in humans. In this study, we characterized adhesion to cultured epithelial cells of certain LEE-negative STEC isolated from humans with or without bloody diarrhea. Several LEE-negative STEC belonging to serogroup O91 showed an unusual, chain-like adhesion pattern to HEp-2 cells. Using Tn5-based transposon mutagenesis, we identified the gene essential for the chain-like adhesion phenotype of this O91 STEC strain. Sequence analysis of the Tn5-inserted allele identified a novel chromosomal open reading frame (ORF) encoding a polypeptide with a high degree of similarity to the E. coli immunoglobulin-binding (Eib) proteins EibA, -C, -D, -E, and -F. Therefore, the ORF was designated EibG. Laboratory E. coli strain MC4100 transformed with a multicopy plasmid carrying eibG showed chain-like adhesion to HEp-2 cells, and whole-cell lysates of the strain bound to human-derived immunoglobulin G (IgG) Fc and IgA. These results indicate that EibG acts as an IgG Fc- and IgA-binding protein, as well as an adhesin of LEE-negative STEC.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Shiga toxin-producing Escherichia coli (STEC) are associated with the development of severe diseases in humans including hemorrhagic colitis and hemolytic-uremic syndrome (17, 22, 27). Shiga toxin (Stx), a key virulence factor of STEC, can be classified into two distinct immunological subgroups, Stx1 and Stx2 (32, 35). The higher mortality rate associated with STEC infections distinguishes them from other diarrheagenic E. coli strains such as enterotoxigenic E. coli, enteropathogenic E. coli, enteroaggregative E. coli (EAEC), and enteroinvasive E. coli (22).

More than 200 different serotypes have been identified as STEC (16). Serogroups O157, O26, and O111 predominate in outbreaks of hemorrhagic colitis and hemolytic-uremic syndrome in some countries (11). The majority of these serogroups possess virulence genes located in the chromosomal locus of enterocyte effacement (LEE), which encodes virulence-related proteins, including type III protein secretion system (TTSS), effector proteins secreted through LEE-encoded TTSS, translocator proteins essential for targeting effector molecules into the host cells, and their chaperones (7, 8, 19).

Another gene in the LEE encodes an adhesin called Intimin (15). Tir, which is encoded within LEE, is secreted and targeted into host cell membranes via LEE-encoded TTSS and acts as an Intimin-specific receptor (18). Although LEE-gene functions are essential for intimate adhesion of E. coli to cultured epithelial cells and are important for full virulence of STEC (reviewed in references 9 and 22), LEE-negative STEC strains have been repeatedly reported to be associated with severe disease in humans (reviewed in reference 27). Virulence genes and their mechanisms in LEE-negative strains remain predominantly undetermined.

Although Stx is the most important virulence factor of STEC, adhesin is also important for establishing the initial stage of infection. Several studies of adhesin in STEC have determined that long polar fimbriae (Lpf) are present in certain strains of various serogroups of E. coli (40, 42, 43). Although it has been demonstrated that a cloned lpf operon introduced into a nonfimbriated E. coli laboratory strain resulted in adherence to cultured epithelial cells, the role of Lpf in STEC strain remains unclear (42).

Nonfimbrial adhesins other than Intimin have been also reported in STEC strains. Efa1, which mediates the attachment of clinical O111:HNM STEC to cultured hamster ovary cells (23), also influences the colonization of STEC O5 and O11 to bovine intestine (34). ToxB, encoded on a 93-kbp plasmid in STEC strain O157:H7, shares sequence similarity with Efa1 (39). Iha, initially identified as an adhesin in the LEE-positive STEC strain O157:H7 (38), is distributed widely among STEC strains, including LEE-negative STEC of various serotypes (41). STEC autoagglutinating adhesin (Saa), the first adhesin identified in a LEE-negative STEC strain (26), exhibits a low degree of similarity with YadA of Yersinia enterocolitica and Eib, E. coli immunoglobulin-binding protein A, C, D, E, and F (26, 28, 29).

Several distinct patterns of diarrheagenic E. coli binding to cultured epithelial cells have been reported: localized adhesion associated with LEE-positive enteropathogenic E. coli or enterohemorrhagic E. coli infection, diffused adhesion, and aggregative adherence associated with EAEC infection (reviewed in reference 22). Recently, another adherence pattern termed chain-like adhesion (CLA), was reported for E. coli cells that were isolated from humans with or without diarrhea and that attach to HEp-2 cells and form chain-like aggregates (10). Several (but not all) E. coli strains that demonstrate CLA possess putative EAEC virulence marker genes and are hypothesized to be related to EAEC (10).

In the present study, we investigated several STEC strains belonging to serogroup O91 that were isolated from humans with or without bloody diarrhea and that adhered to HEp-2 cells in a CLA pattern. Screens of transposon-mutagenized E. coli identified the gene, designated eibG, which is responsible for the CLA phenotype. eibG encodes a 508-amino-acid protein with a high degree of similarity to Eib proteins. Our analysis indicates that EibG is a new immunoglobulin-binding protein that also acts as an adhesin in certain strains of LEE-negative STEC.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial strains and media. All STEC O157, O26, O111, and O91 strains used in the present study were isolated from humans. The Stx1-producing O91 E. coli strain, ST91-1, was isolated from a patient with bloody diarrhea. The reference E. coli strain, ECOR2, and ECOR9 were provided by Thomas Whittam (Michigan State University). The E. coli K-12 strains JM109, JM109{lambda}pir, and MC4100 were used for cloning and expression studies. Bacteria were routinely grown in Luria-Bertani (LB) or on LB agar plates at 37°C, unless stated otherwise. For selection or screening of recombinant E. coli clones, LB medium was supplemented with either 50 µg of ampicillin/ml, 25 µg of kanamycin/ml, or 50 µg of X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside)/ml.

