Faculty of Life Sciences, University of Manchester, Michael Smith Building, Oxford Road, Manchester, M13 9PT, United Kingdom
Received 3 October 2005/ Returned for modification 29 November 2005/ Accepted 4 August 2006
| ABSTRACT |
|---|
|
|
|---|
) and tumor necrosis factor and the chemokine CCL2 (MCP-1) were seen after infection of susceptible and resistant strains, with the only difference in expression being a delayed increase in CCL2 in BALB/c IEC. These increases were ablated in MyD88/ mice, and NF-
B p65 was phosphorylated in response to T. muris excretory/secretory products in the epithelial cell line CMT-93, suggesting involvement of the MyD88-NF-
B signaling pathway in IEC cytokine expression. These data reveal that IEC respond innately to T. muris. However, the minor differences identified between resistant and susceptible mice are unlikely to underlie the subsequent development of a susceptible type 1 (IFN-
-dominated) or resistant type 2 (interleukin-4 [IL-4]/IL-13-dominated) adaptive immune response. | INTRODUCTION |
|---|
|
|
|---|
The epithelial monolayer lining the length of the intestine is charged with a vital and intricate task. Beyond the primary function of nutrient absorption, this cell layer must maintain an immunologically inert barrier to an external environment containing a vast number of commensal bacteria while still being able to mount both innate and adaptive immune responses against invading pathogens. Consequently, the epithelial layer of the gut has evolved an extensive array of defenses with which to protect the host against infection (31).
Aside from acting as a barrier, the gut epithelial compartment can deploy a number of intrinsic mechanisms in the defense against invading pathogens. These include secretory diarrhea and the production of mucus and trefoil peptides by goblet cells and antimicrobial peptides, such as defensins and cathelicidins, by Paneth and epithelial cells (16). Following Trichinella spiralis infection of the small intestine, goblet cells in the epithelial layer have been shown to secrete intelectin-2 (25) and resistin-like molecule ß (4), two molecules suspected of playing roles in the expulsion of the parasite. Studies of intestinal epithelial cells (IEC) have also shown altered expression of cytokines and chemokines in the small intestine in response to T. spiralis (33). These factors play important roles in both the maturation and the migration of dendritic cells and the infiltration of leukocytes into the gut, and consequently the development of an adaptive immune response.
The investigation of the response of IEC to infection is dominated by bacterial (22, 31) and protozoan (7) studies. Current knowledge of innate IEC immune responses to nematode parasites is limited to the small intestine, an environment known to be immunologically distinct from that of the large intestine. Furthermore, this knowledge has been generated only in the context of models that progress to Th2-mediated worm expulsion (19, 29, 33). The innate immune response of colonic IEC to gastrointestinal nematodes is unexplored, and importantly, it is not known whether IEC from resistant and susceptible mice respond differently to the parasite, potentially influencing the adaptive immune response that leads to either the expulsion or the persistence of T. muris.
The present study was designed to assess the innate immune responses of epithelial cells from the large intestines of resistant (BALB/c) and susceptible (AKR) mouse strains to T. muris infection in terms of cytokine and chemokine production, particularly with regard to macrophage chemoattractants, as large numbers of macrophages infiltrate the gut after T. muris infection (8, 20). AKR and BALB/c mice were infected, IEC were recovered after either 24 h or 7 days, and mRNA analyses of proinflammatory cytokines and chemokines and type 1 and type 2 cytokines were performed. The use of SCID mice confirmed that the IEC were responding to the parasite in the absence of mature B and T cells. Myeloid differentiation factor 88-deficient (MyD88/) mice and a cell line, CMT-93, revealed that both MyD88 and NF-
B p65 are involved in the intracellular signaling pathway or pathways activated by exposure to T. muris excretory/secretory (E/S) products.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Isolation of colonic epithelial cells and assessment of purity by flow cytometry. The large intestine (the cecum and approximately 5 cm of colon) was recovered, and fat, connective tissue, and Peyer's patches were removed. The tissue was then slit longitudinally and rinsed in calcium- and magnesium-free Hanks balanced salt solution (Invitrogen, Paisley, United Kingdom) containing 2% fetal calf serum (Invitrogen) (CMF2%), cut into 1-cm lengths, and placed in ice-cold CMF2%. Following vigorous shaking, the supernatant was discarded and fresh CMF2% was added. This was repeated (at least three times) until the supernatant remained clear. The tissue was then placed into calcium- and magnesium-free Hanks balanced salt solution containing 10% fetal calf serum, 1 mM EDTA (Sigma, Poole, United Kingdom), 1 mM dithiothreitol (Sigma), 100 units/ml penicillin, and 100 µg/ml streptomycin (both from Invitrogen) and incubated at 37°C for 20 min. The supernatant was recovered after vigorous shaking and placed on ice. This procedure was repeated once more. The supernatant was then passed through a 100-µm cell strainer and centrifuged at 200 x g for 10 min. The cells were resuspended in ice-cold PBS and counted, and the volume was adjusted to give 5 x 106 cells/ml.
