Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas,1 Departamento de Reumatología, Facultad de Medicina, Pontificia Universidad Católica de Chile, Santiago, Chile,2 Department of Microbiology and Immunology, Albert Einstein College of Medicine, New York, New York3
Received 12 January 2006/ Returned for modification 28 February 2006/ Accepted 26 July 2006
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Previously, we have shown that Salmonella enterica serovar Typhimurium, the causative agent of a typhoid-like disease in the mouse, can escape from antigen presentation by DCs (47). We observed that vacuoles containing virulent serovar Typhimurium inside DCs do not colocalize with lysosomal markers (47). These data suggested the avoidance of lysosomal degradation as a mechanism likely to be responsible for the escape of antigen presentation in DCs (47). This escape mechanism seems to be restricted to virulent strains, because attenuated Salmonella strains, such as mutants of the phoP/Q locus, fail to escape from DC processing and presentation (37). Considering that this locus encodes a two-component regulatory system that controls expression of virulence genes encoded within Salmonella pathogenicity islands 1 and 2 (SPI-1 and SPI-2, respectively) (16, 28), it is likely that these genetic elements could be responsible for interfering with DC function. SPI-1 and SPI-2 encode type three secretion systems (TTSS) that translocate effector proteins (also encoded by SPI-1 and -2) into the cytoplasm of host cells. These effector proteins subvert cellular metabolism to mediate bacterial entry and survival inside host cells. Translocation of effector proteins by the SPI-2 TTSS increases intracellular bacterial survival by preventing the fusion of Salmonella-containing vacuoles (SCV) with lysosomes (48).
Consistent with this notion, it has been recently shown that strains of Salmonella in which the entire SPI-2 region has been deleted are rendered unable to evade presentation of bystander antigens by DCs to MHC class II (MHC-II)-restricted T cells in vitro (6). Here we extend these findings by evaluating the mechanism by which SPI-2-encoded genes of serovar Typhimurium contribute to the escape from presentation of bacterium-expressed antigens by murine DCs to MHC-I- and MHC-II-restricted T cells, both in vitro and in vivo. To approach this question, we deleted the entire SPI-2, as well as specific genes contained within this genetic region that are needed for the assembly of TTSS and for the interference with vesicular trafficking in host cells. Our results show that each of the mutations on SPI-2 impaired the ability of serovar Typhimurium to escape from antigen processing and presentation by DCs. The mechanism responsible seems to be the loss of the ability to avoid intracellular degradation by lysosomes. Consistent with these findings, SPI-2 mutants showed decreased virulence in vivo, as demonstrated by reduced tissue colonization and increased bacterium-specific T-cell and antibody responses. In addition, infection with each of the SPI-2 mutated strains led to protective immunity against challenge with the wild-type (WT) virulent Salmonella strain. Our data support the notion that the ability to interfere with DC function promotes serovar Typhimurium pathogenicity by avoiding bacterial degradation and activation of adaptive immunity. We have identified some of the virulence factors of serovar Typhimurium that mediate this strategy and which subvert DC function and could promote systemic disease in the host.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains. Salmonella enterica serovar Typhimurium 14028s (herein WT) was used as the parental strain (47). Mutants for spiA, spiC, and SPI-2 were generated by allelic exchange (9). Primers designed according to the serovar Typhimurium LT2 sequence (32) were as follows (5' to 3'): for disruption of spiA, GGGGTATAAAATGGTAGTAAATAAACGTTTAATCTTAATTTGTAGGCTGGAGCTGCTTCGand ACTCTTTGGATTAACCATGAGATATGCCATTATTTACTACCATATGAATATCCTCCTTAG; for disruption of spiC, TTTGATAGAAACTCCCATTTATGTCTGAGGAGGGATTCATTGTAGGCTGGAGCTGCTTCGwith GCCAGGTGTTTTTCTATCTCAATAGCAATAAGCTCAGAGCCATATGAATATCCTCCTTA; for disruption of SPI-2, GCGCATAATGTCAATCGAGCAACTTTTTGCCTTCCAGGTCTGTAGGCTGGAGCTGCTTCGand CCAAAAGCATTTATGGTGTTTCGGTAGAATGCGCATAATCCATATGAATATCCTCCTTAG. Genomic deletions were confirmed by PCR using primers up- and downstream from the exchanged site.
To complement the spiA and spiC mutants, the complete coding sequences of these genes were amplified using the following primers (5' to 3'): for SpiA, SpiA-F (GCCCATGGTTAACCATGAGATATGC) and SpiA-R (GGCCATGGTAGTAAATAAACGTTTA); for SpiC, SpiC-F (ATGTCTGAGGAGGGATTCATGC) and SpiC-R (CGGAATTCTTATACCCCACCCGAAT). The products were inserted into the low-copy-number pACYC184 vector. Expression of both complemented genes was controlled by the endogenous promoter by cloning SpiC promoter with primers PSpiC-F (GCGAATTCAATGCTTCCCTCCAGTT) and PSpic-R (GCCCATGGAAATGGGAGTTTCTATC) as described elsewhere (7). Ovalbumin (OVA)-expressing and green fluorescent protein (GFP)-expressing Salmonella strains were obtained by transformation with pOVA and pGFP and evaluated by Western blotting, using an OVA-specific rabbit anti-antiserum (ICN, Biomedicals Inc.) and fluorescence microscopy, respectively (47).