Serotyping. Serotyping of STEC strains was performed by using standard methods described previously (24, 41). Antisera used for serotyping were prepared at the National Institute of Infectious Diseases (NIID).

Transposon mutagenesis, screening, and rescue of interrupted genes. The STEC O91 strain, ST91-1, was mutagenized with the EZ::TN <R6K{gamma}ori/KAN-2> Tnp transposome (Epicenter) according to the manufacturer's instructions. Briefly, electrocompetent ST91-1 cells were transformed with 1 µl of the Tnp transposome. Transposon-inserted bacterial colonies that grew on LB agar plates containing kanamycin were screened for their adhesion phenotype to HEp-2 cells as described below. The region flanking the transposon-inserted allele containing R6K{gamma}ori was cloned as follows. Genomic DNA of the mutant strain, digested with EcoRI and self-ligated, was then used for transformation of JM109{lambda}pir. Rescued DNA plasmids were purified and sequenced by using transposon-specific primers R6KAN-2 RP-1 and KAN-2 FP-1 (Epicenter).

DNA manipulation. Standard procedures, including PCR and DNA sequencing, were performed as described previously (13, 14). PCR product was purified by using a QIAGEN PCR purification kit. Distribution of the eibG gene was examined by PCR using the primers 1114orf1Fp (5'-ATCGGCTTTCATCGCATCAGGAC-3') and 1114orf1Rp (5'-CCACAAGGCGGGTATTCGTATC-3'). The PCR conditions were as follows: 94°C for 2 min, followed by 25 cycles of 94°C for 45 s, 60°C for 1 min, and 72°C for 1 min, with a final extension at 72°C for 10 min.

Construction of an isogenic eibG mutant. A one-step inactivation method with PCR product (6) was used to construct an isogenic ST91-1 eibG mutant (only deleting EibG coding sequences but not the flanking ones). PCR products amplified from pKD4 with primers 1114orf1H1P1 (5'- TTCTTTATGAGTGTGAGGTGTTGCGGCTGATTTGTATACAGATAAGTGTAGGCTGGAGCTGCTTC-3') and 1114orf1H2P2 (5'- GCAAAACTCCACGCCTGCCGTCATGCTTCATGTCACTGTCAGCAACATATGAATATCCTCCTTAGT-3'), which flank the 5' and 3' termini of eibG gene with 45 bp of homology, were electroporated into ST91-1 carrying pKD46. The mutant locus was verified by PCR using three different primer sets: orf1Fw (5'-GTGAGCAGGTATGCCCAGAAT-3')/k1 (6), orf1Fw/orf1Rw (5'-CGGGTCGCCAGAATCACTTT-3'), and k2 (6)/orf1Rw. The FRT-flanked kanamycin cassette was removed after transformation with pCP20 as described previously (6).

Construction of eibG complementation plasmid. The eibG gene, amplified from strain ST91-1 using the primers orf1Fw and orf1Rw (including 148 bp upstream of the eibG start codon), was inserted into pGEM-T-Easy (Promega) to yield pGEMEBG. The negative control was pGEM-self (14).

HEp-2 cell adherence test. HEp-2 cells maintained in Dulbecco modified Eagle medium (DMEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS; Invitrogen) were plated onto coverslips in a 96-well microtiter plates (Corning) or chamber slides (Lab-Tek II Chamber Slide System; Nalge Nunc International) at a density of 105 cells/ml and then incubated at 37°C for 16 h in the presence of 5% CO2. After washing the HEp-2 cells three times in DMEM without FBS, 107 bacterial cells were inoculated into each well or slide containing FBS-free DMEM, and the cells were incubated for 1 h at 37°C in the presence of 5% CO2. The cells were then washed three times with phosphate-buffered saline (PBS) and incubated for another 3 h. The monolayers were then washed three times with PBS, and the cells were fixed with 100% methanol or 4% paraformaldehyde in PBS for 30 min and then stained with Giemsa solution for 45 min. For quantification of bacterial adhesion to HEp-2 cells, 1% Triton X-100 was added, and the cells were incubated at room temperature for 30 min, after which sequential dilutions were plated onto LB agar plates for growing and counting CFU. The assay, performed in duplicate, was repeated at least three times.

Immunodection assay. Centrifuged bacterial cell pellets from overnight cultures were dissolved in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer including 2% SDS (12) and then heated at 100°C for 10 min. Total cell proteins resolved on a 4 to 20% gradient SDS-polyacrylamide gel were transferred to Immobilon-P (polyvinylidene difluoride [PVDF]) membrane (Millipore). Immunodetection of immunoglobulin-binding bacterial proteins was performed by using the ECL Western blotting system (Amersham) without primary antibody against Eib proteins, as described previously (31). For this purpose, purified human IgG Fc-conjugated with horseradish peroxidase (HRP; Jackson Immunoresearch Laboratories) was used at a concentration of 20 ng/ml, human IgA (serum)-HRP (Jackson Immunoresearch Laboratories) was used at 100 ng/ml, and human IgM (whole molecule)-HRP (Rockland) was used at 4 µg/ml. Anti-DnaK monoclonal antibody was purchased from Stressgen (Canada).