Cells were stained with rat anti-mouse epithelial cell adhesion molecule (Ep-CAM; clone G8.8), which binds to a mouse epithelial cell epitope (13, 23). The percentage of cells binding Ep-CAM was determined by a secondary antibody, anti-rat immunoglobulin G2a (IgG2a):fluorescein isothiocyanate (Serotec, Oxford, United Kingdom). Isotype controls were performed using rat IgG2a of irrelevant specificity (anti-KLH; BD Biosciences, Oxford, United Kingdom) and the same secondary antibody, anti-rat IgG2a:fluorescein isothiocyanate. To assess leukocyte contamination and because some CD45+ cells have been shown to express Ep-CAM, IEC preparations were also stained with rat anti-mouse CD45:phycoerythrin (Serotec) (isotype control, rat IgG2b:phycoerythrin; Caltag, Towcester, United Kingdom). The cells were double stained for Ep-CAM and CD45 for 30 min on ice in the dark before being fixed with 1% paraformaldehyde in phosphate-buffered saline (PBS) and stored at 4°C in the dark until they were analyzed. The results were acquired on a FACSCaliber flow cytometer and analyzed using CellQuest Pro software (both from BD Biosciences). Ep-CAM expression was found on the majority of cells and was never less than 93% in any strain or at any time point in this study. Importantly, none of the strains of mice used contained more than 1.0% CD45+ cells in the epithelial cell preparation. This was true of all time points and strains examined in the results presented in this study (data not shown). The remainder of the cells (
6%) most likely comprised goblet cells and a small population of enteroendocrine cells.
Culture of CMT-93 cells. The rectal epithelial cell line CMT-93 was purchased from LGC Promochem (Teddington, United Kingdom). CMT-93 cells were cultured in Dulbecco's modified Eagle's medium plus 10% fetal calf serum (Invitrogen). The cells were grown on six-well plates from a starting density of 1 x 105/well until they were approximately 90% confluent, the medium was changed, and the cells were stimulated with either E/S (50 µg/ml), 6-amino-4-(4-phenoxyphenylethylamino)quinazoline (6AQ) (10 nM), or both. The supernatants were collected for cytokine and chemokine enzyme-linked immunosorbent assays (ELISAs), and cells were recovered for protein or RNA extraction.
Cytokine and chemokine ELISAs.
Cytokines were analyzed by sandwich ELISA as previously described (10). The monoclonal antibody pairs used for gamma interferon (IFN-
) were R4-6A2 and XMG1.2. All detection antibodies were biotinylated and used in conjunction with streptavidin-peroxidase (Roche Diagnostics, Sussex, United Kingdom). Color development following the addition of tetramethylbenzidine (BD Biosciences) was monitored, and the reaction was stopped with 2 N sulfuric acid. The plates were read at 405 nm. ELISAs for CCL2 and tumor necrosis factor (TNF) (BD Biosciences) were performed according to the manufacturer's instructions.
Extraction of total RNA and reverse transcription (RT). Colonic epithelial cells (5 x 106) from AKR, BALB/c, and SCID mice or CMT-93 cells were lysed in TRIzol (Invitrogen), and total RNA was extracted according to the manufacturer's instructions. The integrity of the RNA was confirmed by visualization of the 18S and 28S ribosomal bands under UV light following separation on a 1.5% agarose gel. The concentration of total RNA was measured by absorbance at 260 nm on a GeneQuant spectrophotometer (Amersham Biosciences, Chalfont St. Giles, Bucks, United Kingdom). One microgram of total RNA was reverse transcribed using SuperScript 2 (Invitrogen) in a final volume of 40 µl according to the manufacturer's instructions and stored at 20°C until it was used.
Quantitative PCR.