Reverse transcription-PCRs (RT-PCRs) and Western blotting. cDNAs obtained from total RNA from bacterial cultures grown overnight in N salts medium at pH 5 (2, 18) were tested for amplification of spiA and spiC using primers SpiA-F with -R and SpiC-F with -R, respectively. Protein secretion by the SPI-2-encoded TTSS was evaluated by Western blot detection of SseB in supernatants of bacteria cultures, as previously described (20).
Antigen presentation assays, bacterial survival, and DC viability. As previously described (47), bone marrow-derived DCs (day 6 of culture) were pulsed for 4 h with OVA-expressing wild-type or SPI-2 mutant Salmonella strains at a multiplicity of infection (MOI) equal to 50 and treated with gentamicin (100 µg/ml; Sigma) to remove extracellular bacteria. As a control, DCs were loaded with various MOIs (5, 10, 25, 50, and 100) of live or heat-killed (65°C for 1 h [35]) Salmonella strains. After 12 h of culture, DCs were cocultured with either 1 x 105 B3Z or OT4H.2D5 (herein, OT4H) T-cell hybridomas, which are specific for H-2Kb/OVA257-264 and I-Ab/OVA265-280, respectively (29, 45). T-cell activation of transgenic T cells was evaluated by coculture of pulsed DCs with either OT-I or OT-II T cells (1 x 105) obtained from lymph nodes (LNs) of transgenic mice. Interleukin-2 (IL-2) release was measured after 20 h of DC-T-cell coculture (26). To evaluate bacterial infectivity and survival, 1 x 103 gentamicin-treated DCs were permeabilized for 30 min with 0.1% Triton X-100 in phosphate-buffered saline (PBS) and plated on LB agar 1 and 8 h postinfection. At the same time points, DC viability was determined by trypan blue exclusion.
Detection of bacterium-derived pMHC complexes. DCs were infected at an MOI of 50 for 4 h with either wild-type or SPI-2 mutant Salmonella strains that expressed OVA, treated with 100 µg/ml gentamicin to remove extracellular bacteria, washed at 4°C, and incubated for 16 h at 37°C in the presence of 100 µg/ml gentamicin. As a control for DC function upon bacterial pulse, DCs were copulsed with nonrecombinant WT Salmonella and 10 ng/ml of SIINFEKL peptide. Controls for background staining were unpulsed DCs and DCs pulsed with nonrecombinant WT Salmonella. DC surface H-2Kb/SIINFEKL complexes were detected by staining with anti-CD11c-phycoerythrin (PE) (clone HL3; Pharmingen) and supernatant from 25-D1.16 cells, a mouse-derived hybridoma which secretes a monoclonal antibody specific for pMHC H-2Kb/SIINFEKL (39). After washing, cells were stained with goat anti-mouse immunoglobulin G (IgG)-fluorescein isothiocyanate (Pharmingen), and the percentage of H-2Kb/SIINFEKL-positive cells in the CD11c+ population was determined by fluorescence-activated cell sorter analysis.
Confocal and electron microscopy. DCs pulsed (MOI equal to 50) with wild-type or SPI-2 mutant Salmonella strains that expressed GFP were stained with anti-CD11c-PE, washed with gentamicin-supplemented PBS, fixed with 2% paraformaldehyde, and permeabilized with Triton X-100 (0.5% Triton in 5% fetal calf serum-PBS). The lysosomal marker LAMP-2 was detected by a rabbit antiserum (Zymed Laboratories, Inc.) and revealed with a rhodamine Red-X-labeled goat anti-rabbit IgG (Molecular Probes). DCs were examined on a Zeiss LSM 5 Pa confocal microscope. Semiquantitative analysis was performed by counting DCs showing Salmonella-LAMP-2 colocalization on several randomly selected fields, and fluorescence extension analyses were performed using the Carl Zeiss LSM 5 Examiner software. DCs pulsed for 4 h with either wild-type or SPI-2 mutant Salmonella strains were prepared as previously described (47) and analyzed on a Phillips Tecnai 21 electron microscope.
In vivo attenuation assays.
Mice (6 to 8 weeks
of age) were orally inoculated with 100 µl of PBS containing
106 CFU of either OVA-expressing wild-type or SPI-2 mutant
Salmonella strains, grown at logarithmic phase, by
intragastric gavage with a 20-mm feeding tip. This dose had been
previously shown to induce an immune response by oral infection with
attenuated Salmonella strains
(35). Uninfected control
mice received an equivalent volume of PBS. At day 5 postinfection,
serum anti-OVA IgG and organ colonization were measured by
enzyme-linked immunosorbent assay and plating on LB-ampicillin agar,
respectively. Activation of naïve T cells in mice challenged with
wild-type or SPI-2 mutant Salmonella strains was evaluated on
single-cell suspensions from spleens and LNs by measuring gamma
interferon (IFN-
) and IL-2 release in response to stimulation
for 72 h with peptides derived from OVA
(OVA257-264 and OVA265-277) or
flagellin (FliC427-441), at a concentration equal to
10 ng/ml. This peptide concentration had been previously shown to be
appropriate to expand peptide-specific T-cell populations
(23,
34). For ex vivo antigen
presentation assays, mice were challenged in the footpads with
105 CFU of OVA-expressing wild-type or SPI-2 mutant
Salmonella strains. After 48 h, cell suspensions
obtained from popliteal LNs were used to measure
H-2Kb/SIINFEKL complexes on the CD11c+
population as described above. To test the capacity of LN
antigen-presenting cells (APCs) to activate T cells ex vivo, IL-2
release was measured on cocultures consisting of 105
LN-derived cells and either OT-I or OT-II T cells. For protection
assays, mice were orally infected with 106 CFU
OVA-expressing SPI-2 mutant strains or with PBS as a control. At day
14, mice were orally challenged with 108 CFU of wild-type
Salmonella pOVA; this dose is 1,000-fold higher than the 50%
lethal dose reported for this strain following oral inoculation
(19). Mouse survival was
evaluated within a period of 7 weeks.