Sequence analysis. DNA sequence analysis was performed on a PE 310 or PE 3100 DNA automated sequencer (Perkin-Elmer). Nucleotide sequence data were analyzed by using GENETYX software ver 7.0 (GENETYX, Japan) as described previously (13). BLAST searches were performed at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/BLAST), and protein domains were predicted by using the Pfam database (http://pfam.wustl.edu) (1). The location of a signal peptide cleavage site was predicted by using the SignalIP 3.0 server (http://www.cbs.dtu.dk/services/SignalP/) (2) and GENETYX version 7.0.

Nucleotide sequence accession numbers. The DNA sequence described in the present study has been deposited in the DDBJ under accession number AB255744.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of a LEE-negative STEC strain that shows chain-like adhesion to HEp-2 cells. To elucidate virulence traits of LEE-negative STEC strains, the adherence properties of those strains to cultured epithelial cells were examined as described in Materials and Methods. After 3 h of infection, Giemsa staining showed several LEE-negative STEC strains (5 of 32 strains with various serotypes [data not shown]) with unusual patterns of binding to HEp-2 cells (Fig. 1A and B). Because the binding pattern was similar to the previously described "chain-like adhesion" (CLA) pattern of several E. coli strains isolated from humans with or without diarrhea (10), we designated these strains CLA-STEC. HeLa and T84 cells, which were also observed in adherence assays, confirmed the same CLA phenotype on their surface (data not shown).


Figure 1
View larger version (90K):
[in this window]
[in a new window]
 
FIG. 1. Adherence of STEC O91 strain to HEp-2 cells (Giemsa stain). Strain: A and B, ST91-1; C, ST91-1G; D, ST91-1G/pGEMEBG. Magnification: A, C, and D, x400; B, x1,000.

 
O-serogroup analysis revealed that the five CLA-STEC identified above all belonged to serogroup O91, although each of the strains was isolated independently and showed distinct pulsed-field gel electrophoresis patterns of XbaI-digested genomic DNA (our unpublished results). Since seven of the nine CLA strains isolated previously had been shown to react with EAEC marker probes (10) and because the CLA pattern appeared to be similar to the binding pattern of EAEC, we suspected that these O91 CLA-STEC strains also possessed putative EAEC virulence marker genes.

PCR amplifications of template DNA from the O91 CLA-STEC strains were negative with primers specific to astA (encoding heat-stable enterotoxin [EAST1]), pet (encoding plasmid-encoded enterotoxin), aggA (encoding the pilin of enteroaggregative fimbriae I [AAF/I]), aggC (encoding the usher of the AAF/I), aafA (encoding the pilin of AAF/II), and aspU (encoding EAEC secreted protein U) genes, as well as aggR, which encodes a positive regulator for the expression of AAF/I, II, and III (3, 5, 20, 21) (data not shown). All primer sequences noted above and the conditions of each PCR were as described previously (10). In addition, the O91 STEC did not possess genes encoding Saa or Efa1, both of which have been shown to act as nonfimbrial adhesins in certain STEC strains (23, 26). We hypothesized that the O91 STEC strains express a new adhesin responsible for the CLA phenotype.

Transposon mutagenesis to screen for adhesion-defective mutants of O91 STEC. To identify a gene responsible for the CLA phenotype, we performed transposon mutagenesis on a parent O91 CLA-STEC strain (ST91-1) isolated from a patient with bloody diarrhea and screened for adhesion-defective mutants. Among 5,600-transposon-inserted mutants screened, several mutants that did not adhere to HEp-2 cells were isolated. The transposon-inserted locus of each mutant was cloned, and insertion flanking regions were sequenced. Transposons in two mutants were found to have inserted into different sites (between bp 167 and 168 and between bp 1488 and 1489 from the initial codon) of the same 1,524-bp open reading frame (ORF) encoding a 508-amino-acid polypeptide. Although these two mutants showed growth rates comparable to that of the parent strain in LB media, they were defective in adherence (data not shown).

BLASTP analysis revealed that the ORF was highly similar to EibACDEF immunoglobulin-binding proteins of E. coli (Fig. 2) (28, 29). We therefore designated the ORF as EibG. Similarities between EibG and EibC, -D, and -E were slightly higher (68%) than between EibG and EibA and -F (45%) (Fig. 2), although C-terminal amino acids 393 to 508 of EibG corresponded exactly to amino acids 372 to 487 of EibF. Like other Eib proteins, a putative signal peptide that is likely to be cleaved between amino acids 27 and 28 is located at the EibG N terminus (Fig. 2).


Figure 2
View larger version (85K):
[in this window]
[in a new window]
 
FIG. 2. Multiple alignment of amino acid sequences of Eib proteins. GENETYX software version 7.0 was used for analysis. Alignment of predicted amino acid sequences of EibA (accession no. AAF63234), EibC (AAF63035), EibD (AAF63040), EibE (AAF63045), EibF (AAL31493), and EibG. The numbers on the right indicate the position within the amino acid sequence for each Eib protein. The arrow indicates the predicted signal peptide cleavage site. Amino acid residues conserved in more than three proteins are indicated by boxes. Bars indicate gaps. Four Hep_Hag repeat domains are underlined and are numbered through 1 to 4.

 
Amino acids 151 to 508 of EibG exhibited 31% identity and 44% similarity (with 15% gaps) with amino acids 37 to 422 of YadA, a plasmid-encoded adhesin of Yersinia enterocolitica (4, 37). Furthermore, amino acids 242 to 504 of EibG exhibited 28% identity and 42% similarity with amino acids 187 to 508 of STEC autoagglutinating adhesin (Saa). Amino acids 178 to 293 of EibG were found by Pfam (1) to encode four repeats of the seven-residue Hep_Hag motif (ATGANST/AIGSNAV/ASGENSV/ALGGNAL) frequently found in bacterial hemagglutinin and invasin proteins (Fig. 2). The C-terminal nine amino acids of EibG are alternating aligned hydrophobic residues that end with phenylalanine (YNMGVNFEF; Fig. 2), which form a conserved motif among all Eib proteins that has been reported to target proteins to the outer membrane (36).