Quantitative PCR was performed using SYBR green (New England Biolabs, Hitchin, United Kingdom) on an OPTICON DNA engine with OPTICON Monitor software version 2.03 (Real-Time Systems; MJ Research). Amplification of mRNA encoding hypoxanthine phosphoribosyltransferase 1 (HPRT1), 18S rRNA, and ß-actin was performed to control for the starting amount of cDNA. Expression levels of genes of interest are shown as change (n-fold) over that seen in naïve animals after normalization to HPRT1 mRNA levels using the comparative threshold cycle method. The primers used were GTAATGATCAGTCAACGGGGGAC and CCAGCAAGCTTGCAACCTTAACCA for HPRT1, TGCTGACCCCAAGAAGGAATG and CTTGAGGTGGTTGTGGAAAAGG for CCL2, TCTTCTCATTCCTGCTTGTGG and GACAACCTGGGAGTAGACAAGGT for TNF, and AAGACTGTGATTGCGGGGTTG and GAGCGAGTTATTTGTCATTCGGG for IFN-
. All sequences are 5'-3', with the sense primer given first.
Total cell protein isolation and phosphorylated NF-
B p65 (RelA) ELISA.
A whole-cell extract kit (Active Motif, Rixensart, Belgium) was used for the preparation of total cell protein. CMT-93 cells were cultured with or without E/S for various times, the media were removed, and the cells were washed twice with ice-cold PBS containing phosphatase inhibitors. Fresh PBS containing phosphatase inhibitors was added, and the cells were removed with a cell scraper and transferred to an ice-cold tube. After centrifugation at 200 x g for 5 min at 4°C, the supernatant was discarded, and the cells were disrupted in lysis buffer containing protease inhibitors and incubated for 10 min on ice with gentle rocking. Samples were then centrifuged at 8,500 x g for 20 min at 4°C, and the supernatant was recovered as the protein-containing fraction. Samples were stored at 80°C until they were assayed.
An ELISA-based method of quantifying phosphorylated NF-
B p65 was purchased from Active Motif and used according to the manufacturer's instructions. An oligonucleotide containing an NF-
B consensus binding site was immobilized to the surface of a 96-well ELISA plate. Total protein isolated from cells of interest or recombinant NF-
B p65 (the standard) was incubated on the plate for 1 hour at room temperature. Jurkat nuclear extract was used as a positive control, and the specificity of binding was determined by the addition of a blocking oligonucleotide. After sample incubation, an anti-NF-
B p65 antibody was added, followed by a horseradish peroxidase-labeled secondary antibody. Color development was monitored and stopped with acid. The plates were read at 450 nm with a reference wavelength of 655 nm. After nonspecific-background subtraction, a standard curve was plotted to allow determination of the amount of phosphorylated NF-
B p65 per sample.
Statistical analysis. Statistical analysis was performed using Student's t test or analysis of variance, as appropriate, with the statistical package GraphPad Prism (GraphPad Software, San Diego, CA). A probability value of <0.05 was considered significant.
| RESULTS |
|---|
|
|
|---|
and TNF mRNA were higher in both AKR and BALB/c IEC (Fig. 1). Interestingly, there was no detectable expression of mRNA for the type 2 cytokines interleukin-4 (IL-4) and IL-13 and only weak expression of IL-12 p35 and IL-12 p40 by AKR or BALB/c IEC (data not shown). There was a large increase in mRNA for CCL2 in AKR IEC (11.3-fold over naïve levels) but no difference in BALB/c IEC (1.5-fold change) (Fig. 1). Two further macrophage chemoattractants, CCL6 and EMAP-2, and the antimicrobial chemokine CCL28 were expressed in naïve IEC, but levels were not increased after infection at this or the later time point (data not shown).
|
and TNF mRNA levels were increased from naïve levels in both AKR and BALB/c IEC, although TNF expression was now higher in BALB/c than AKR IEC (Fig. 2A). Expression of CCL2 was now detectable in both strains, although levels were higher in AKR than in BALB/c IEC (7.0- and 2.4-fold increases over naïve levels, respectively), showing that BALB/c IEC do express CCL2 in response to T. muris infection, but with slower kinetics than in the susceptible strain (Fig. 2A). As at 24 h p.i., there was no expression of mRNA for IL-4 and IL-13, only very small amounts of IL-12 p35 and IL-12 p40 mRNAs, the expression of which was not altered after infection (data not shown).
|
, TNF, and CCL2 mRNAs after infection. This shows that IEC are the most likely source in AKR, BALB/c, and SCID mice of IFN-
, TNF, and CCL2 produced at day 7 in response to T. muris infection.
T. muris E/S stimulate the production of cytokines and chemokines from CMT-93 cells and involve the activation of NF-
B.
To confirm that IEC from the large intestine are capable of responding to the presence of T. muris, a colonic epithelial cell line was utilized. The CMT-93 cell is derived from an epithelial polyploid carcinoma and, although altered from the normal physiological state of a colonic IEC, is a valuable model for directly analyzing the response of epithelial cells to E/S proteins of T. muris in the absence of any other cell type. CMT-93 cells were cultured for 24 h in medium alone or with T. muris E/S (50 µg/ml), and total RNA was recovered.