In vivo T-cell proliferation and cytokine production.
Single-cell suspensions obtained from
spleens and LNs of either OT-I, OT-II, or SM1 transgenic mice were
stained with 10 µM carboxyfluorescein diacetate succinimidyl
ester (CFSE; Molecular Probes) and intravenously (i.v.) injected into
syngeneic C57BL/6 recipient mice. Each splenocyte suspension was
adjusted to a final volume of 500 µl containing 1 x
106 V
2+ CD8+
(for OT-I), V
2+ CD4+
(for OT-II), or Vß2+ CD4+
(for SM1) CFSE+ cells, as determined by flow
cytometry (22,
41). Cells were injected
into each recipient mouse, and 24 h later 1 x
105 CFU of OVA-expressing wild-type or SPI-2 mutant
Salmonella strain cells were i.v. injected. Spleens were
extracted from recipient mice 3 days after bacterial injection, and
OT-I, OT-II, and SM1 T-cell proliferation was evaluated by dilution of
CFSE labeling in the respective CD8+ or
CD4+ population
(22,
41). Detection of in vivo
IFN-
production by OT-I transgenic T cells was evaluated as
previously described
(46). Briefly,
splenocytes obtained from mice previously transferred with OT-I T cells
as described above and challenged with Salmonella were
incubated with 10 nM OVA257-264 in the presence of
brefeldin A (2.5 µg/ml) for 6 h. Next, cells were
washed and stained with anti-CD8-PE and fixed in 2%
paraformaldehyde. After washing, cells were permeabilized
with PBS-2% bovine serum albumin-0.5% Saponin,
incubated with anti-IFN-
-biotin (clone XMG1.2), washed
again, and stained with streptavidin-Tc. Staining for IFN-
in
the CFSE+ population was determined by gating on
CD8+
cells.
| RESULTS |
|---|
|
|
|---|
Deletion of
spiA and spiC from the chromosome was confirmed by
PCR (not shown) and by RT-PCR of total RNA obtained from strains grown
in N salt medium at pH 5.0, which induces expression and secretion of
SPI-2-encoded effector proteins to the culture supernatant
(2,
18). As shown in Fig.
1A, spiA or spiC transcripts could not be detected in the
respective mutant strain. As a control for transcription of both coding
sequences, an SPI-2 null mutant was also generated (Fig.
1A). In these mutants,
translocation was evaluated by Western blot detection of SseB, an
effector protein encoded by SPI-2 and secreted by the SPI-2 TTSS.
Consistent with previous observations
(13), a significant
reduction on SseB secretion was observed for the
spiA,
spiC, and
SPI-2
Salmonella mutants (Fig.
1B). SseB secretion could
be restored to wild-type levels upon complementation in trans
with spiA and spiC genes for each respective null
mutant (Fig.
1B).
|
spiA,
spiC, and
SPI-2 null mutant strains invaded DCs with equivalent
efficiency as the wild-type strain (Fig.
2A, left panel), which is consistent with previous reports
(38,
48). In contrast, 8 hours
postinfection a significant reduction of intracellular bacterial load
for the three SPI-2 mutants was observed (Fig.
2A, left panel).
Evaluation of DC survival by trypan blue exclusion at each time point
after Salmonella infection showed no significant decrease in
DC viability compared to uninfected cells (Fig.
2A, right panel). These
data suggest that, although DCs internalize equivalent amounts of
wild-type and SPI-2 Salmonella mutants, a deficiency in SPI-2
function impairs bacterial survival inside DCs.
|
Complementation of
SpiA or
SpiC mutant strains with the respective wild-type gene
restored the ability of Salmonella to evade antigen
presentation to T cells (Fig.
2B, upper panels). These
results suggest that the phenotypes shown by the serovar Typhimurium
mutants are caused by the deletion of those specific genes and not due
to nonspecific genetic modifications.
To evaluate the mechanism responsible for the absence of T-cell activation, generation of bacterium-derived pMHC complexes was evaluated using an H-2Kb/SIINFEKL-specific antibody. Consistent with the T-cell activation data, H-2Kb/SIINFEKL complexes were barely detected on the surfaces of DCs infected with wild-type Salmonella expressing OVA (Fig. 2D). The absence of H-2Kb/SIINFEKL complexes was not due to reduced expression of H-2Kb molecules on the surface of DCs, because a copulse with WT Salmonella and exogenous SIINFEKL peptide restored the assembly of H-2Kb/SIINFEKL complexes (Fig. 2D). In contrast to WT Salmonella, DCs infected with SPI-2 mutants expressing OVA showed a significant increase in the level of H-2Kb/SIINFEKL complexes on the surface (Fig. 2D). These data support the notion that the TTSS encoded by SPI-2 and the SpiC protein are critical for the evasion of antigen presentation in DCs. H-2Kb/SIINFEKL complexes were not detected in DCs infected with strains of Salmonella not expressing OVA (Fig. 2D). It is worth mentioning that differences in T-cell activation and generation of H-2Kb/SIINFEKL complexes were observed between wild-type Salmonella and each of the SPI-2 mutants despite equivalent OVA expression for each of these bacteria strains, as shown by Western blot analyses (Fig. 2E).