Sequence analysis of flanking region of eibG. The 6.5-kb EcoRI fragment containing eibG encoded seven additional ORFs. Like the eibA- and the eibC-linked regions (28, 30), eibG appears to be located at the end of the prophage genome (Fig. 3A). The organization of Lom, ORF-156, and ORF-60 in the eibG-linked region is the same as in eibA and eibC, although the sequences between lom and eibG and downstream of ORF-60 are not the same as eibA- and eibC-flanking regions (Fig. 3A). These facts suggest that eibG may also be part of a prophage genome like the other eib genes.


Figure 3
View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3. (A) Gene organization of the eibG-linked region. The solid arrows indicate common ORFs among the eibA-, eibC-, and eibG-linked regions. The dashed arrows indicate distinct-sized ORFs in the eibG-linked region. The number above the arrow indicates the number of amino acids encoded by the ORF. (B) Phylogenetic tree was generated by using UPGMA (unweighted pair-group method with arithmetic averages). The numbers indicate the percent identity.

 
The far-right sequence flanking eibG was identical to E. coli K-12 and identifies the transposon insertion boundary at min 21.6 of the E. coli K-12 genome, interrupting the ycbW gene. The prophage insertion boundaries for eibA (28.3 min) and eibC (42.0 min) interrupt yciD and yecE, respectively.

Isolation of an eibG isogenic mutant and analysis of its adhesion phenotype. To confirm that eibG gene function is responsible for the CLA phenotype of certain O91 STEC strains, we constructed an isogenic deletion mutant of eibG in the parent O91 STEC ST91-1, as described in Materials and Methods. The mutant strain, designated ST91-1G, did not adhere to HEp-2 cells (Fig. 1C), whereas ST91-1G transformed with pGEMEBG, which carries only eibG, restored the CLA phenotype (Fig. 1D). These results suggest that EibG is responsible for CLA phenotype and acts as an adhesin of O91 STEC to HEp-2 cells. However, we can alternatively hypothesize that the EibG mediates the chain elongation phenotype but not the HEp-2 cell adhesin. We therefore examined whether a nonadherent E. coli laboratory strain can acquire the CLA phenotype when pGEMEBG (expressing only the EibG) was introduced into E. coli K-12 strain MC4100. As shown in Fig. 4A and B, only the eibG conferred the CLA phenotype to MC4100. These results indicate that EibG is responsible for the CLA phenotype and that EibG acts as an adhesin in an E. coli K-12 strain. Strains ST91-1 and ST91-1G with pGEMEBG, but not ST91-1G alone, showed autoagglutinating activity when cultured in LB medium without shaking (data not shown), indicating that EibG also mediates autoagglutination.


Figure 4
View larger version (113K):
[in this window]
[in a new window]
 
FIG. 4. Adherence of E. coli strain to HEp-2 cells (Giemsa stain). Strain: A, MC4100/pGEM-self; B, MC4100/pGEMEBG; C, ECOR-2; D, ECOR-9.

 
Immunoglobulin-binding activity of O91 CLA-STEC. Because EibG is highly similar to EibACDEF, which exhibits immunoglobulin-binding activity, we tested the IgG- and IgA-binding activity of EibG. Whole-cell lysates were boiled and fractionated by SDS-PAGE, blotted to PVDF membrane, and probed directly with human-derived IgG Fc-, IgA-, and IgM-HRP as described in Materials and Methods. Cell lysates resolved by SDS-PAGE and containing EibG showed a large polypeptide (>250 kDa) that bound both IgG Fc and IgA (Fig. 5A and B). Because the predicted molecular mass of EibG is 54 kDa, we hypothesize that the larger protein band is a multimer of EibG, similar to reported multimers of other Eib proteins (28) and YadA (4, 37, 44).


Figure 5
View larger version (77K):
[in this window]
[in a new window]
 
FIG. 5. Immunoglobulin-binding activity of EibG. Whole-cell lysates of bacteria were fractionated by SDS-PAGE, transferred to PVDF membrane, and then probed directly with human IgG Fc-HRP (A) or human serum IgA-HRP (B). (C) The amount of control DnaK protein in each whole-cell lysate was examined by standard Western blotting with monoclonal anti-DnaK antibody. Strain: lanes 1, ST91-1; lanes 2, ST91-1G; lanes 3, MC4100/pGEMEBG; lanes 4, MC4100/pGEM-self; lanes 5, ECOR-2; lanes 6, ECOR-9.

 
Whole-cell lysates of the O91 STEC strain ST91-1 bound human-derived IgG Fc-HRP such as those of ECOR-2 (eibF-positive) and ECOR-9 (eibACDE-positive) strains, but the binding ability of ST91-1 was lower than ECOR-2 and ECOR-9 strains when comparable amounts of lysates were loaded (Fig. 5A and C). No proteins from ST91-1G and MC4100 showed IgG Fc-binding activity, whereas both of these strains with pGEMEBG acquired IgG Fc-binding activity (Fig. 5A and data not shown). When human-derived IgA-HRP was used, ST91-1 control lysates did not show IgA-binding activity, but protein from pGEMEBG-transformed MC4100 bound IgA similar to ECOR-2 and ECOR-9. These results indicate that EibG is a new IgG Fc- and IgA-binding protein of E. coli. As reported previously for other Eib proteins, EibG did not confer any detectable IgM-binding activity to any strains examined (data not shown).