Figure 3A shows that E/S stimulation of CMT-93 cells enhances the expression of IFN-
, TNF, and CCL2 mRNAs when measured by quantitative RT-PCR, mirroring the results seen in IEC isolated from AKR and BALB/c mice. ELISA measurements of protein secretion by CMT-93 cells revealed that the amount of TNF increased over 5-fold, from 19.6 (± 5.4) to 103.8 (± 38.7) pg/ml (P < 0.01), and CCL2 rose 20-fold, from 15.2 (± 8.3) pg/ml in control samples to 308.6 (± 102.3) pg/ml in E/S-treated cells (P < 0.05) (Fig. 3B). IFN-
was not detectable by ELISA, and as in the case of ex vivo IEC, no IL-4 or IL-13 was detectable by either PCR or ELISA and IL-12 p35 and p40 expression was low and did not change after stimulation (data not shown).
|
B. To determine if NF-
B activation occurs in CMT-93 cells following exposure to E/S, total protein was recovered from cells at various times after stimulation, and the amount of phosphorylated NF-
B p65 (RelA) was measured by an oligonucleotide-based ELISA. Unstimulated cells contained 6.0 (± 0.5) ng/ml phosphorylated NF-
B p65, which rose 83% to 11.0 (± 3.1) ng/ml 4 h after E/S stimulation, a statistically significant increase (P < 0.05). Levels of phosphorylated NF-
B p65 then declined to control levels by 48 h poststimulation (Fig. 3C). To confirm the involvement of NF-
B in IFN-
, TNF, and CCL2 gene expression, an NF-
B inhibitor (6AQ) was utilized. Cells cultured with E/S showed a large increase in the expression of TNF and CCL2 by quantitative PCR (Fig. 3D) and ELISA (Fig. 3E), and this was completely inhibited by 6AQ. The increase in IFN-
mRNA expression measured by quantitative PCR was also abolished by the addition of 6AQ (data not shown).
Changes in IEC gene expression after T. muris infection are dependent on MyD88.
To investigate in vivo the upstream signaling pathways that lead to the activation of NF-
B p65 and ultimately the increases seen in gene expression in vitro in CMT-93 cells, MyD88/ mice on a C57BL/6 background were infected for 24 h and IEC gene expression was measured by PCR. Both C57BL/6 and MyD88/ mice are resistant to T. muris infection, but they expel the parasite with slower kinetics than BALB/c mice (17). Analysis of C57BL/6 and MyD88/ IEC revealed a role for MyD88 in altered gene expression 24 h post-T. muris infection. PCR analysis confirmed that only wild-type (WT) cells express Myd88 (data not shown). WT mice show expression of IFN-
, TNF, and CCL2 mRNAs in IEC from naïve mice, with increases of 2.2-, 1.7-, and 4.5-fold, respectively, at 24 h p.i. (Fig. 4). In comparison, MyD88/ IEC show reduced amounts of mRNA for all three genes investigated in naïve animals (data not shown) and there are no increases in expression at 24 h p.i. (Fig. 4). These results show that MyD88-dependent signaling is required for the increased expression of IFN-
, TNF, and CCL2 mRNAs by IEC 24 h post-T. muris infection.
|
| DISCUSSION |
|---|
|
|
|---|
, TNF, and CCL2 mRNAs in response to T. muris infection by mouse colonic epithelial cells as early as 24 h after infection. These increases persisted until at least day 7 p.i. The use of resistant and susceptible strains also showed that at these early time points after infection, there were no substantial differences in the production of cytokines or chemokines by IEC that could clearly determine the development of a type-1 or type-2 immune response.
Interestingly, there was increased expression of IFN-
mRNA in the absence of type 2 cytokines (IL-4 and IL-13) (data not shown), suggesting that, at least initially, a type 1-dominated environment occurs locally in both AKR and BALB/c mice and that alternative mechanisms, such as cytokines produced by other cell types, must exist to convert this to a type 2 response that mediates worm expulsion in resistant strains of mice. IFN-
is normally induced by IL-12; however, no evidence was found for IL-12-driven IFN-
production, as only low levels of IL-12p35 and -p40 were detected, and they were not increased after infection (data not shown). It would thus be interesting to assess whether another cell type produces IL-12 or if IL-18, which is known to be produced by intestinal epithelial cells (34), is involved in the induction of the observed IFN-
mRNA expression. Another consideration is whether the small (<1%) CD45+ population contributes to the measured IFN-
expression. The use of SCID mice excludes T and B cells from this role; however, functional NK cells would still be present. While not formally excluding NK cell-derived IFN-
, the very low number of contaminating cells and the production of IFN-
by CMT-93 cells in response to E/S argue against this.