SPI-2 deficiency restores targeting of serovar Typhimurium to lysosomal degradation in DCs. The TTSS and effector proteins encoded by SPI-2 are important for bacterial survival and intracellular proliferation by arresting maturation of the SCV (51). While virulent strains of serovar Typhimurium reside inside DCs in vacuoles that lack lysosomal markers, efficient presentation of antigens derived from virulent Salmonella to T cells by DCs requires targeting bacteria for lysosomal degradation (25, 47).
Intracellular
destination of Salmonella mutants in DCs was evaluated using
wild-type and SPI-2 mutant Salmonella strains that express
GFP. Quantitative confocal microscopy analyses showed that vacuoles
containing GFP-expressing wild-type Salmonella did not
colocalize with the lysosomal marker LAMP-2 in DCs (Fig.
3A, E, and
F). In contrast, colocalization with LAMP-2 was observed for the three
SPI-2 mutant Salmonella strains analyzed (Fig.
3B to D and F). As shown
by fluorescence extension analysis, significant colocalization for
fluorescence intensity derived from LAMP-2 and GFP inside DCs was
observed only for
SpiA,
SpiC, and
SPI-2
serovar Typhimurium mutants but not for wild-type serovar Typhimurium
(Fig.
3E).
|
SpiA,
SpiC, and
SPI-2 mutant strains of serovar Typhimurium (Fig.
4C to H). Such structures
have been previously associated with bacterial lysis
(37).
|
SPI-2 deficiency leads to virulence attenuation and prevents serovar Typhimurium from evading T-cell activation in vivo.
The capacity of Salmonella
mutants to avoid activation of the immune system was measured in vivo.
Mice were infected orally with 106 CFU of OVA-expressing
wild-type or one of the SPI-2 mutant Salmonella strains.
Bacterial colonization capacity as well as OVA-specific IgG titers and
T cells were evaluated at day 5 postinfection. Mice infected with
wild-type bacteria showed three to fourfold higher CFU in liver,
spleen, and LNs compared to mice infected with any of the
Salmonella SPI-2 mutants (Fig.
5A). These data are consistent with the notion that a
deficient SPI-2 function attenuates virulence and reduces bacterial
dissemination and organ colonization
(6). However, whether
attenuation due to SPI-2 mutations could lead to a reduced capacity of
bacteria to evade adaptive immunity has not been evaluated. When
humoral responses were measured in mice infected with OVA-expressing
Salmonella, anti-OVA IgG titers elicited by each of the SPI-2
mutants were twofold higher than with wild-type virulent
Salmonella (Fig.
5B). In addition,
IFN-
and IL-2 production by T cells specific for OVA- or
flagellin-derived peptides could only be measured in mice challenged
with
SPI-2,
SpiA, or
SpiC mutant
Salmonella strains and not in mice infected with wild-type
Salmonella (Fig.
5C). No measurable
cytokine release was observed in the absence of antigenic peptide (not
shown). Although T cells obtained from mice challenged with the
SpiA mutant showed lower cytokine release when stimulated with
FliC peptide than with OVA peptides, the response of these cells to
FliC was significantly higher than T cells obtained from
mice challenged with WT Salmonella (Fig.
5C). The reduced FliC
response shown by mice challenged with the
SpiA mutant could
be due to the expression of an immature form of flagellin by this
mutant, which is likely to be less available for T-cell priming
(31,
38).
|
To further
evaluate this notion, an in vivo T-cell proliferation assay was
performed using OVA-expressing wild-type or SPI-2 mutant
Salmonella strains. CFSE-labeled T cells obtained either from
OT-I, OT-II, or SM1 transgenic mice were i.v. injected into syngeneic
recipient mice (3).
Twenty-four hours later, 105 CFU of the wild type or one of
the SPI-2 mutant strains of Salmonella were administered by
the same route (41).
Three days after bacterial injection, proliferation of OT-I, OT-II, or
SM1 T cells was evaluated in spleens of recipient mice by dilution of
the CFSE signal. Proliferation of CD8+ (OT-I) or
CD4+ (OT-II and SM1) was only observed in mice
injected with SPI-2 mutant strains of Salmonella and not in
mice challenged with wild-type virulent Salmonella (Fig.
6A). Differences in the efficiency of CFSE labeling and proliferation
between OT-I, OT-II, and SM1 observed in these assays could be due to
intrinsic features of each TCR transgenic system
(5). To determine whether
T cells that proliferated in response to bacterial challenge are
functional, we measured IFN-
secretion by OT-I transgenic T
cells by intracellular cytokine staining. As shown in Fig.