Due to the high similarity between EibG and other Eib proteins, we examined the HEp-2 adhesion phenotype of ECOR-2 (eibF-positive) and ECOR-9 (eibACDE-positive) strains. As shown in Fig. 4C, ECOR-2 binds HEp-2 cells in a CLA pattern, similar to bacteria expressing eibG. ECOR-9 also binds to HEp-2 cells, but not in a typical CLA pattern (Fig. 4D). Since eibG is not found in ECOR-2 and ECOR-9 (data not shown), binding to HEp-2 may be due to the presence of EibF in ECOR-2 and EibACDE in ECOR-9.

Quantitative HEp-2 adherence assay. We measured EibG-dependent adherence by using the quantitative assay described in Materials and Methods. As shown in Fig. 6, the total adherence of wild-type strain (ST91-1) cells per single HEp-2 cell (as shown by CFU/HEp-2 cell) was 61 ± 9.6 (mean ± the standard deviation). This was significantly larger than the 0.37 ± 0.17 per HEp-2 cell adherence of ST91-1G. MC4100 with pGEMEBG exhibited a total adherence of 36 ± 9.9 per cell, whereas the adherence of MC4100 carrying pGEM-self was only 0.29 ± 0.14. These results confirm that EibG acts as an adhesin to HEp-2 cells in STEC and the E. coli laboratory strain, MC4100.


Figure 6
View larger version (14K):
[in this window]
[in a new window]
 
FIG. 6. Quantitative HEp-2 adherence assay. Each bar represents the mean of three independent experiments with standard deviations. The number of microcolonies is indicated by CFU per 106 of HEp-2 cells. Strain: wild type, ST91-1; {Delta}eibG, ST91-1G; MC4100/vector, MC4100/pGEM-self; MC4100/eibG+, MC4100/pGEMEBG.

 
Distribution of EibG in STEC strains. To examine the distribution of the eibG gene in other STEC strains, we have designed PCR primers (as described in Materials and Methods) that amplify the eibG gene specifically and do not cross-react with eibACDEF genes (data not shown). Because the five CLA-STEC strains that were initially identified are all in the O91 serogroup, we examined the distribution of eibG in other O91 STEC strains, as well as in O157, O26, and O111 STEC strains. All LEE-positive STEC in the O157, O26, and O111 serogroups were negative for eibG (Table 1) . Among the 36 O91 STEC strains isolated from humans (34 healthy individuals and 2 patients with diarrhea or bloody diarrhea), all were LEE-negative and 23 were eibG positive. None of the eibG-positive O91 STEC strains possessed the saa gene, whereas the saa-positive O91 STEC strains (n = 9) were all eibG negative (Table 1). A CLA-positive HEp-2 adhesion phenotype was observed in all eibG-positive O91 STEC strains (n = 23) but not in any eibG-negative strains (data not shown), demonstrating a strong correlation between the presence of eibG and a CLA phenotype on HEp-2 cells. We have also found that several strains of LEE-negative STEC belonging to serogroups other than O91 were positive for eibG by PCR analysis (our unpublished results).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Distribution of eae, eibG, and saa genes among various serogroups of STEC

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunoglobulin-binding proteins of E. coli have been identified in commensal E. coli strains, such as ECOR-2 and ECOR-9 (28, 29). The Eib proteins identified thus far share common features, such as IgG Fc- and/or IgA-binding and stable multimerization. However, to our knowledge, Eib has never been described as an adhesin to host mammalian cells. In the present study, a new Eib protein EibG, was identified in screens for adhesins that confer a CLA phenotype to O91 STEC.

We demonstrated that not only the O91 STEC strain possessing EibG but also both ECOR-2 (EibF) and ECOR-9 (EibACDE) adhered tightly to HEp-2 cells. These results suggest that the function of cultured epithelial cell adhesin may be maintained among all Eib proteins. Given that they share structural similarities to Saa and YadA (which act as adhesins of STEC and Yersinia, respectively [4, 26, 37]), Eib proteins appear to play a similar role and belong to the same group of non-fimbria-associated bacterial adhesins.

Although eibG-positive bacteria were able to autoagglutinate, the morphology of autoagglutinating bacteria was not like that of bacteria in the presence of HEp-2 cells (data not shown), since they form clumps with or without very short chains (data not shown). It is not known whether living host cells are necessary for inducing or developing the formation of CLA.

One of the transposon-insertion sites was located near the end of eibG gene (45 bp upstream from the stop codon). Because the C-terminal nine amino acids of Eib proteins have been hypothesized to be essential for targeting proteins to the outer membrane (36), this mutant may be mislocalized and therefore unable to adhere to HEp-2 cells. Consistent with this hypothesis, EibG (as well as the other Eib proteins) shares a highly conserved C-terminal 432- to 508-amino-acid sequence with that of YadA, which is essential for its localization to the outer membrane (37).