Previous studies have established a role for IFN-
in the epithelial hyperproliferation seen in T. muris infection. Administration of anti-IFN-
antibodies to infected SCID mice significantly reduced hyperproliferation at day 21 p.i. without affecting the susceptibility of the strain (2), although it was not clear if this activity of IFN-
was direct or indirect. More recently, it has been shown that increased IEC proliferation may be involved in worm expulsion (6), an observation that initially seems at odds with the effect of IFN-
. Further investigation revealed that IFN-
induces IEC to express CXCL10, which reduces cell movement up the crypt, an effect which in combination with increased cell proliferation leads to crypt hyperplasia, resulting in a larger niche for the parasite to occupy. Resistant mice express IL-13, speeding the movement of IEC up the crypt, where they are ultimately lost into the lumen, possibly driving the parasite from its niche in the process (6). These mechanisms, seen at day 21 p.i. at the height of the adaptive response, may be initiated earlier than previously recognized, as we show here that IFN-
mRNA is increased by 24 h p.i.
The mechanisms by which IFN-
and TNF influence the development of type 1-mediated susceptibility may incorporate other features of their biology. It is now well established that IFN-
can directly reduce the barrier function of human IEC lines in vitro and that TNF synergizes with IFN-
in this effect (21, 28, 36). This process could lead to increased bacterial invasion of the epithelial cell layer in vivo, acting as a powerful stimulus of a type 1 immune response. Indeed, this mechanism is one of the explanations for the observation that TLR4- and MyD88-deficient mice are highly resistant to T. muris infection (17). However, despite several lines of evidence for IFN-
promoting susceptibility to T. muris infection, the cytokine was induced in BALB/c mice at 24 h and 7 days p.i., albeit at slightly lower levels than in AKR IEC. A function of IFN-
beyond T-cell polarization may be in the proliferation of local T cells, as the cytokine stimulates the production of IL-7 by IEC, a cytokine which causes the proliferation of lamina propria and intraepithelial lymphocytes (38), giving a possible advantage to the host. Furthermore, IFN-
synergizes with TNF to induce the production of CCL2 (37), a chemokine necessary for the expulsion of T. muris (8).
TNF has been shown to be expressed at higher levels in the human colon after bacterial infection (32) and in the mouse small intestine after Nippostrongylus brasiliensis infection (14). A major proinflammatory role for TNF is the induction of increased amounts of intracellular adhesion molecule 1 on the surfaces of endothelial cells, a vital component in the early influx of inflammatory cells, such as neutrophils and macrophages, to a site of infection (39). The increase in TNF mRNA expression reported here at 24 h p.i., along with CCL2, is consistent with a role in the early inflammatory-cell influx. TNF has also been previously shown to be involved in the immune response to T. muris infection (1). Administration of anti-TNF antibodies delayed worm expulsion without altering the levels of Th2 cytokines, suggesting an effector role for the cytokine. Furthermore, TNF receptor p55/p75 double-knockout mice were susceptible to infection and mounted a predominantly Th1 response, showing that TNF may also be involved in the generation of type 2 immune responses. The production of TNF mRNA by IEC from both resistant and susceptible strains at 24 h and 7 days p.i. confirms that the cytokine is involved in the host response from the earliest stages of infection. Whether the quantitative difference seen at 24 h p.i. between AKR and BALB/c IEC, an effect reversed at 7 days p.i., is important and how this might alter the generation of the subsequent immune response are currently unknown.
The only absolute difference between susceptible and resistant mice reported in this study was the increased expression of CCL2 mRNA at 24 h p.i. in AKR, but not BALB/c, mice. This difference may be kinetic, as both strains expressed increased levels of CCL2 at day 7 p.i., or it could be linked with the higher TNF expression in infected BALB/c IEC at this time point. The observed elevation of CCL2 in the susceptible host by day 7 p.i. was unexpected, as CCL2 is involved in the generation of type 2 immune responses (15) and is necessary for the expulsion of T. muris (8). Thus, if CCL2 production by IEC was linked to resistance and polarized Th2 responses, higher expression would have been expected in the resistant BALB/c and C57BL/6 strains of mice.
CCL2, however, is produced by epithelial cells from normal human gut mucosa (26), as well as after bacterial infection in the colon (18, 32) and Giardia lamblia infection of Caco-2 cells (30) and here by IEC in response to T. muris and CMT-93 cells after E/S stimulation. These data show a role for CCL2 in response to several different infections, suggesting that the influx of cells expressing the CCL2 receptor, CCR2, is vital in the early response to intestinal pathogens.