6B, proliferating OT-I T
cells were positive for intracellular IFN-
. These data suggest
that mutant bacteria were efficiently processed and presented to
naïve transgenic T cells in vivo by endogenous APCs. Furthermore,
the observation that equivalent results were obtained with OT-II and
SM1 T cells suggests that the SPI-2-mediated bacterial evasion of
antigen presentation to T cells is common to autologous (flagellin) and
heterologous (OVA) antigens expressed by
Salmonella.
|
SPI-2 mutant strain of serovar Typhimurium, and to lesser
extent those infected with
SpiA and
SpiC mutant
strains, were protected against a challenge with wild-type serovar
Typhimurium. Infection with WT Salmonella led to death of
naïve mice before the time of challenge (data not shown)
(10). | DISCUSSION |
|---|
|
|
|---|
To study the role of SPI-2 gene products in the interactions between Salmonella and DCs, we generated mutant strains by removing either the complete SPI-2 or two specific genes, spiA and spiC. A deficiency of SpiA prevents the assembly of the TTSS needle complex encoded by SPI-2 and impairs the translocation of bacterial effector proteins into the host cell cytoplasm (14, 38). One of these effectors corresponds to SpiC, which is required both to translocate effector proteins by the SPI-2-encoded TTSS (13) as well as to interfere with vesicular trafficking in host cells to prevent SCV-lysosome fusion (14, 38). Although wild-type Salmonella and each of the three SPI-2 mutants showed equivalent capacities to infect DCs, a significantly reduced capacity to survive inside DCs was demonstrated for all of the SPI-2 mutants (Fig. 2A). In a previous report, no differences in survival were observed for serovar Typhimurium and a PhoPc mutant after infecting DCs (36). Different mouse strains as DC sources (47) as well as the pleiotropic effect caused by the PhoPc mutation could account for this apparent discrepancy.
Consistent with previous
reports (36,
44), under the
experimental conditions applied during this study we did not observe
significant DC death as result of infection with serovar Typhimurium
(Fig. 2). However,
evidence for induction of apoptosis as a strategy for interfering with
DC function has been provided recently
(50). The difference
could be explained by the superior aggressiveness shown by strain SR-11
3041 used in reference
50, compared to strain
14028s used here (50% lethal dose, 2.4 x 104 and
105, respectively [determined in the same mouse strain and
under equivalent experimental conditions])
(19,
30).
Taken together, our data suggest that SPI-2 Salmonella mutants fail to survive inside murine DCs. Accordingly, bacterial colocalization with lysosomal markers, generation of pMHC complexes loaded with bacterium-derived antigens, and activation of antigen-specific T cells were only observed for DCs infected with SPI-2 mutant strains of Salmonella. These results were consistent with the observations made in vivo where SPI-2 deficiency impaired organ colonization by bacteria and led to a significant increase in the adaptive immune response against Salmonella. Furthermore, infection with each of the SPI-2 mutants studied here led to significant protection against a lethal challenge with wild-type serovar Typhimurium (Fig. 6C). Although significant differences were only seen between naïve and each of the SPI-2-immunized mice, the observation that infection with SpiA and SpiC mutants led to different outcomes in mouse survival after challenge with virulent Salmonella (Fig. 6C) suggests that these mutations are not phenotypically redundant (38, 48).
The findings described here support the notion that interference with DC function is a mechanism of pathogenicity employed by virulent Salmonella to evade T-cell recognition. We showed that this feature of Salmonella virulence requires functional expression of SPI-2. Both the functional assembly of an SPI-2-encoded TTSS and the activity of effector proteins, such as SpiC, are critical for the capacity of Salmonella residing inside DCs to evade antigen presentation to T cells. Recently, evidence has been provided for the induction of inducible nitrogen oxide synthase in DCs as a result of the interaction with virulent Salmonella (6, 12). Considering that NO has been shown to inhibit T-cell function (11), it is conceivable that the avoidance of T-cell activation by virulent Salmonella infecting DCs could be at least in part the result of NO secretion. However, we think this scenario is unlikely, based on recent data showing no differences in the amount of NO secreted by DCs infected by wild-type and SPI-2 mutant strains of Salmonella (6). In addition, DCs infected with wild-type Salmonella were able to prime T cells when exogenously pulsed with MHC-I- and MHC-II-restricted peptides (data not shown) (47). Furthermore, the observation that virulent Salmonella keeps DCs from presenting bacterium-expressed antigens on MHC-I and -II, both in vitro and in vivo, would be sufficient to explain the absence of T-cell activation.
Our results are consistent with a recent study
showing that virulent Salmonella can impair activation of
MHC-II-restricted T cells by DCs in vitro
(6). However, it is
important to note that in that study OVA was not expressed by
Salmonella and was used instead as an accompanying soluble
antigen (6). Here we have
further expanded on this notion by showing that virulent
Salmonella is able to keep DCs from activating T cells that
recognize antigens expressed by bacteria on class I and class II MHC
molecules. In addition, we show that this mechanism of evasion has
biological significance in vivo by adoptive transfer experiments using
transgenic mice expressing TCRs that recognize antigens expressed by
Salmonella on MHC class I and class II. Furthermore, we show
that equivalent results are obtained in naïve (nontransgenic)
mice challenged with wild-type virulent Salmonella, in which
the pathogen suppresses cellular and humoral adaptive immune responses
(Fig. 5). According to our
data, this pathogenic feature of virulent Salmonella also
depends on the functional expression of SPI-2. However, in addition to
deleting the entire SPI-2 region, we have identified specific genes
that seem responsible for the capacity of Salmonella to avoid
presentation of bacterium-derived antigens by DCs, with the consequent
impairment on T- and B-cell-mediated host immunity. In the absence of
functional SPI-2- or SPI-2-specific genes encoding TTSS components or
effector proteins, Salmonella is unable to prevent
presentation of bacterium-expressed antigens to T cells by infected
DCs. As a result of a deficiency in either SPI-2, spiC, or
spiA, T cells are activated in vitro by infected DCs (Fig.
2). Furthermore, challenge
of mice with SPI-2 mutant strains of Salmonella leads to
activation of transgenic T cells in vivo and secretion of IFN-
(Fig. 6). Accordingly,
SPI-2-deficient Salmonella strains are unable to prevent
antibody- and T cell-mediated immunity and fail to cause systemic
infection and colonization of internal tissues (Fig.
5). In addition to the
evasion of T-cell activation we report here, evidence has been provided
recently for an additional mechanism displayed by Salmonella
to interfere with T-cell function which seems to require
bacterium-T-cell contact
(49). Given that under
our experimental conditions T cells interact with DCs that have
previously captured Salmonella and extracellular
Salmonella are removed by treatment with gentamicin, we think
that in our assays direct Salmonella-T-cell
interactions are unlikely. The observation that Salmonella can
at least employ two distinct strategies to prevent T-cell activation
underscores the molecular sophistication developed for this bacterial
pathogen to evade adaptive immunity in the host.
Survival inside DCs in the absence of presentation of bacterial antigens to T cells is likely to be highly significant for the capacity of Salmonella to cause systemic disease in the host, because on one hand it prevents activation of adaptive immunity and on the other it could exploit DCs as reservoirs and means for bacterial dissemination from the site of infection to internal tissues. The involvement of DCs as key targets for Salmonella pathogenesis emphasizes the necessity to identify the virulence factors responsible for interfering with DC function, which would provide valuable insights for designing new strategies to prevent systemic infection caused by this pathogen.
| ACKNOWLEDGMENTS |
|---|
This work was supported by grants FONDECYT 1030557 and 1050979, DIPUC no. 2002/11E, IFS no. A/3639-1 and no. B/3764-1, Millennium Nucleus on Immunology and Immunotherapy (A.M.K.). J.A.T. is a DIPUC fellow. L.J.C., P.A.G., and S.M.B. are CONICYT fellows.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
| 1. | Agrawal, A., J. Lingappa, S. H. Leppla, S. Agrawal, A. Jabbar, C. Quinn, and B. Pulendran. 2003. Impairment of dendritic cells and adaptive immunity by anthrax lethal toxin.Nature 424:329-334.[CrossRef][Medline] |
| 2. | Beuzon, C. R., G. Banks, J. Deiwick, M. Hensel, and D. W. Holden. 1999. pH-dependent secretion of SseB, a product of the SPI-2 type III secretion system of Salmonella typhimurium. Mol. Microbiol. 33:806-816.[CrossRef][Medline] |
| 3. | Bonifaz,
L., D. Bonnyay, K. Mahnke, M. Rivera, M. C. Nussenzweig, and
R. M. Steinman. 2002. Efficient targeting of
protein antigen to the dendritic cell receptor DEC-205 in the steady
state leads to antigen presentation on major histocompatibility complex
class I products and peripheral CD8+ T cell
tolerance. J. Exp. Med.
196:1627-1638. |
| 4. | Bousso, P., and E. Robey. 2003. Dynamics of CD8+ T cell priming by dendritic cells in intact lymph nodes. Nat. Immunol. 4:579-585.[CrossRef][Medline] |
| 5. | Bumann, D. 2003. T cell receptor-transgenic mouse models for studying cellular immune responses to Salmonella in vivo. FEMS Immunol. Med. Microbiol. 37:105-109.[CrossRef][Medline] |
| 6. | Cheminay,
C., A. Mohlenbrink, and M. Hensel. 2005. Intracellular
salmonella inhibit antigen presentation by dendritic cells.J. Immunol.
174:2892-2899. |
| 7. | Chen,
H., and D. M. Schifferli. 2003.
Construction, characterization, and immunogenicity of an attenuated
Salmonella enterica serovar Typhimurium pgtE vaccine
expressing fimbriae with integrated viral epitopes from the spiC
promoter. Infect. Immun.
71:4664-4673. |
| 8. | Clarke, S. R., M. Barnden, C. Kurts, F. R. Carbone, J. F. Miller, and W. R. Heath.2000 . Characterization of the ovalbumin-specific TCR transgenic line OT-I: MHC elements for positive and negative selection.Immunol. Cell Biol. 78:110-117.[CrossRef][Medline] |
| 9. | Datsenko,
K. A., and B. L. Wanner. 2000.
One-step inactivation of chromosomal genes in Escherichia coli K-12
using PCR products. Proc. Natl. Acad. Sci. USA
97:6640-6645. |
| 10. | Detweiler, C. S., D. M. Monack, I. E. Brodsky, H. Mathew, and S. Falkow. 2003. virK, somA and rcsC are important for systemic Salmonella enterica serovar Typhimurium infection and cationic peptide resistance. Mol. Microbiol. 48:385-400.[CrossRef][Medline] |
| 11. | Eisenstein, T. K. 2001. Implications of Salmonella-induced nitric oxide (NO) for host defense and vaccines: NO, an antimicrobial, antitumor, immunosuppressive and immunoregulatory molecule. Microbes Infect. 3:1223-1231.[CrossRef][Medline] |
| 12. | Eriksson, S., B. J. Chambers, and M. Rhen. 2003. Nitric oxide produced by murine dendritic cells is cytotoxic for intracellular Salmonella enterica sv. Typhimurium. Scand. J. Immunol. 58:493-502. |
| 13. | Freeman,
J. A., C. Rappl, V. Kuhle, M. Hensel, and S. I.
Miller. 2002. SpiC is required for translocation of
Salmonella pathogenicity island 2 effectors and secretion of
translocon proteins SseB and SseC. J. Bacteriol.
184:4971-4980. |
| 14. | Galan,
J. E., C. Ginocchio, and P. Costeas. 1992.
Molecular and functional characterization of the Salmonella
invasion gene invA: homology of InvA to members of a new
protein family. J. Bacteriol.
174:4338-4349. |
| 15. | Granucci, F., and P. Ricciardi-Castagnoli. 2003. Interactions of bacterial pathogens with dendritic cells during invasion of mucosal surfaces. Curr. Opin. Microbiol. 6:72-76.[CrossRef][Medline] |
| 16. | Groisman,
E. A. 2001. The pleiotropic two-component
regulatory system PhoP-PhoQ. J. Bacteriol.
183:1835-1842. |
| 17. | Hanekom, W. A., M. Mendillo, C. Manca, P. A. Haslett, M. R. Siddiqui, C. Barry III, and G. Kaplan.2003 . Mycobacterium tuberculosis inhibits maturation of human monocyte-derived dendritic cells in vitro. J. Infect. Dis. 188:257-266.[CrossRef][Medline] |
| 18. | Hansen-Wester,
I., B. Stecher, and M. Hensel. 2002. Type III
secretion of Salmonella enterica serovar Typhimurium
translocated effectors and SseFG. Infect. Immun.
70:1403-1409. |
| 19. | Heithoff,
D. M., R. L. Sinsheimer, D. A. Low, and
M. J. Mahan. 1999. An essential role for DNA
adenine methylation in bacterial virulence. Science
284:967-970. |
| 20. | Hensel, M., J. E. Shea, S. R. Waterman, R. Mundy, T. Nikolaus, G. Banks, A. Vazquez-Torres, C. Gleeson, F. C. Fang, and D. W. Holden. 1998. Genes encoding putative effector proteins of the type III secretion system of Salmonella pathogenicity island 2 are required for bacterial virulence and proliferation in macrophages. Mol. Microbiol. 30:163-174.[CrossRef][Medline] |
| 21. | Holden, D. W. 2002. Trafficking of the Salmonella vacuole in macrophages. Traffic 3:161-169.[CrossRef][Medline] |
| 22. | Inobe,
M., and R. H. Schwartz. 2004. CTLA-4
engagement acts as a brake on CD4+ T cell
proliferation and cytokine production but is not required for tuning T
cell reactivity in adaptive tolerance. J.
Immunol.
173:7239-7248. |
| 23. | Iruretagoyena,
M. I., J. A. Tobar, P. A. Gonzalez,
S. E. Sepulveda, C. A. Figueroa, R. A.
Burgos, J. L. Hancke, and A. M. Kalergis.2005
. Andrographolide interferes with T cell activation
and reduces experimental autoimmune encephalomyelitis in the mouse.J. Pharmacol. Exp. Ther.
312:366-372. |
| 24. | Itano, A. A., and M. K. Jenkins. 2003. Antigen presentation to naive CD4 T cells in the lymph node.Nat. Immunol. 4:733-739.[CrossRef][Medline] |
| 25. | Jantsch, J., C. Cheminay, D. Chakravortty, T. Lindig, J. Hein, and M. Hensel. 2003. Intracellular activities of Salmonella enterica in murine dendritic cells. Cell Microbiol. 5:933-945.[CrossRef][Medline] |
| 26. | Kalergis,
A. M., and J. V. Ravetch. 2002.
Inducing tumor immunity through the selective engagement of activating
Fc receptors on dendritic cells. J. Exp. Med.
195:1653-1659. |
| 27. | Lauvau, G., and N. Glaichenhaus. 2004. Mini-review: presentation of pathogen-derived antigens in vivo. Eur. J. Immunol. 34:913-920.[CrossRef][Medline] |
| 28. | Lejona,
S., A. Aguirre, M. L. Cabeza, E. Garcia Vescovi, and
F. C. Soncini. 2003. Molecular
characterization of the Mg2+-responsive PhoP-PhoQ
regulon in Salmonella enterica. J. Bacteriol.
185:6287-6294. |
| 29. | Li, Y., Y. Ke, P. D. Gottlieb, and J. A. Kapp.1994 . Delivery of exogenous antigen into the major histocompatibility complex class I and class II pathways by electroporation. J. Leukoc. Biol. 56:616-624.[Abstract] |
| 30. | Lockman,
H. A., and R. Curtiss III. 1990.
Salmonella typhimurium mutants lacking flagella or motility
remain virulent in BALB/c mice. Infect. Immun.
58:137-143. |
| 31. | Lyons,
S., L. Wang, J. E. Casanova, S. V. Sitaraman, D.
Merlin, and A. T. Gewirtz. 2004. Salmonella
typhimurium transcytoses flagellin via an SPI2-mediated vesicular
transport pathway. J. Cell Sci.
117:5771-5780. |
| 32. | McClelland, M., K. E. Sanderson, J. Spieth, S. W. Clifton, P. Latreille, L. Courtney, S. Porwollik, J. Ali, M. Dante, F. Du, S. Hou, D. Layman, S. Leonard, C. Nguyen, K. Scott, A. Holmes, N. Grewal, E. Mulvaney, E. Ryan, H. Sun, L. Florea, W. Miller, T. Stoneking, M. Nhan, R. Waterston, and R. K. Wilson. 2001. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413:852-856.[CrossRef][Medline] |
| 33. | McSorley, S. J., S. Asch, M. Costalonga, R. L. Reinhardt, and M. K. Jenkins. 2002. Tracking Salmonella-specific CD4 T cells in vivo reveals a local mucosal response to a disseminated infection. Immunity 16:365-377.[CrossRef][Medline] |
| 34. | Mendel, I., and E. M. Shevach. 2006. Activated T cells express the OX40 ligand: requirements for induction and costimulatory function. Immunology 117:196-204.[CrossRef][Medline] |
| 35. | Monack,
D. M., D. Hersh, N. Ghori, D. Bouley, A. Zychlinsky, and S.
Falkow. 2000. Salmonella exploits caspase-1 to
colonize Peyer's patches in a murine typhoid model. J. Exp.
Med.
192:249-258. |
| 36. | Niedergang, F., A. Didierlaurent, J. P. Kraehenbuhl, and J. C. Sirard. 2004. Dendritic cells: the host Achille's heel for mucosal pathogens? Trends Microbiol. 12:79-88.[CrossRef][Medline] |
| 37. | Niedergang,
F., J. C. Sirard, C. T. Blanc, and J. P.
Kraehenbuhl. 2000. Entry and survival of Salmonella
typhimurium in dendritic cells and presentation of recombinant antigens
do not require macrophage-specific virulence factors. Proc.
Natl. Acad. Sci. USA
97:14650-14655. |
| 38. | Ochman,
H., F. C. Soncini, F. Solomon, and E. A.
Groisman. 1996. Identification of a pathogenicity
island required for Salmonella survival in host cells. Proc.
Natl. Acad. Sci. USA
93:7800-7804. |
| 39. | Porgador, A., J. W. Yewdell, Y. Deng, J. R. Bennink, and R. N. Germain. 1997. Localization, quantitation, and in situ detection of specific peptide-MHC class I complexes using a monoclonal antibody. Immunity 6:715-726.[CrossRef][Medline] |
| 40. | Robertson,
J. M., P. E. Jensen, and B. D.
Evavold. 2000. DO11.10 and OT-II T cells recognize a
C-terminal ovalbumin 323-339 epitope. J.
Immunol.
164:4706-4712. |
| 41. | Srinivasan,
A., J. Foley, R. Ravindran, and S. J. McSorley.2004
. Low-dose Salmonella infection evades activation of
flagellin-specific CD4 T cells. J. Immunol.
173:4091-4099. |
| 42. | Stagg,
A. J., A. L. Hart, S. C. Knight, and
M. A. Kamm. 2003. The dendritic cell: its
role in intestinal inflammation and relationship with gut bacteria.Gut
52:1522-1529. |
| 43. | Steinman, R. M., D. Hawiger, and M. C. Nussenzweig.2003 . Tolerogenic dendritic cells. Annu. Rev. Immunol. 21:685-711.[CrossRef][Medline] |
| 44. | Svensson,
M., C. Johansson, and M. J. Wick. 2000.
Salmonella enterica Serovar Typhimurium-induced maturation of
bone marrow-derived dendritic cells. Infect. Immun.
68:6311-6320. |
| 45. | Svensson, M., B. Stockinger, and M. J. Wick. 1997. Bone marrow-derived dendritic cells can process bacteria for MHC-I and MHC-II presentation to T cells. J. Immunol. 158:4229-4236.[Abstract] |
| 46. | Tau,
G. Z., S. N. Cowan, J. Weisburg, N. S.
Braunstein, and P. B. Rothman. 2001.
Regulation of IFN-gamma signaling is essential for the cytotoxic
activity of CD8+ T cells. J.
Immunol.
167:5574-5582. |
| 47. | Tobar,
J. A., P. A. Gonzalez, and A. M.
Kalergis. 2004. Salmonella escape from antigen
presentation can be overcome by targeting bacteria to Fc gamma
receptors on dendritic cells. J. Immunol.
173:4058-4065. |
| 48. | Uchiya, K., M. A. Barbieri, K. Funato, A. H. Shah, P. D. Stahl, and E. A. Groisman.1999 . A Salmonella virulence protein that inhibits cellular trafficking. EMBO J. 18:3924-3933.[CrossRef][Medline] |
| 49. | van
der Velden, A. W., M. K. Copass, and M.
N. Starnbach. 2005. Salmonella inhibit T cell
proliferation by a direct, contact-dependent immunosuppressive effect.Proc. Natl. Acad. Sci. USA
102:17769-17774. |
| 50. | van
der Velden, A. W. M., M. Velasquez, and
M. N. Starnbach. 2003. Salmonella rapidly
kill dendritic cells via a caspase-1- dependent mechanism.J. Immunol.
171:6742-6749. |
| 51. | Waterman, S. R., and D. W. Holden. 2003. Functions and effectors of the Salmonella pathogenicity island 2 type III secretion system. Cell Microbiol. 5:501-511.[CrossRef][Medline] |
| 52. | Wick, M. J. 2003. The role of dendritic cells in the immune response to Salmonella. Immunol. Lett. 85:99-102.[CrossRef][Medline] |
| 53. | Yrlid, U., M. Svensson, A. Kirby, and M. J. Wick.2001 . Antigen-presenting cells and anti-Salmonella immunity. Microbes Infect. 3:1239-1248.[CrossRef][Medline] |
| 54. | Yu, X. J., J. Ruiz-Albert, K. E. Unsworth, S. Garvis, M. Liu, and D. W. Holden. 2002. SpiC is required for secretion of Salmonella pathogenicity island 2 type III secretion system proteins. Cell Microbiol. 4:531-540.[CrossRef][Medline] |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||