Sandt and Hill (29) reported that a 60-amino-acid C-terminal truncation of EibF retained IgG Fc- and IgA-binding activities but no longer formed multimers. These results suggest that the domain essential for multimerization is separate from the domain for IgG Fc and IgA binding. These authors also showed that the residues essential for IgG Fc-binding activity of EibA and -F are amino acids 254 to 344 and amino acids 318 to 459, respectively (29). Sequence comparisons revealed that these two segments are common to all Eib proteins, including EibG, and that the IgG Fc-binding region appears to be conserved among Eib proteins. In contrast, the IgA-binding activity of Eib proteins was confirmed in lysates containing EibC, -D, -F, and -G; barely detectable in EibE-containing lysates; and undetectable in EibA-containing lysates, respectively (29) (Fig. 4B). Using the IgA-binding domain of EibF (amino acids 181 to 280 [29]), we searched for homologies in the database by using BLASTP analysis. This segment of EibF shared homology with amino acids 269 to 346 (35% identity and 56% positivity) and amino acids 303 to 383 (34 and 46%) of EibD and with amino acids 262 to 339 (35 and 56%) and amino acids 296 to 376 (34 and 46%) of EibC, but not with EibA, -E, and -G (data not shown). These results suggest that the IgA-binding activity of EibC, -D, and -F is conferred by a motif common to these three proteins, whereas the IgA binding of EibG may be unique.

Eib proteins have commonly been found to form heat-stable multimers in SDS-PAGE. Disulfide cross-linking bonds do not appear to be essential for this effect, since EibG does not contain cysteine residues like the other Eib proteins and YadA. The predicted mass of YadA is 47 kDa, but its apparent mass upon SDS-PAGE is 160 to 250 kDa, suggesting that YadA forms heat-stable trimers or tetramers (44). Similarly, the molecular mass of EibG on SDS-PAGE was greater than 250 kDa. Given that the predicted mass of an EibG monomer is 54 kDa, EibG may also form heat-stable multimers (pentamers or hexamers) in STEC O91 and the E. coli K-12 strain, MC4100.

Although all LEE-positive STEC strains do not possess eibG (Table 1; unpublished results), all eibG-positive O91 STEC strains of various H types showed the CLA phenotype, indicating that the presence of eibG correlates positively with the CLA phenotype. We also found that eibG-positive STEC strains possess neither eae nor saa genes. Because the saa gene is detectable only in LEE-negative STEC strains (26, 41), the presence of saa, eae, or eibG may be mutually exclusive among STEC.

The association between eibG and disease may be low because most of the O91 STEC strains examined in the present study were isolated from asymptomatic carriers, and only 2 of 36 strains were isolated from patients with diarrhea or bloody diarrhea (strain ST91-1). Shiga toxin type may be one reason for the lack of symptoms, since all of the O91 STEC strains tested thus far had only the stx1 gene, and there were no strains with stx2. The epidemiological data suggest that the presence of Stx2 appears to associate with more severe disease than Stx1 (25, 33). Nonetheless, EibG acts as an adhesin for cultured epithelial cells in certain O91 strains of STEC. Given that eibG is encoded by a prophage, it may be an important virulence factor if lysogenized in Stx2-carrying strains or in cases where EibG-positive E. coli are recipients of Stx2-converting phage.

In the present study, we have identified a new E. coli immunoglobulin-binding protein EibG that also acts as an adhesin for the formation of chain-like adherents to cultured epithelial cells. EibG and other Eib proteins in ECOR strains seem to act as adhesins, so that Eib proteins may allow commensal E. coli, as well as STEC, to successfully colonize the intestine. Further study of the presence or absence of eib genes in various STEC and commensal E. coli strains will help elucidate the role of Eib proteins in human pathogenesis.


    ACKNOWLEDGMENTS
 
We are grateful to all of the prefectural and local health institutes of Japan for providing the STEC strains; Thomas Whittam (Michigan State Univ) provided the ECOR2 and ECOR9 strains. We thank Kazumiti Tamura (NIID), Nobuko Takai (NIID), Jun Terajima (NIID), Sayaka Takeshita (NIID), Satsuki Kojima (NIID), Claudia Toma (Ryukyu University), Hiroyuki Abe (Osaka University), Nobuo Koizumi (NIID), and Makoto Ohnishi (NIID) for helpful discussions and/or technical assistance.

This study was supported by grants-in-aid for scientific research from the Ministry of Health, Labor, and Welfare of Japan (H18-Sinkou-ippan-019); the Ministry of Education, Culture, Science, and Technology of Japan; and the Japan Health Science Foundation. Y.L. was supported by fellowship from the Japan Health Science Foundation.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Bacteriology, National Institute of Infectious Diseases, Toyama 1-23-1, Shinjuku-ku, Tokyo 162-8640, Japan. Phone: 81-3-5285-1111. Fax: 81-3-5285-1163. E-mail: siyoda{at}nih.go.jp. Back