Work on the epithelial cell-derived cell line CMT-93 mirrored the results from ex vivo IEC, with increases in IFN-
, TNF, and CCL2 mRNA expression being measured by PCR in response to T. muris-derived E/S proteins. This confirms, in a large-intestine epithelial cell line, previous work showing that Trichuris suis E/S causes the production of cytokines by a small-intestine epithelial cell line (24). The use of CMT-93 cells also allowed the investigation of phosphorylation of NF-
B p65 (RelA), which was shown to be increased 4 h after E/S stimulation. A role for members of the NF-
B family of transcription factors in the control of T. muris infection has been demonstrated using NF-
B1, NF-
B2, and c-Rel knockout mice (3). Despite reduced Th2 responses, C-Rel knockout mice still expelled the parasite, but NF-
B1 and NF-
B2 knockout mice developed chronic infections associated with high IFN-
production by mesenteric lymph node cells. Although it was not possible to assess the in vivo involvement of NF-
B p65, as the deletion of this subunit is lethal in utero, this study has now shown that NF-
B p65 is activated in IEC following exposure to T. muris E/S products. To begin to explore the in vivo signaling pathways activated in response to the presence of T. muris E/S proteins leading to NF-
B p65 activation, MyD88/ mice on a generally resistant C57BL/6 background were utilized. MyD88/ IEC showed no increase in expression of mRNA for IFN-
, TNF, or CCL2 after infection, whereas expression of these genes was elevated in WT mice. This is consistent with previous reports showing that MyD88 is essential for the survival of T. muris (17).
This study shows that the colonic epithelial cell is capable of responding to the presence of T. muris infection by up-regulating the expression of proinflammatory genes by 24 h p.i., a response which persists until at least 7 days p.i. The increased expression of IFN-
, TNF, and CCL2 mRNAs depended on MyD88 and NF-
B p65 signaling pathways; however, there was little difference in the overall cytokine expression profiles of IEC from resistant and susceptible mice. These data do not exclude the possibility that colonic IEC may influence the development of the adaptive immune response, culminating in a resistant or susceptible phenotype, but show that the factors investigated here are probably not involved. However, the strong inflammatory and macrophage chemoattractant signal produced by IEC does provide a mechanism by which cells are recruited to the large intestine in the initial stages of T. muris infection. Further understanding of the early innate signaling events and cytokine/chemokine production stimulated by T. muris at the site of infection (rather than the draining lymph node) may provide important information on the mechanisms that underlie the subsequent development of the differential adaptive immune responses generated in resistant and susceptible strains of mice.
| ACKNOWLEDGMENTS |
|---|
We thank G. Anderson for the G8.8 monoclonal antibody.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
| 1. | Artis, D., N. E. Humphreys, A. J. Bancroft, N. J. Rothwell, C. S. Potten, and R. K. Grencis. 1999. Tumor necrosis factor- is a critical component of interleukin 13-mediated protective T helper cell type 2 responses during helminth infection. J. Exp. Med. 190:953-962. |
| 2. | Artis, D., C. S. Potten, K. J. Else, F. D. Finkelman, and R. K. Grencis. 1999. Trichuris muris: host intestinal epithelial cell hyperproliferation during chronic infection is regulated by interferon- . Exp. Parasitol. 92:144-153.[CrossRef][Medline] |
| 3. | Artis, D., S. Shapira, N. Mason, K. M. Speirs, M. Goldschmidt, J. Caamano, H. C. Liou, C. A. Hunter, and P. Scott. 2002. Differential requirement for NF- B family members in control of helminth infection and intestinal inflammation. J. Immunol. 169:4481-4487. |
| 4. | Artis, D., M. L. Wang, S. A. Keilbaugh, W. He, M. Brenes, G. P. Swain, P. A. Knight, D. D. Donaldson, M. A. Lazar, H. R. Miller, G. A. Schad, P. Scott, and G. D. Wu. 2004. RELMß /FIZZ2 is a goblet cell-specific immune-effector molecule in the gastrointestinal tract. Proc. Natl. Acad. Sci. USA 101:13596-13600. |
| 5. | Bancroft, A. J., A. N. McKenzie, and R. K. Grencis. 1998. A critical role for IL-13 in resistance to intestinal nematode infection. J. Immunol. 160:3453-3461. |
| 6. | Cliffe, L. J., N. E. Humphreys, T. E. Lane, C. S. Potten, C. Booth, and R. K. Grencis. 2005. Accelerated intestinal epithelial cell turnover: a new mechanism of parasite expulsion. Science 308:1463-1465. |
| 7. | Deng, M., M. S. Rutherford, and M. S. Abrahamsen. 2004. Host intestinal epithelial response to Cryptosporidium parvum. Adv. Drug Deliv. Rev. 56:869-884.[CrossRef][Medline] |
| 8. | deSchoolmeester, M. L., M. C. Little, B. J. Rollins, and K. J. Else. 2003. Absence of CC chemokine ligand 2 results in an altered Th1/Th2 cytokine balance and failure to expel Trichuris muris infection. J. Immunol. 170:4693-4700. |
| 9. | Else, K. J., F. D. Finkelman, C. R. Maliszewski, and R. K. Grencis. 1994. Cytokine-mediated regulation of chronic intestinal helminth infection. J. Exp. Med. 179:347-351. |
| 10. | Else, K. J., and R. K. Grencis. 1991. Cellular immune responses to the murine nematode parasite Trichuris muris. I. Differential cytokine production during acute or chronic infection. Immunology 72:508-513.[Medline] |
| 11. | Else, K. J., D. Wakelin, D. L. Wassom, and K. M. Hauda. 1990. MHC-restricted antibody responses to Trichuris muris excretory/secretory (E/S) antigen. Parasite Immunol. 12:509-527.[Medline] |
| 12. | Fahmy, M. A. 1954. An investigation on the life cycle of Trichuris muris. Parasitology 44:50-57.[Medline] |
| 13. | Farr, A., A. Nelson, J. Truex, and S. Hosier. 1991. Epithelial heterogeneity in the murine thymus: a cell surface glycoprotein expressed by subcapsular and medullary epithelium. J. Histochem. Cytochem. 39:645-653.[Abstract] |
| 14. | Fujiwara, A., Y. Kawai, S. Sekikawa, T. Horii, M. Yamada, S. Mitsufuji, and N. Arizono. 2004. Villus epithelial injury induced by infection with the nematode Nippostrongylus brasiliensis is associated with upregulation of granzyme B. J. Parasitol. 90:1019-1026.[CrossRef][Medline] |
| 15. | Gu, L., S. Tseng, R. M. Horner, C. Tam, M. Loda, and B. J. Rollins. 2000. Control of TH2 polarization by the chemokine monocyte chemoattractant protein-1. Nature 404:407-411.[CrossRef][Medline] |
| 16. | Hecht, G. 1999. Innate mechanisms of epithelial host defense: spotlight on intestine. Am. J. Physiol. 277:C351-C358. |
| 17. | Helmby, H., and R. K. Grencis. 2003. Essential role for TLR4 and MyD88 in the development of chronic intestinal nematode infection. Eur. J. Immunol. 33:2974-2979.[CrossRef][Medline] |
| 18. | Jung, H. C., L. Eckmann, S. K. Yang, A. Panja, J. Fierer, E. Morzycka-Wroblewska, and M. F. Kagnoff. 1995. A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion. J. Clin. Investig. 95:55-65.[Medline] |
| 19. | Li, C. K., R. Seth, T. Gray, R. Bayston, Y. R. Mahida, and D. Wakelin. 1998. Production of proinflammatory cytokines and inflammatory mediators in human intestinal epithelial cells after invasion by Trichinella spiralis. Infect. Immun. 66:2200-2206. |
| 20. | Little, M. C., L. V. Bell, L. J. Cliffe, and K. J. Else. 2005. The characterization of intraepithelial lymphocytes, lamina propria leukocytes, and isolated lymphoid follicles in the large intestine of mice infected with the intestinal nematode parasite Trichuris muris. J. Immunol. 175:6713-6722. |
| 21. | Madara, J. L., and J. Stafford. 1989. Interferon- directly affects barrier function of cultured intestinal epithelial monolayers. J. Clin. Investig. 83:724-727.[Medline] |
| 22. | Mumy, K. L., and B. A. McCormick. 2005. Events at the host-microbial interface of the gastrointestinal tract. II. Role of the intestinal epithelium in pathogen-induced inflammation. Am. J. Physiol. Gastrointest. Liver Physiol. 288:G854-G859. |
| 23. | Nelson, A. J., R. J. Dunn, R. Peach, A. Aruffo, and A. G. Farr. 1996. The murine homolog of human Ep-CAM, a homotypic adhesion molecule, is expressed by thymocytes and thymic epithelial cells. Eur. J. Immunol. 26:401-408.[Medline] |
| 24. | Parthasarathy, G., and L. S. Mansfield. 2005. Trichuris suis excretory secretory products (ESP) elicit interleukin-6 (IL-6) and IL-10 secretion from intestinal epithelial cells (IPEC-1). Vet. Parasitol. 131:317-324.[CrossRef][Medline] |
| 25. | Pemberton, A. D., P. A. Knight, J. Gamble, W. H. Colledge, J. K. Lee, M. Pierce, and H. R. Miller. 2004. Innate BALB/c enteric epithelial responses to Trichinella spiralis: inducible expression of a novel goblet cell lectin, intelectin-2, and its natural deletion in C57BL/10 mice. J. Immunol. 173:1894-1901. |
| 26. | Reinecker, H. C., E. Y. Loh, D. J. Ringler, A. Mehta, J. L. Rombeau, and R. P. MacDermott. 1995. Monocyte-chemoattractant protein 1 gene expression in intestinal epithelial cells and inflammatory bowel disease mucosa. Gastroenterology 108:40-50.[CrossRef][Medline] |
| 27. | Richard, M., R. K. Grencis, N. E. Humphreys, J. C. Renauld, and J. Van Snick. 2000. Anti-IL-9 vaccination prevents worm expulsion and blood eosinophilia in Trichuris muris-infected mice. Proc. Natl. Acad. Sci. USA 97:767-772. |
| 28. | Rodriguez, P., M. Heyman, C. Candalh, M. A. Blaton, and C. Bouchaud. 1995. Tumour necrosis factor- induces morphological and functional alterations of intestinal HT29 cl.19A cell monolayers. Cytokine 7:441-448.[CrossRef][Medline] |
| 29. | Rosbottom, A., P. A. Knight, G. McLachlan, E. M. Thornton, S. W. Wright, H. R. Miller, and C. L. Scudamore. 2002. Chemokine and cytokine expression in murine intestinal epithelium following Nippostrongylus brasiliensis infection. Parasite. Immunol. 24:67-75.[CrossRef][Medline] |
| 30. | Roxstrom-Lindquist, K., E. Ringqvist, D. Palm, and S. Svard. 2005. Giardia lamblia-induced changes in gene expression in differentiated Caco-2 human intestinal epithelial cells. Infect. Immun. 73:8204-8208. |
| 31. | Sansonetti, P. J. 2004. War and peace at mucosal surfaces. Nat. Rev. Immunol. 4:953-964.[CrossRef][Medline] |
| 32. | Stadnyk, A. W. 2002. Intestinal epithelial cells as a source of inflammatory cytokines and chemokines. Can. J. Gastroenterol. 16:241-246.[Medline] |
| 33. | Stadnyk, A. W., and J. A. Kearsey. 1996. Pattern of proinflammatory cytokine mRNA expression during Trichinella spiralis infection of the rat. Infect. Immun. 64:5138-5143.[Abstract] |
| 34. | Takeuchi, M., Y. Nishizaki, O. Sano, T. Ohta, M. Ikeda, and M. Kurimoto. 1997. Immunohistochemical and immuno-electron-microscopic detection of interferon- -inducing factor ("interleukin-18") in mouse intestinal epithelial cells. Cell Tissue Res. 289:499-503.[CrossRef][Medline] |
| 35. | Wakelin, D. 1967. Acquired immunity to Trichuris muris in the albino laboratory mouse. Parasitology 57:515-524.[Medline] |
| 36. | Wang, F., W. V. Graham, Y. Wang, E. D. Witkowski, B. T. Schwarz, and J. R. Turner. 2005. Interferon- and tumor necrosis factor- synergize to induce intestinal epithelial barrier dysfunction by up-regulating myosin light chain kinase expression. Am. J. Pathol. 166:409-419. |
| 37. | Warhurst, A. C., S. J. Hopkins, and G. Warhurst. 1998. Interferon- induces differential upregulation of and ß chemokine secretion in colonic epithelial cell lines. Gut 42:208-213. |
| 38. | Watanabe, M., Y. Ueno, T. Yajima, Y. Iwao, M. Tsuchiya, H. Ishikawa, S. Aiso, T. Hibi, and H. Ishii. 1995. Interleukin-7 is produced by human intestinal epithelial cells and regulates the proliferation of intestinal mucosal lymphocytes. J. Clin. Investig. 95:2945-2953.[Medline] |
| 39. | Yang, L., R. M. Froio, T. E. Sciuto, A. M. Dvorak, R. Alon, and F. W. Luscinskas. 2005. ICAM-1 regulates neutrophil adhesion and transcellular migration of TNF- -activated vascular endothelium under flow. Blood 106:584-592. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|