Editor: J. T. Barbieri


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Bateman, A., L. Coin, R. Durbin, R. D. Finn, V. Hollich, S. Griffiths-Jones, A. Khanna, M. Marshall, S. Moxon, E. L. Sonnhammer, D. J. Studholme, C. Yeats, and S. R. Eddy. 2004. The Pfam protein families database. Nucleic Acids Res. 32:D138-D141.[Abstract/Free Full Text]
2. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340:783-795.[CrossRef][Medline]
3. Bernier, C., P. Gounon, and C. Le Bougue,nec. 2002. Identification of an aggregative adhesion fimbria (AAF) type III-encoding operon in enteroaggregative Escherichia coli as a sensitive probe for detecting the AAF-encoding operon family. Infect. Immun. 70:4302-4311.[Abstract/Free Full Text]
4. Bliska, J. B., M. C. Copass, and S. Falkow. 1993. The Yersinia pseudotuberculosis adhesin YadA mediates intimate bacterial attachment to and entry into HEp-2 cells. Infect. Immun. 61:3914-3921.[Abstract/Free Full Text]
5. Czeczulin, J. R., S. Balepur, S. Hicks, A. Philips, R. Hall, M. H. Kothary, F. Navarro-Garcia, and J. P. Nataro. 1997. Aggregative adherence fimbria II, a second fimbrial antigen mediating aggregative adherence in enteroaggregative Escherichia coli. Infect. Immun. 65:4135-4145.[Abstract]
6. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
7. Deng, W., J. L. Puente, S. Gruenheid, Y. Li, B. A. Vallance, A. Vazquez, J. Barba, J. A. Ibarra, P. O'Donnell, P. Metalnikov, K. Ashman, S. Lee, D. Goode, T. Pawson, and B. B. Finlay. 2004. Dissecting virulence: systematic and functional analyses of a pathogenicity island. Proc. Natl. Acad. Sci. USA 101:3597-3602.[Abstract/Free Full Text]
8. Elliott, S. J., L. A. Wainwright, T. K. McDaniel, K. G. Jarvis, Y. K. Deng, L. C. Lai, B. P. McNamara, M. S. Donnenberg, and J. B. Kaper. 1998. The complete sequence of the locus of enterocyte effacement (LEE) from enteropathogenic Escherichia coli E2348/69. Mol. Microbiol. 28:1-4.[CrossRef][Medline]
9. Frankel, G., A. D. Phillips, I. Rosenshine, G. Dougan, J. B. Kaper, and S. Knutton. 1998. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol. Microbiol. 30:911-921.[CrossRef][Medline]
10. Gioppo, N. M., W. P. Elias, Jr., M. C. Vidotto, R. E. Linhares, H. O. Saridakis, T. A. T. Gomes, L. R. Trabulsi, and J. S. Pelayo. 2000. Prevalence of HEp-2 cell-adherent Escherichia coli and characterisation of enteroaggregative E coli and chain-like adherent E. coli isolated from children with or without diarrhoea, in Londrina, Brazil, FEMS Microbiol. Lett. 190:293-298.
11. Griffin, P. M., and R. V. Tauxe. 1991. The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic-uremic syndrome. Epidemiol. Rev. 13:60-98.[Medline]
12. Iyoda, S., and K. Kutsukake. 1995. Molecular dissection of the flagellum-specific anti-sigma factor, FlgM, of Salmonella typhimurium. Mol. Gen. Genet. 249:417-424.[CrossRef][Medline]
13. Iyoda, S., and H. Watanabe. 2004. Positive effects of multiple pch genes on expression of the locus of enterocyte effacement genes and adherence of enterohaemorrhagic Escherichia coli O157:H7 to Hep-2 cells. Microbiology 150:2357-2371.[Abstract/Free Full Text]
14. Iyoda, S., and H. Watanabe. 2005. ClpXP protease controls expression of the type III protein secretion system through regulation of RpoS and GrlR levels in enterohemorrhagic Escherichia coli. J. Bacteriol. 187:4086-4094.[Abstract/Free Full Text]
15. Jerse, A. E., J. Yu., B. D. Tall, and J. B. Kaper. 1990. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc. Natl. Acad. Sci. USA 87:7839-7843.[Abstract/Free Full Text]
16. Johnson, R. P., R. C. Clarke, J. B. Wilson, S. C. Read, K. Rahn, S. A. Renwick, K. A. Sandhu, D. Alves, M. A. Karmali, H. Lior, S. A. McEwen, J. S. Spika, and C. L. Gyles. 1996. Growing concerns and recent outbreaks involving non-O157:H7 serotypes of verotoxigenic Escherichia coli. J. Food Prot. 59:1112-1122.
17. Karmali, M. A. 1989. Infection by verocytotoxin-producing Escherichia coli. Clin. Microbiol. Rev. 2:15-38.[Abstract/Free Full Text]
18. Kenny, B., R. DeVinney, M. Stein, D. J. Reinscheid, E. A. Frey, and B. B. Finlay. 1997. Enteropathogenic Escherichia coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell 91:511-520.[CrossRef][Medline]
19. McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. USA 92:1664-1668.[Abstract/Free Full Text]
20. Nataro, J. P., Y. Deng, Y. Deng, and K. Walker. 1994. AggR, a transcriptional activator of aggregative adherence factor I expression. J. Bacteriol. 176:4691-4699.[Abstract/Free Full Text]
21. Nataro, J. P., Y. Deng, D. R. Maneval, A. L. German, W. C. Martin, and M. M. Levine. 1992. Aggregative adherence fimbriae I of enteroaggregative Escherichia coli mediate adherence to HEp-2 cells and hemagglutination of human erythrocytes. Infect. Immun. 60:2297-2304.[Abstract/Free Full Text]
22. Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142-201.[Abstract/Free Full Text]
23. Nicholls, L., T. H. Grant, and R. M. Robins-Browne. 2000. Identification of a novel genetic locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells. Mol. Microbiol. 35:275-288.[CrossRef][Medline]
24. Ørskov F., and I. Ørskov. 1984. Serotyping of Escherichia coli. Methods Microbiol. 14:43-112.
25. Ostroff, S. M., P. I. Tarr, M. A. Neill, J. H. Lewis, N. Hargrett-Bean, and J. M. Kobayashi. 1989. Toxin genotypes and plasmid profiles as determinants of systemic sequelae in Escherichia coli O157:H7 infections. J. Infect. Dis. 160:994-998.[Medline]
26. Paton, A. W., P. Srimanote, M. C. Woodrow, and J. C. Paton. 2001. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect. Immun. 69:6999-7009.[Abstract/Free Full Text]
27. Paton, J. C., and A. W. Paton. 1998. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin. Microbiol. Rev. 11:450-479.[Abstract/Free Full Text]
28. Sandt, C. H., and C. W. Hill. 2000. Four different genes responsible for nonimmune immunoglobulin-binding activities within a single strain of Escherichia coli. Infect. Immun. 68:2205-2214.[Abstract/Free Full Text]
29. Sandt, C. H., and C. W. Hill. 2001. Nonimmune binding of human immunoglobulin A (IgA) and IgG Fc by distinct sequence segments of the EibF cell surface protein of Escherichia coli. Infect. Immun. 69:7293-7303.[Abstract/Free Full Text]
30. Sandt, C. H., J. E. Hopper, and C. W. Hill. 2002. Activation of prophage eib genes for immunoglobulin-binding proteins by genes from the IbrAB genetic island of Escherichia coli ECOR-9. J. Bacteriol. 184:3640-3648.[Abstract/Free Full Text]
31. Sandt, C. H., Y.-D. Wang, R. A. Wilson, and C. W. Hill. 1997. Escherichia coli strains with nonimmune immunoglobulin-binding activity. Infect. Immun. 65:4572-4579.[Abstract]
32. Scotland, S. M., H. R. Smith, and B. Rowe. 1985. Two distinct toxins active on Vero cells from Escherichia coli O157. Lancet ii:885-886.
33. Scotland, S. M., G. A. Willshaw, H. R. Smith, and B. Rowe. 1987. Properties of strains of Escherichia coli belonging to serogroup O157 with special reference to production of Vero cytotoxins VT1 and VT2. Epidemiol. Infect. 99:613-624.[Medline]
34. Stevens, M. P., P. M. van Diemen, G. Frankel, A. D. Phillips, and T. S. Wallis. 2002. Efa1 influences colonization of the bovine intestine by Shiga toxin-producing Escherichia coli serotypes O5 and O111. Infect. Immun. 70:5158-5166.[Abstract/Free Full Text]
35. Strockbine, N. A., L. R. M. Marques, J. W. Newland, H. W. Smith, R. K. Holmes, and A. D. O'Brien. 1986. Two toxin-converting phages from Escherichia coli O157:H7 strain 933 encode antigenically distinct toxins with similar biologic activities. Infect. Immun. 53:135-140.[Medline]
36. Struyvé, M., M. Moons, and J. Tommassen. 1991. Carboxy-terminal phenylalanine is essential for the correct assembly of a bacterial outer membrane protein. J. Mol. Biol. 218:141-148.[CrossRef][Medline]
37. Tamm, A., A. M. Tarkkanen, T. K. Korhonen, P. Kuusela, P. Toivanen, and M. Skurnik. 1993. Hydrophobic domains affect the collagen-binding specificity and surface polymerization as well as the virulence potential of the YadA protein of Yersinia enterocolitica. Mol. Microbiol. 10:995-1011.[Medline]
38. Tarr, P. I., S. S. Bilge, J. C. Vary, Jr., S. Jelacic, R. L. Habeeb, T. R. Ward, M. R. Baylor, and T. E. Besser. 2000. Iha: a novel Escherichia coli O157:H7 adherence-conferring molecule encoded on a recently acquired chromosomal island of conserved structure. Infect. Immun. 68:1400-1407.[Abstract/Free Full Text]
39. Tatsuno, I., M. Horie, H. Abe, T. Miki, K. Makino, H. Shinagawa, H. Taniguchi, S. Kamiya, T. Hayashi, and C. Sasakawa. 2001. toxB gene on pO157 of enterohemorrhagic Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect. Immun. 69:6660-6669.[Abstract/Free Full Text]
40. Toma, C., N. Higa, S. Iyoda, M. Rivas, and M. Iwanaga. 2006. The long polar fimbriae genes identified in Shiga toxin-producing Escherichia coli are present in other diarrheagenic E. coli and in the standard E. coli collection of reference (ECOR) strains. Res. Microbiol. 157:153-161.[Medline]
41. Toma, C., E. Martinez Espinosa, T. Song, E. Miliwebsky, I. Chinen, S. Iyoda, M. Iwanaga, and M. Rivas. 2004. Distribution of putative adhesins in different seropathotypes of Shiga toxin-producing Escherichia coli. J. Clin. Microbiol. 42:4937-4946.[Abstract/Free Full Text]
42. Torres, A. G., J. A. Giron, N. T. Perna, V. Burland, F. R. Blattner, F. Avelino-Flores, and J. B. Kaper. 2002. Identification and characterization of lpfABCC'DE, a fimbrial operon of enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 70:5416-5427.[Abstract/Free Full Text]
43. Torres, A. G., K. J. Kanack, C. B. Tutt, V. Popov, and J. B. Kaper. 2004. Characterization of the second long polar (LP) fimbriae of Escherichia coli O157:H7 and distribution of LP fimbriae in other pathogenic E. coli strains. FEMS Microbiol. Lett. 238:333-344.[Medline]
44. Zaleska, M., K. Lounatmaa, M. Nurminen, E. Wahlström, and P. H. Mäkelä. 1985. A novel virulence-associated cell surface structure composed of 47-kd protein subunits in Yersinia enterocolitica. EMBO J. 4:1013-1018.[Medline]


Infection and Immunity, October 2006, p. 5747-5755, Vol. 74, No. 10
0019-9567/06/$08.00+0     doi:10.1128/IAI.00724-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, Y.
Right arrow Articles by Watanabe, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, Y.
Right arrow Articles by Watanabe, H.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals