This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tobar, J. A.
Right arrow Articles by Kalergis, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tobar, J. A.
Right arrow Articles by Kalergis, A. M.

 Previous Article  |  Next Article 

Infection and Immunity, November 2006, p. 6438-6448, Vol. 74, No. 11
0019-9567/06/$08.00+0     doi:10.1128/IAI.00063-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Virulent Salmonella enterica Serovar Typhimurium Evades Adaptive Immunity by Preventing Dendritic Cells from Activating T Cells

Jaime A. Tobar,1 Leandro J. Carreño,1 Susan M. Bueno,1 Pablo A. González,1 Jorge E. Mora,1 Sergio A. Quezada,1 and Alexis M. Kalergis1,2,3*

Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas,1 Departamento de Reumatología, Facultad de Medicina, Pontificia Universidad Católica de Chile, Santiago, Chile,2 Department of Microbiology and Immunology, Albert Einstein College of Medicine, New York, New York3

Received 12 January 2006/ Returned for modification 28 February 2006/ Accepted 26 July 2006


arrow
ABSTRACT
 
Dendritic cells (DCs) constitute the link between innate and adaptive immunity by directly recognizing pathogen-associated molecular patterns (PAMPs) in bacteria and by presenting bacterial antigens to T cells. Recognition of PAMPs renders DCs as professional antigen-presenting cells able to prime naïve T cells and initiate adaptive immunity against bacteria. Therefore, interfering with DC function would promote bacterial survival and dissemination. Understanding the molecular mechanisms that have evolved in virulent bacteria to evade activation of adaptive immunity requires the characterization of virulence factors that interfere with DC function. Salmonella enterica serovar Typhimurium, the causative agent of typhoid-like disease in the mouse, can prevent antigen presentation to T cells by avoiding lysosomal degradation in DCs. Here, we show that this feature of virulent Salmonella applies in vivo to prevent activation of adaptive immunity. In addition, this attribute of virulent Salmonella requires functional expression of a type three secretion system (TTSS) and effector proteins encoded within the Salmonella pathogenicity island 2 (SPI-2). In contrast to wild-type virulent Salmonella, mutant strains carrying specific deletions of SPI-2 genes encoding TTSS components or effectors proteins are targeted to lysosomes and are no longer able to prevent DCs from activating T cells in vitro or in vivo. SPI-2 mutant strains are attenuated in vivo, showing reduced tissue colonization and enhanced T-cell activation, which confers protection against a challenge with wild-type virulent Salmonella. Our data suggest that impairment of DC function by the activity of SPI-2 gene products is crucial for Salmonella pathogenesis.


arrow
INTRODUCTION
 
Dendritic cells (DCs) are key elements for the generation of an efficient adaptive immune response against bacterial pathogens (15, 52). They have the unique ability to initiate adaptive immunity by activating naïve T cells. Recognition of pathogen-associated molecular patterns from bacteria (43) leads to DC maturation and migration to secondary lymphoid organs (4, 24). As part of maturation, DCs show an increased density of major histocompatibility complex (MHC) and costimulatory molecules on their surface and become extremely efficient at activating bacterium-specific naïve T cells (27, 42). Therefore, interfering with DC activity would be advantageous for virulent bacteria, enabling them to survive and disseminate efficiently inside the host (1, 17).

Previously, we have shown that Salmonella enterica serovar Typhimurium, the causative agent of a typhoid-like disease in the mouse, can escape from antigen presentation by DCs (47). We observed that vacuoles containing virulent serovar Typhimurium inside DCs do not colocalize with lysosomal markers (47). These data suggested the avoidance of lysosomal degradation as a mechanism likely to be responsible for the escape of antigen presentation in DCs (47). This escape mechanism seems to be restricted to virulent strains, because attenuated Salmonella strains, such as mutants of the phoP/Q locus, fail to escape from DC processing and presentation (37). Considering that this locus encodes a two-component regulatory system that controls expression of virulence genes encoded within Salmonella pathogenicity islands 1 and 2 (SPI-1 and SPI-2, respectively) (16, 28), it is likely that these genetic elements could be responsible for interfering with DC function. SPI-1 and SPI-2 encode type three secretion systems (TTSS) that translocate effector proteins (also encoded by SPI-1 and -2) into the cytoplasm of host cells. These effector proteins subvert cellular metabolism to mediate bacterial entry and survival inside host cells. Translocation of effector proteins by the SPI-2 TTSS increases intracellular bacterial survival by preventing the fusion of Salmonella-containing vacuoles (SCV) with lysosomes (48).

Consistent with this notion, it has been recently shown that strains of Salmonella in which the entire SPI-2 region has been deleted are rendered unable to evade presentation of bystander antigens by DCs to MHC class II (MHC-II)-restricted T cells in vitro (6). Here we extend these findings by evaluating the mechanism by which SPI-2-encoded genes of serovar Typhimurium contribute to the escape from presentation of bacterium-expressed antigens by murine DCs to MHC-I- and MHC-II-restricted T cells, both in vitro and in vivo. To approach this question, we deleted the entire SPI-2, as well as specific genes contained within this genetic region that are needed for the assembly of TTSS and for the interference with vesicular trafficking in host cells. Our results show that each of the mutations on SPI-2 impaired the ability of serovar Typhimurium to escape from antigen processing and presentation by DCs. The mechanism responsible seems to be the loss of the ability to avoid intracellular degradation by lysosomes. Consistent with these findings, SPI-2 mutants showed decreased virulence in vivo, as demonstrated by reduced tissue colonization and increased bacterium-specific T-cell and antibody responses. In addition, infection with each of the SPI-2 mutated strains led to protective immunity against challenge with the wild-type (WT) virulent Salmonella strain. Our data support the notion that the ability to interfere with DC function promotes serovar Typhimurium pathogenicity by avoiding bacterial degradation and activation of adaptive immunity. We have identified some of the virulence factors of serovar Typhimurium that mediate this strategy and which subvert DC function and could promote systemic disease in the host.


arrow
MATERIALS AND METHODS
 
Mice. C57BL/6 mice were purchased and maintained at the animal facilities of P. Universidad Católica de Chile. OT-I (8) and OT-II (40) transgenic mice with a specific T-cell receptor (TCR) for H-2Kb/OVA257-264 and I-Ab/OVA323-339, respectively, were provided by R. Steinman. SM1 transgenic mice expressing a TCR specific for I-Ab/FliC427-441 (33) were provided by S. McSorley. Animal work was performed according to institutional guidelines.

Bacterial strains. Salmonella enterica serovar Typhimurium 14028s (herein WT) was used as the parental strain (47). Mutants for spiA, spiC, and SPI-2 were generated by allelic exchange (9). Primers designed according to the serovar Typhimurium LT2 sequence (32) were as follows (5' to 3'): for disruption of spiA, GGGGTATAAAATGGTAGTAAATAAACGTTTAATCTTAATTTGTAGGCTGGAGCTGCTTCGand ACTCTTTGGATTAACCATGAGATATGCCATTATTTACTACCATATGAATATCCTCCTTAG; for disruption of spiC, TTTGATAGAAACTCCCATTTATGTCTGAGGAGGGATTCATTGTAGGCTGGAGCTGCTTCGwith GCCAGGTGTTTTTCTATCTCAATAGCAATAAGCTCAGAGCCATATGAATATCCTCCTTA; for disruption of SPI-2, GCGCATAATGTCAATCGAGCAACTTTTTGCCTTCCAGGTCTGTAGGCTGGAGCTGCTTCGand CCAAAAGCATTTATGGTGTTTCGGTAGAATGCGCATAATCCATATGAATATCCTCCTTAG. Genomic deletions were confirmed by PCR using primers up- and downstream from the exchanged site.

To complement the spiA and spiC mutants, the complete coding sequences of these genes were amplified using the following primers (5' to 3'): for SpiA, SpiA-F (GCCCATGGTTAACCATGAGATATGC) and SpiA-R (GGCCATGGTAGTAAATAAACGTTTA); for SpiC, SpiC-F (ATGTCTGAGGAGGGATTCATGC) and SpiC-R (CGGAATTCTTATACCCCACCCGAAT). The products were inserted into the low-copy-number pACYC184 vector. Expression of both complemented genes was controlled by the endogenous promoter by cloning SpiC promoter with primers PSpiC-F (GCGAATTCAATGCTTCCCTCCAGTT) and PSpic-R (GCCCATGGAAATGGGAGTTTCTATC) as described elsewhere (7). Ovalbumin (OVA)-expressing and green fluorescent protein (GFP)-expressing Salmonella strains were obtained by transformation with pOVA and pGFP and evaluated by Western blotting, using an OVA-specific rabbit anti-antiserum (ICN, Biomedicals Inc.) and fluorescence microscopy, respectively (47).

Reverse transcription-PCRs (RT-PCRs) and Western blotting. cDNAs obtained from total RNA from bacterial cultures grown overnight in N salts medium at pH 5 (2, 18) were tested for amplification of spiA and spiC using primers SpiA-F with -R and SpiC-F with -R, respectively. Protein secretion by the SPI-2-encoded TTSS was evaluated by Western blot detection of SseB in supernatants of bacteria cultures, as previously described (20).

Antigen presentation assays, bacterial survival, and DC viability. As previously described (47), bone marrow-derived DCs (day 6 of culture) were pulsed for 4 h with OVA-expressing wild-type or SPI-2 mutant Salmonella strains at a multiplicity of infection (MOI) equal to 50 and treated with gentamicin (100 µg/ml; Sigma) to remove extracellular bacteria. As a control, DCs were loaded with various MOIs (5, 10, 25, 50, and 100) of live or heat-killed (65°C for 1 h [35]) Salmonella strains. After 12 h of culture, DCs were cocultured with either 1 x 105 B3Z or OT4H.2D5 (herein, OT4H) T-cell hybridomas, which are specific for H-2Kb/OVA257-264 and I-Ab/OVA265-280, respectively (29, 45). T-cell activation of transgenic T cells was evaluated by coculture of pulsed DCs with either OT-I or OT-II T cells (1 x 105) obtained from lymph nodes (LNs) of transgenic mice. Interleukin-2 (IL-2) release was measured after 20 h of DC-T-cell coculture (26). To evaluate bacterial infectivity and survival, 1 x 103 gentamicin-treated DCs were permeabilized for 30 min with 0.1% Triton X-100 in phosphate-buffered saline (PBS) and plated on LB agar 1 and 8 h postinfection. At the same time points, DC viability was determined by trypan blue exclusion.

Detection of bacterium-derived pMHC complexes. DCs were infected at an MOI of 50 for 4 h with either wild-type or SPI-2 mutant Salmonella strains that expressed OVA, treated with 100 µg/ml gentamicin to remove extracellular bacteria, washed at 4°C, and incubated for 16 h at 37°C in the presence of 100 µg/ml gentamicin. As a control for DC function upon bacterial pulse, DCs were copulsed with nonrecombinant WT Salmonella and 10 ng/ml of SIINFEKL peptide. Controls for background staining were unpulsed DCs and DCs pulsed with nonrecombinant WT Salmonella. DC surface H-2Kb/SIINFEKL complexes were detected by staining with anti-CD11c-phycoerythrin (PE) (clone HL3; Pharmingen) and supernatant from 25-D1.16 cells, a mouse-derived hybridoma which secretes a monoclonal antibody specific for pMHC H-2Kb/SIINFEKL (39). After washing, cells were stained with goat anti-mouse immunoglobulin G (IgG)-fluorescein isothiocyanate (Pharmingen), and the percentage of H-2Kb/SIINFEKL-positive cells in the CD11c+ population was determined by fluorescence-activated cell sorter analysis.

Confocal and electron microscopy. DCs pulsed (MOI equal to 50) with wild-type or SPI-2 mutant Salmonella strains that expressed GFP were stained with anti-CD11c-PE, washed with gentamicin-supplemented PBS, fixed with 2% paraformaldehyde, and permeabilized with Triton X-100 (0.5% Triton in 5% fetal calf serum-PBS). The lysosomal marker LAMP-2 was detected by a rabbit antiserum (Zymed Laboratories, Inc.) and revealed with a rhodamine Red-X-labeled goat anti-rabbit IgG (Molecular Probes). DCs were examined on a Zeiss LSM 5 Pa confocal microscope. Semiquantitative analysis was performed by counting DCs showing Salmonella-LAMP-2 colocalization on several randomly selected fields, and fluorescence extension analyses were performed using the Carl Zeiss LSM 5 Examiner software. DCs pulsed for 4 h with either wild-type or SPI-2 mutant Salmonella strains were prepared as previously described (47) and analyzed on a Phillips Tecnai 21 electron microscope.

In vivo attenuation assays. Mice (6 to 8 weeks of age) were orally inoculated with 100 µl of PBS containing 106 CFU of either OVA-expressing wild-type or SPI-2 mutant Salmonella strains, grown at logarithmic phase, by intragastric gavage with a 20-mm feeding tip. This dose had been previously shown to induce an immune response by oral infection with attenuated Salmonella strains (35). Uninfected control mice received an equivalent volume of PBS. At day 5 postinfection, serum anti-OVA IgG and organ colonization were measured by enzyme-linked immunosorbent assay and plating on LB-ampicillin agar, respectively. Activation of naïve T cells in mice challenged with wild-type or SPI-2 mutant Salmonella strains was evaluated on single-cell suspensions from spleens and LNs by measuring gamma interferon (IFN-{gamma}) and IL-2 release in response to stimulation for 72 h with peptides derived from OVA (OVA257-264 and OVA265-277) or flagellin (FliC427-441), at a concentration equal to 10 ng/ml. This peptide concentration had been previously shown to be appropriate to expand peptide-specific T-cell populations (23, 34). For ex vivo antigen presentation assays, mice were challenged in the footpads with 105 CFU of OVA-expressing wild-type or SPI-2 mutant Salmonella strains. After 48 h, cell suspensions obtained from popliteal LNs were used to measure H-2Kb/SIINFEKL complexes on the CD11c+ population as described above. To test the capacity of LN antigen-presenting cells (APCs) to activate T cells ex vivo, IL-2 release was measured on cocultures consisting of 105 LN-derived cells and either OT-I or OT-II T cells. For protection assays, mice were orally infected with 106 CFU OVA-expressing SPI-2 mutant strains or with PBS as a control. At day 14, mice were orally challenged with 108 CFU of wild-type Salmonella pOVA; this dose is 1,000-fold higher than the 50% lethal dose reported for this strain following oral inoculation (19). Mouse survival was evaluated within a period of 7 weeks.

In vivo T-cell proliferation and cytokine production. Single-cell suspensions obtained from spleens and LNs of either OT-I, OT-II, or SM1 transgenic mice were stained with 10 µM carboxyfluorescein diacetate succinimidyl ester (CFSE; Molecular Probes) and intravenously (i.v.) injected into syngeneic C57BL/6 recipient mice. Each splenocyte suspension was adjusted to a final volume of 500 µl containing 1 x 106 V{alpha}2+ CD8+ (for OT-I), V{alpha}2+ CD4+ (for OT-II), or Vß2+ CD4+ (for SM1) CFSE+ cells, as determined by flow cytometry (22, 41). Cells were injected into each recipient mouse, and 24 h later 1 x 105 CFU of OVA-expressing wild-type or SPI-2 mutant Salmonella strain cells were i.v. injected. Spleens were extracted from recipient mice 3 days after bacterial injection, and OT-I, OT-II, and SM1 T-cell proliferation was evaluated by dilution of CFSE labeling in the respective CD8+ or CD4+ population (22, 41). Detection of in vivo IFN-{gamma} production by OT-I transgenic T cells was evaluated as previously described (46). Briefly, splenocytes obtained from mice previously transferred with OT-I T cells as described above and challenged with Salmonella were incubated with 10 nM OVA257-264 in the presence of brefeldin A (2.5 µg/ml) for 6 h. Next, cells were washed and stained with anti-CD8-PE and fixed in 2% paraformaldehyde. After washing, cells were permeabilized with PBS-2% bovine serum albumin-0.5% Saponin, incubated with anti-IFN-{gamma}-biotin (clone XMG1.2), washed again, and stained with streptavidin-Tc. Staining for IFN-{gamma} in the CFSE+ population was determined by gating on CD8+ cells.


arrow
RESULTS
 
Generation of spiA, spiC, and SPI-2 serovar Typhimurium mutants. To evaluate the role of the SPI-2 TTSS and SPI-2-encoded effectors on the capacity of serovar Typhimurium to interfere with antigen presentation by DCs, mutant strains of Salmonella carrying a deletion of either spiA or spiC were generated. The SpiA protein (SsaC) is a component of the outer membrane ring of the TTSS needle complex encoded by SPI-2. Deletion of the spiA gene impairs TTSS function, rendering bacteria unable to translocate effector molecules into the host cell cytoplasm (38). One of these effectors is SpiC (SsaB), an acidic protein also encoded by SPI-2 (21, 51). Although SpiC also participates in effector protein translocation by the TTSS (13), in addition it plays a role in serovar Typhimurium pathogenesis by inhibiting vesicular trafficking to prevent fusion of SCV with lysosomes. Accordingly, spiC mutant strains show impaired intracellular survival in macrophages (48) and colocalize with lysosomal markers (54).

Deletion of spiA and spiC from the chromosome was confirmed by PCR (not shown) and by RT-PCR of total RNA obtained from strains grown in N salt medium at pH 5.0, which induces expression and secretion of SPI-2-encoded effector proteins to the culture supernatant (2, 18). As shown in Fig. 1A, spiA or spiC transcripts could not be detected in the respective mutant strain. As a control for transcription of both coding sequences, an SPI-2 null mutant was also generated (Fig. 1A). In these mutants, translocation was evaluated by Western blot detection of SseB, an effector protein encoded by SPI-2 and secreted by the SPI-2 TTSS. Consistent with previous observations (13), a significant reduction on SseB secretion was observed for the {Delta}spiA, {Delta}spiC, and {Delta}SPI-2 Salmonella mutants (Fig. 1B). SseB secretion could be restored to wild-type levels upon complementation in trans with spiA and spiC genes for each respective null mutant (Fig. 1B).


Figure 1
View larger version (48K):
[in this window]
[in a new window]
 
FIG. 1. Transcriptional and functional characterization of S. enterica serovar Typhimurium SPI-2 mutants. A. spiA and spiC RT-PCR amplification was absent on mutant strains (upper panels) and restored by complementation (lower panels). B. Western blot analyses show that secretion of SseB by SPI-2-encoded TTSS was significantly reduced in the supernatants (SN) of mutant Salmonella strains. Bacterial lysates (BL) are included as controls.

Antigens derived from serovar Typhimurium SPI-2 mutants are efficiently processed and presented by DCs. To evaluate whether SPI-2-encoded effectors and TTSS are important for the capacity of Salmonella to evade antigen presentation, DCs were infected with OVA-expressing wild-type or mutant strains of serovar Typhimurium. Bacterial load in infected DCs was measured by gentamicin protection assays (47, 53). One hour after infection, {Delta}spiA, {Delta}spiC, and {Delta}SPI-2 null mutant strains invaded DCs with equivalent efficiency as the wild-type strain (Fig. 2A, left panel), which is consistent with previous reports (38, 48). In contrast, 8 hours postinfection a significant reduction of intracellular bacterial load for the three SPI-2 mutants was observed (Fig. 2A, left panel). Evaluation of DC survival by trypan blue exclusion at each time point after Salmonella infection showed no significant decrease in DC viability compared to uninfected cells (Fig. 2A, right panel). These data suggest that, although DCs internalize equivalent amounts of wild-type and SPI-2 Salmonella mutants, a deficiency in SPI-2 function impairs bacterial survival inside DCs.


Figure 2
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 2. SPI-2 mutant strains of Salmonella fail to evade antigen presentation by DCs. A. DCs were infected at an MOI of 50 for 4 h, washed, and incubated to evaluate Salmonella infection and survival capacity after 1 and 8 h by gentamicin protection assay (left panel). In addition, DC viability was determined at the same time points by trypan blue exclusion assay (right panel). *, P < 0.05, Student's t test, relative to WT Salmonella. B. Activation of T-cell hybridomas (B3Z and OT4H; upper panels) or transgenic T cells (OT-I and OT-II; lower panels) in response to DCs pulsed as above with OVA-expressing Salmonella and left in culture for 12 h.*, P < 0.05; n.s., nonsignificant (Student's t test relative to WT Salmonella). C. IL-2 release by OT-II T cells in response to DCs challenged with different MOIs of live (left panel) or heat-killed (right panel) WT or SPI-2 mutant Salmonella strains. D. Density of H-2Kb/SIINFEKL complexes on the surface of DCs treated as described above. OVA- and peptide-pulsed DCs were used as positive controls. Unpulsed DCs and DCs infected with the parental strain of Salmonella (14028s), which does not express OVA, were included as negative controls to show background staining. Data shown are the percentages of CD11c+ cells positive for surface H-2Kb/SIINFEKL. *, P < 0.05; **, P < 0.01; n.s., nonsignificant (Student's t test relative to WT Salmonella). E. OVA expression on WT and SPI-2 mutant Salmonella strains was evaluated by Western blotting with two different amounts of bacterial protein extracts.

When the capacity of infected DCs to present bacterial antigens to T cells was tested, neither Kb/OVA- nor I-Ab/OVA-specific T-cell lines were activated in response to DCs infected by wild-type Salmonella expressing OVA (Fig. 2B, upper panels), which is consistent with our previous data (47). In contrast, DCs infected with SPI-2 mutants expressing OVA were able to efficiently activate both CD8+ and CD4+ OVA-specific T cells (Fig. 2B, upper panels). Similarly, when OT-I and OT-II transgenic T cells were used instead of T-cell hybridomas, only DCs pulsed with SPI-2 mutant strains of Salmonella expressing OVA were able to activate T cells (Fig. 2B, lower panels). The observation that mutations on SPI-2 impaired the ability of Salmonella to prevent activation of T cells by DCs was independent of the MOI, as shown by assays in which the number of bacteria used to infect DCs was titrated (Fig. 2C). Furthermore, interference with T-cell activation by DCs required live bacteria, because heat-killed wild-type Salmonella showed no differences with live or heat-killed SPI-2 mutants at each of the tested MOIs. No measurable IL-2 was released by T cells in response to DCs infected with Salmonella strains which do not express OVA (data not shown). The absence of T-cell activation by DCs infected with wild-type Salmonella was not due to nonspecific bacterium-mediated inhibition of T cells, as supported by the observation that Salmonella-infected DCs pulsed with exogenous SIINFEKL peptide were able to efficiently activate T cells (47) (data not shown).

Complementation of {Delta}SpiA or {Delta}SpiC mutant strains with the respective wild-type gene restored the ability of Salmonella to evade antigen presentation to T cells (Fig. 2B, upper panels). These results suggest that the phenotypes shown by the serovar Typhimurium mutants are caused by the deletion of those specific genes and not due to nonspecific genetic modifications.

To evaluate the mechanism responsible for the absence of T-cell activation, generation of bacterium-derived pMHC complexes was evaluated using an H-2Kb/SIINFEKL-specific antibody. Consistent with the T-cell activation data, H-2Kb/SIINFEKL complexes were barely detected on the surfaces of DCs infected with wild-type Salmonella expressing OVA (Fig. 2D). The absence of H-2Kb/SIINFEKL complexes was not due to reduced expression of H-2Kb molecules on the surface of DCs, because a copulse with WT Salmonella and exogenous SIINFEKL peptide restored the assembly of H-2Kb/SIINFEKL complexes (Fig. 2D). In contrast to WT Salmonella, DCs infected with SPI-2 mutants expressing OVA showed a significant increase in the level of H-2Kb/SIINFEKL complexes on the surface (Fig. 2D). These data support the notion that the TTSS encoded by SPI-2 and the SpiC protein are critical for the evasion of antigen presentation in DCs. H-2Kb/SIINFEKL complexes were not detected in DCs infected with strains of Salmonella not expressing OVA (Fig. 2D). It is worth mentioning that differences in T-cell activation and generation of H-2Kb/SIINFEKL complexes were observed between wild-type Salmonella and each of the SPI-2 mutants despite equivalent OVA expression for each of these bacteria strains, as shown by Western blot analyses (Fig. 2E).

SPI-2 deficiency restores targeting of serovar Typhimurium to lysosomal degradation in DCs. The TTSS and effector proteins encoded by SPI-2 are important for bacterial survival and intracellular proliferation by arresting maturation of the SCV (51). While virulent strains of serovar Typhimurium reside inside DCs in vacuoles that lack lysosomal markers, efficient presentation of antigens derived from virulent Salmonella to T cells by DCs requires targeting bacteria for lysosomal degradation (25, 47).

Intracellular destination of Salmonella mutants in DCs was evaluated using wild-type and SPI-2 mutant Salmonella strains that express GFP. Quantitative confocal microscopy analyses showed that vacuoles containing GFP-expressing wild-type Salmonella did not colocalize with the lysosomal marker LAMP-2 in DCs (Fig. 3A, E, and F). In contrast, colocalization with LAMP-2 was observed for the three SPI-2 mutant Salmonella strains analyzed (Fig. 3B to D and F). As shown by fluorescence extension analysis, significant colocalization for fluorescence intensity derived from LAMP-2 and GFP inside DCs was observed only for {Delta}SpiA, {Delta}SpiC, and {Delta}SPI-2 serovar Typhimurium mutants but not for wild-type serovar Typhimurium (Fig. 3E).


Figure 3
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3. SPI-2 mutant strains of Salmonella colocalize with lysosomal markers inside DCs. (A to D) Representative merged images show green (GFP) and red (LAMP-2) fluorescence in DCs infected either with GFP-expressing wild-type Salmonella (A), {Delta}spiA (B), {Delta}spiC (C), or {Delta}SPI-2 (D). Arrowheads show colocalization of GFP- and LAMP-2-derived fluorescence. Bar, 5 µm. (E) Fluorescence extension analyses for each Salmonella strain, showing the degree of overlay between green and red fluorescence. (F) Quantitative analysis of DCs showing Salmonella-GFP-LAMP-2 colocalization. *, P < 0.05 (Student's t test relative to WT Salmonella).

Furthermore, electron micrographs showed an intact ultrastructure and no signs of degradation for wild-type serovar Typhimurium residing inside large vacuoles in DCs (Fig. 4A and B). In contrast, evidence for bacterial degradation was observed as electron light structures in the cytoplasm of {Delta}SpiA, {Delta}SpiC, and {Delta}SPI-2 mutant strains of serovar Typhimurium (Fig. 4C to H). Such structures have been previously associated with bacterial lysis (37).


Figure 4
View larger version (115K):
[in this window]
[in a new window]
 
FIG. 4. Degradation signs are shown by SPI-2 mutant strains of Salmonella inside DCs. DCs were infected with wild-type or SPI-2 mutant Salmonella strains at an MOI of 50 and evaluated ultrastructurally by electron microscropy. Left panels show bacteria residing inside DCs. A zoom of the indicated area is shown in the right panels. Arrowheads show electron-light structures corresponding to degradation of bacteria. Bars, 500 nm.

The data presented above support the notion that functional SPI-2 expression is required for the capacity of Salmonella to survive inside DCs, avoiding lysosomal degradation and antigen presentation. Accordingly, lysosomal targeting and generation of bacterium-derived pMHC complexes were only observed when DCs were infected with SPI-2-deficient serovar Typhimurium.

SPI-2 deficiency leads to virulence attenuation and prevents serovar Typhimurium from evading T-cell activation in vivo. The capacity of Salmonella mutants to avoid activation of the immune system was measured in vivo. Mice were infected orally with 106 CFU of OVA-expressing wild-type or one of the SPI-2 mutant Salmonella strains. Bacterial colonization capacity as well as OVA-specific IgG titers and T cells were evaluated at day 5 postinfection. Mice infected with wild-type bacteria showed three to fourfold higher CFU in liver, spleen, and LNs compared to mice infected with any of the Salmonella SPI-2 mutants (Fig. 5A). These data are consistent with the notion that a deficient SPI-2 function attenuates virulence and reduces bacterial dissemination and organ colonization (6). However, whether attenuation due to SPI-2 mutations could lead to a reduced capacity of bacteria to evade adaptive immunity has not been evaluated. When humoral responses were measured in mice infected with OVA-expressing Salmonella, anti-OVA IgG titers elicited by each of the SPI-2 mutants were twofold higher than with wild-type virulent Salmonella (Fig. 5B). In addition, IFN-{gamma} and IL-2 production by T cells specific for OVA- or flagellin-derived peptides could only be measured in mice challenged with {Delta}SPI-2, {Delta}SpiA, or {Delta}SpiC mutant Salmonella strains and not in mice infected with wild-type Salmonella (Fig. 5C). No measurable cytokine release was observed in the absence of antigenic peptide (not shown). Although T cells obtained from mice challenged with the {Delta}SpiA mutant showed lower cytokine release when stimulated with FliC peptide than with OVA peptides, the response of these cells to FliC was significantly higher than T cells obtained from mice challenged with WT Salmonella (Fig. 5C). The reduced FliC response shown by mice challenged with the {Delta}SpiA mutant could be due to the expression of an immature form of flagellin by this mutant, which is likely to be less available for T-cell priming (31, 38).


Figure 5
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 5. SPI-2 mutant strains of Salmonella are attenuated in vivo and fail to evade T-cell activation. (A to C) Mice orally infected with OVA-expressing wild-type or SPI-2 mutant Salmonella strains were evaluated 5 days after infection for bacterial organ colonization (*, P < 0.05, Student's t test relative to WT Salmonella) (A), serum anti-OVA IgG (*, P < 0.05, Student's t test relative to preimmune serum) (B), and IFN-{gamma} and IL-2 secretion by spleen and mesenteric LN cell suspensions after 72 h of stimulation with OVA257-264 (white bars), OVA265-280 (black bars), and FliC427-441 (gray bars) peptides (*, P < 0.05; **, P < 0.01; n.s., nonsignificant, Student's t test relative to naïve mice) (C). (D) Frequency of H-2Kb/SIINFEKL+ cells in the CD11c+ DCs obtained from popliteal lymph nodes 48 h after a footpad challenge with OVA-expressing wild-type or SPI-2 mutant Salmonella strains. (E) Activation of CD8+ and CD4+ OVA-specific T cells by APCs obtained from popliteal lymph nodes 48 h after a footpad challenge with OVA-expressing wild-type or SPI-2 mutant Salmonella strains. *, P < 0.05; **, P < 0.01; n.s., nonsignificant (Student's t test relative to PBS-pulsed and unpulsed DCs in panels D and E, respectively).

Consistent with the reduced capacity shown in vitro by SPI-2 mutants to avoid antigen presentation to T cells (Fig. 2), APCs obtained from draining LNs were able to activate OVA-specific T cells only when mice were challenged with SPI-2 mutant Salmonella that expressed OVA (Fig. 5E). Activation of OVA-specific T cells was consistent with the presence of specific H-2Kb/SIINFEKL complexes on the surface of DCs residing in these LNs (Fig. 5D). These data support the notion that loss of virulence caused by SPI-2 deficiency could be due to an impaired ability of bacteria to avoid degradation by DCs, leading to presentation of bacterium-derived antigens on MHC molecules and T-cell activation.

To further evaluate this notion, an in vivo T-cell proliferation assay was performed using OVA-expressing wild-type or SPI-2 mutant Salmonella strains. CFSE-labeled T cells obtained either from OT-I, OT-II, or SM1 transgenic mice were i.v. injected into syngeneic recipient mice (3). Twenty-four hours later, 105 CFU of the wild type or one of the SPI-2 mutant strains of Salmonella were administered by the same route (41). Three days after bacterial injection, proliferation of OT-I, OT-II, or SM1 T cells was evaluated in spleens of recipient mice by dilution of the CFSE signal. Proliferation of CD8+ (OT-I) or CD4+ (OT-II and SM1) was only observed in mice injected with SPI-2 mutant strains of Salmonella and not in mice challenged with wild-type virulent Salmonella (Fig. 6A). Differences in the efficiency of CFSE labeling and proliferation between OT-I, OT-II, and SM1 observed in these assays could be due to intrinsic features of each TCR transgenic system (5). To determine whether T cells that proliferated in response to bacterial challenge are functional, we measured IFN-{gamma} secretion by OT-I transgenic T cells by intracellular cytokine staining. As shown in Fig. 6B, proliferating OT-I T cells were positive for intracellular IFN-{gamma}. These data suggest that mutant bacteria were efficiently processed and presented to naïve transgenic T cells in vivo by endogenous APCs. Furthermore, the observation that equivalent results were obtained with OT-II and SM1 T cells suggests that the SPI-2-mediated bacterial evasion of antigen presentation to T cells is common to autologous (flagellin) and heterologous (OVA) antigens expressed by Salmonella.


Figure 6
View larger version (38K):
[in this window]
[in a new window]
 
FIG. 6. Only infection with SPI-2 mutant strains of Salmonella leads to activation of naive T cells in vivo. C57BL/6 mice were adoptively transferred with CFSE-labeled OT-I, OT-II, or SM1 transgenic T cells and challenged 1 day later with virulent or SPI-2 mutant Salmonella strains. A. Mice were evaluated for in vivo activation of OT-I (upper panel), OT-II (middle panel), and SM1 (lower panel) transgenic T cells 3 days after adoptive transfer. Histograms show CFSE-derived fluorescence for CD8+ T cells (OT-I transfer) or CD4+ T cells (OT-II and SM1 transfer). B. Production of IFN-{gamma} by OT-I T cells recovered from mice treated as described above based on intracellular staining. Dot plots show the fluorescence associated with CFSE and IFN-{gamma} in the CD8+ cell population. C. Mice were infected orally with PBS (naïve) or SPI-2 Salmonella mutant strains expressing OVA and challenged with a lethal dose of wild-type Salmonella 14 days later. Survival of infected mice was monitored over a 7-week period. Data shown are means of three independent experiments. *, P = 0.05; n.s., nonsignificant (log-rank test performed for each curve relative to the others).

Infection with SPI-2-deficient serovar Typhimurium promotes immunity against virulent wild-type serovar Typhimurium. The data presented above suggested that DCs that have captured SPI-2 mutants would be able to process and present bacterial antigens in vivo to prime Salmonella-specific T cells and confer immunity against a lethal infection with wild-type serovar Typhimurium. To evaluate this notion, mice were orally inoculated with each of the SPI-2 mutants or PBS as a control. Two weeks after immunization, mice were challenged with a lethal dose of wild-type serovar Typhimurium, and survival was measured over a period of 5 weeks. As shown in Fig. 6C, mice infected with the {Delta}SPI-2 mutant strain of serovar Typhimurium, and to lesser extent those infected with {Delta}SpiA and {Delta}SpiC mutant strains, were protected against a challenge with wild-type serovar Typhimurium. Infection with WT Salmonella led to death of naïve mice before the time of challenge (data not shown) (10).


arrow
DISCUSSION
 
Here we have provided evidence for the contribution of the TTSS and effector proteins encoded by the SPI-2 gene to the ability of virulent serovar Typhimurium to survive inside DCs and evade antigen processing and presentation to T cells. Our data support the capacity of virulent Salmonella to avoid fusion of SCV with DC lysosomes as the mechanism likely to be responsible for the evasive strategy of this pathogen. This feature is restricted only to virulent Salmonella strains, as suggested by the observation that attenuated strains fail to evade antigen presentation by DCs (47). The findings presented here are consistent with the notion that the ability of Salmonella to avoid bacterial degradation by DCs contributes to preventing the activation of naïve T cells, which could be crucial for the systemic infection caused by this pathogen.

To study the role of SPI-2 gene products in the interactions between Salmonella and DCs, we generated mutant strains by removing either the complete SPI-2 or two specific genes, spiA and spiC. A deficiency of SpiA prevents the assembly of the TTSS needle complex encoded by SPI-2 and impairs the translocation of bacterial effector proteins into the host cell cytoplasm (14, 38). One of these effectors corresponds to SpiC, which is required both to translocate effector proteins by the SPI-2-encoded TTSS (13) as well as to interfere with vesicular trafficking in host cells to prevent SCV-lysosome fusion (14, 38). Although wild-type Salmonella and each of the three SPI-2 mutants showed equivalent capacities to infect DCs, a significantly reduced capacity to survive inside DCs was demonstrated for all of the SPI-2 mutants (Fig. 2A). In a previous report, no differences in survival were observed for serovar Typhimurium and a PhoPc mutant after infecting DCs (36). Different mouse strains as DC sources (47) as well as the pleiotropic effect caused by the PhoPc mutation could account for this apparent discrepancy.

Consistent with previous reports (36, 44), under the experimental conditions applied during this study we did not observe significant DC death as result of infection with serovar Typhimurium (Fig. 2). However, evidence for induction of apoptosis as a strategy for interfering with DC function has been provided recently (50). The difference could be explained by the superior aggressiveness shown by strain SR-11 {chi}3041 used in reference 50, compared to strain 14028s used here (50% lethal dose, 2.4 x 104 and 105, respectively [determined in the same mouse strain and under equivalent experimental conditions]) (19, 30).

Taken together, our data suggest that SPI-2 Salmonella mutants fail to survive inside murine DCs. Accordingly, bacterial colocalization with lysosomal markers, generation of pMHC complexes loaded with bacterium-derived antigens, and activation of antigen-specific T cells were only observed for DCs infected with SPI-2 mutant strains of Salmonella. These results were consistent with the observations made in vivo where SPI-2 deficiency impaired organ colonization by bacteria and led to a significant increase in the adaptive immune response against Salmonella. Furthermore, infection with each of the SPI-2 mutants studied here led to significant protection against a lethal challenge with wild-type serovar Typhimurium (Fig. 6C). Although significant differences were only seen between naïve and each of the SPI-2-immunized mice, the observation that infection with SpiA and SpiC mutants led to different outcomes in mouse survival after challenge with virulent Salmonella (Fig. 6C) suggests that these mutations are not phenotypically redundant (38, 48).

The findings described here support the notion that interference with DC function is a mechanism of pathogenicity employed by virulent Salmonella to evade T-cell recognition. We showed that this feature of Salmonella virulence requires functional expression of SPI-2. Both the functional assembly of an SPI-2-encoded TTSS and the activity of effector proteins, such as SpiC, are critical for the capacity of Salmonella residing inside DCs to evade antigen presentation to T cells. Recently, evidence has been provided for the induction of inducible nitrogen oxide synthase in DCs as a result of the interaction with virulent Salmonella (6, 12). Considering that NO has been shown to inhibit T-cell function (11), it is conceivable that the avoidance of T-cell activation by virulent Salmonella infecting DCs could be at least in part the result of NO secretion. However, we think this scenario is unlikely, based on recent data showing no differences in the amount of NO secreted by DCs infected by wild-type and SPI-2 mutant strains of Salmonella (6). In addition, DCs infected with wild-type Salmonella were able to prime T cells when exogenously pulsed with MHC-I- and MHC-II-restricted peptides (data not shown) (47). Furthermore, the observation that virulent Salmonella keeps DCs from presenting bacterium-expressed antigens on MHC-I and -II, both in vitro and in vivo, would be sufficient to explain the absence of T-cell activation.

Our results are consistent with a recent study showing that virulent Salmonella can impair activation of MHC-II-restricted T cells by DCs in vitro (6). However, it is important to note that in that study OVA was not expressed by Salmonella and was used instead as an accompanying soluble antigen (6). Here we have further expanded on this notion by showing that virulent Salmonella is able to keep DCs from activating T cells that recognize antigens expressed by bacteria on class I and class II MHC molecules. In addition, we show that this mechanism of evasion has biological significance in vivo by adoptive transfer experiments using transgenic mice expressing TCRs that recognize antigens expressed by Salmonella on MHC class I and class II. Furthermore, we show that equivalent results are obtained in naïve (nontransgenic) mice challenged with wild-type virulent Salmonella, in which the pathogen suppresses cellular and humoral adaptive immune responses (Fig. 5). According to our data, this pathogenic feature of virulent Salmonella also depends on the functional expression of SPI-2. However, in addition to deleting the entire SPI-2 region, we have identified specific genes that seem responsible for the capacity of Salmonella to avoid presentation of bacterium-derived antigens by DCs, with the consequent impairment on T- and B-cell-mediated host immunity. In the absence of functional SPI-2- or SPI-2-specific genes encoding TTSS components or effector proteins, Salmonella is unable to prevent presentation of bacterium-expressed antigens to T cells by infected DCs. As a result of a deficiency in either SPI-2, spiC, or spiA, T cells are activated in vitro by infected DCs (Fig. 2). Furthermore, challenge of mice with SPI-2 mutant strains of Salmonella leads to activation of transgenic T cells in vivo and secretion of IFN-{gamma} (Fig. 6). Accordingly, SPI-2-deficient Salmonella strains are unable to prevent antibody- and T cell-mediated immunity and fail to cause systemic infection and colonization of internal tissues (Fig. 5). In addition to the evasion of T-cell activation we report here, evidence has been provided recently for an additional mechanism displayed by Salmonella to interfere with T-cell function which seems to require bacterium-T-cell contact (49). Given that under our experimental conditions T cells interact with DCs that have previously captured Salmonella and extracellular Salmonella are removed by treatment with gentamicin, we think that in our assays direct Salmonella-T-cell interactions are unlikely. The observation that Salmonella can at least employ two distinct strategies to prevent T-cell activation underscores the molecular sophistication developed for this bacterial pathogen to evade adaptive immunity in the host.

Survival inside DCs in the absence of presentation of bacterial antigens to T cells is likely to be highly significant for the capacity of Salmonella to cause systemic disease in the host, because on one hand it prevents activation of adaptive immunity and on the other it could exploit DCs as reservoirs and means for bacterial dissemination from the site of infection to internal tissues. The involvement of DCs as key targets for Salmonella pathogenesis emphasizes the necessity to identify the virulence factors responsible for interfering with DC function, which would provide valuable insights for designing new strategies to prevent systemic infection caused by this pathogen.


arrow
ACKNOWLEDGMENTS
 
We thank R. Steinman for the OT-I and OT-II mice, S. McSorley for the SM1 mice, M. J. Wick for the B3Z line, J. Kapp for the OT4H line, R. Germain for the 25-D1.16 hybridoma, M. Hensel for the anti-SseB antibody, M. Iruretagoyena for critical reading of the manuscript, and Alejandro Munizaga for technical support on electronic microscopy.

This work was supported by grants FONDECYT 1030557 and 1050979, DIPUC no. 2002/11E, IFS no. A/3639-1 and no. B/3764-1, Millennium Nucleus on Immunology and Immunotherapy (A.M.K.). J.A.T. is a DIPUC fellow. L.J.C., P.A.G., and S.M.B. are CONICYT fellows.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Alameda #340, Santiago, Chile. Phone: 56-2-686-2842. Fax: 56-2-222-5515. E-mail: akalergis{at}bio.puc.cl. Back

Editor: J. L. Flynn


arrow
REFERENCES
 
    1
  1. Agrawal, A., J. Lingappa, S. H. Leppla, S. Agrawal, A. Jabbar, C. Quinn, and B. Pulendran. 2003. Impairment of dendritic cells and adaptive immunity by anthrax lethal toxin.Nature 424:329-334.[CrossRef][Medline]
  2. 2
  3. Beuzon, C. R., G. Banks, J. Deiwick, M. Hensel, and D. W. Holden. 1999. pH-dependent secretion of SseB, a product of the SPI-2 type III secretion system of Salmonella typhimurium. Mol. Microbiol. 33:806-816.[CrossRef][Medline]
  4. 3
  5. Bonifaz, L., D. Bonnyay, K. Mahnke, M. Rivera, M. C. Nussenzweig, and R. M. Steinman. 2002. Efficient targeting of protein antigen to the dendritic cell receptor DEC-205 in the steady state leads to antigen presentation on major histocompatibility complex class I products and peripheral CD8+ T cell tolerance. J. Exp. Med. 196:1627-1638.[Abstract/Free Full Text]
  6. 4
  7. Bousso, P., and E. Robey. 2003. Dynamics of CD8+ T cell priming by dendritic cells in intact lymph nodes. Nat. Immunol. 4:579-585.[CrossRef][Medline]
  8. 5
  9. Bumann, D. 2003. T cell receptor-transgenic mouse models for studying cellular immune responses to Salmonella in vivo. FEMS Immunol. Med. Microbiol. 37:105-109.[CrossRef][Medline]
  10. 6
  11. Cheminay, C., A. Mohlenbrink, and M. Hensel. 2005. Intracellular salmonella inhibit antigen presentation by dendritic cells.J. Immunol. 174:2892-2899.[Abstract/Free Full Text]
  12. 7
  13. Chen, H., and D. M. Schifferli. 2003. Construction, characterization, and immunogenicity of an attenuated Salmonella enterica serovar Typhimurium pgtE vaccine expressing fimbriae with integrated viral epitopes from the spiC promoter. Infect. Immun. 71:4664-4673.[Abstract/Free Full Text]
  14. 8
  15. Clarke, S. R., M. Barnden, C. Kurts, F. R. Carbone, J. F. Miller, and W. R. Heath.2000 . Characterization of the ovalbumin-specific TCR transgenic line OT-I: MHC elements for positive and negative selection.Immunol. Cell Biol. 78:110-117.[CrossRef][Medline]
  16. 9
  17. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
  18. 10
  19. Detweiler, C. S., D. M. Monack, I. E. Brodsky, H. Mathew, and S. Falkow. 2003. virK, somA and rcsC are important for systemic Salmonella enterica serovar Typhimurium infection and cationic peptide resistance. Mol. Microbiol. 48:385-400.[CrossRef][Medline]
  20. 11
  21. Eisenstein, T. K. 2001. Implications of Salmonella-induced nitric oxide (NO) for host defense and vaccines: NO, an antimicrobial, antitumor, immunosuppressive and immunoregulatory molecule. Microbes Infect. 3:1223-1231.[CrossRef][Medline]
  22. 12
  23. Eriksson, S., B. J. Chambers, and M. Rhen. 2003. Nitric oxide produced by murine dendritic cells is cytotoxic for intracellular Salmonella enterica sv. Typhimurium. Scand. J. Immunol. 58:493-502.
  24. 13
  25. Freeman, J. A., C. Rappl, V. Kuhle, M. Hensel, and S. I. Miller. 2002. SpiC is required for translocation of Salmonella pathogenicity island 2 effectors and secretion of translocon proteins SseB and SseC. J. Bacteriol. 184:4971-4980.[Abstract/Free Full Text]
  26. 14
  27. Galan, J. E., C. Ginocchio, and P. Costeas. 1992. Molecular and functional characterization of the Salmonella invasion gene invA: homology of InvA to members of a new protein family. J. Bacteriol. 174:4338-4349.[Abstract/Free Full Text]
  28. 15
  29. Granucci, F., and P. Ricciardi-Castagnoli. 2003. Interactions of bacterial pathogens with dendritic cells during invasion of mucosal surfaces. Curr. Opin. Microbiol. 6:72-76.[CrossRef][Medline]
  30. 16
  31. Groisman, E. A. 2001. The pleiotropic two-component regulatory system PhoP-PhoQ. J. Bacteriol. 183:1835-1842.[Free Full Text]
  32. 17
  33. Hanekom, W. A., M. Mendillo, C. Manca, P. A. Haslett, M. R. Siddiqui, C. Barry III, and G. Kaplan.2003 . Mycobacterium tuberculosis inhibits maturation of human monocyte-derived dendritic cells in vitro. J. Infect. Dis. 188:257-266.[CrossRef][Medline]
  34. 18
  35. Hansen-Wester, I., B. Stecher, and M. Hensel. 2002. Type III secretion of Salmonella enterica serovar Typhimurium translocated effectors and SseFG. Infect. Immun. 70:1403-1409.[Abstract/Free Full Text]
  36. 19
  37. Heithoff, D. M., R. L. Sinsheimer, D. A. Low, and M. J. Mahan. 1999. An essential role for DNA adenine methylation in bacterial virulence. Science 284:967-970.[Abstract/Free Full Text]
  38. 20
  39. Hensel, M., J. E. Shea, S. R. Waterman, R. Mundy, T. Nikolaus, G. Banks, A. Vazquez-Torres, C. Gleeson, F. C. Fang, and D. W. Holden. 1998. Genes encoding putative effector proteins of the type III secretion system of Salmonella pathogenicity island 2 are required for bacterial virulence and proliferation in macrophages. Mol. Microbiol. 30:163-174.[CrossRef][Medline]
  40. 21
  41. Holden, D. W. 2002. Trafficking of the Salmonella vacuole in macrophages. Traffic 3:161-169.[CrossRef][Medline]
  42. 22
  43. Inobe, M., and R. H. Schwartz. 2004. CTLA-4 engagement acts as a brake on CD4+ T cell proliferation and cytokine production but is not required for tuning T cell reactivity in adaptive tolerance. J. Immunol. 173:7239-7248.[Abstract/Free Full Text]
  44. 23
  45. Iruretagoyena, M. I., J. A. Tobar, P. A. Gonzalez, S. E. Sepulveda, C. A. Figueroa, R. A. Burgos, J. L. Hancke, and A. M. Kalergis.2005 . Andrographolide interferes with T cell activation and reduces experimental autoimmune encephalomyelitis in the mouse.J. Pharmacol. Exp. Ther. 312:366-372.[Abstract/Free Full Text]
  46. 24
  47. Itano, A. A., and M. K. Jenkins. 2003. Antigen presentation to naive CD4 T cells in the lymph node.Nat. Immunol. 4:733-739.[CrossRef][Medline]
  48. 25
  49. Jantsch, J., C. Cheminay, D. Chakravortty, T. Lindig, J. Hein, and M. Hensel. 2003. Intracellular activities of Salmonella enterica in murine dendritic cells. Cell Microbiol. 5:933-945.[CrossRef][Medline]
  50. 26
  51. Kalergis, A. M., and J. V. Ravetch. 2002. Inducing tumor immunity through the selective engagement of activating Fc{gamma} receptors on dendritic cells. J. Exp. Med. 195:1653-1659.[Abstract/Free Full Text]
  52. 27
  53. Lauvau, G., and N. Glaichenhaus. 2004. Mini-review: presentation of pathogen-derived antigens in vivo. Eur. J. Immunol. 34:913-920.[CrossRef][Medline]
  54. 28
  55. Lejona, S., A. Aguirre, M. L. Cabeza, E. Garcia Vescovi, and F. C. Soncini. 2003. Molecular characterization of the Mg2+-responsive PhoP-PhoQ regulon in Salmonella enterica. J. Bacteriol. 185:6287-6294.[Abstract/Free Full Text]
  56. 29
  57. Li, Y., Y. Ke, P. D. Gottlieb, and J. A. Kapp.1994 . Delivery of exogenous antigen into the major histocompatibility complex class I and class II pathways by electroporation. J. Leukoc. Biol. 56:616-624.[Abstract]
  58. 30
  59. Lockman, H. A., and R. Curtiss III. 1990. Salmonella typhimurium mutants lacking flagella or motility remain virulent in BALB/c mice. Infect. Immun. 58:137-143.[Abstract/Free Full Text]
  60. 31
  61. Lyons, S., L. Wang, J. E. Casanova, S. V. Sitaraman, D. Merlin, and A. T. Gewirtz. 2004. Salmonella typhimurium transcytoses flagellin via an SPI2-mediated vesicular transport pathway. J. Cell Sci. 117:5771-5780.[Abstract/Free Full Text]
  62. 32
  63. McClelland, M., K. E. Sanderson, J. Spieth, S. W. Clifton, P. Latreille, L. Courtney, S. Porwollik, J. Ali, M. Dante, F. Du, S. Hou, D. Layman, S. Leonard, C. Nguyen, K. Scott, A. Holmes, N. Grewal, E. Mulvaney, E. Ryan, H. Sun, L. Florea, W. Miller, T. Stoneking, M. Nhan, R. Waterston, and R. K. Wilson. 2001. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413:852-856.[CrossRef][Medline]
  64. 33
  65. McSorley, S. J., S. Asch, M. Costalonga, R. L. Reinhardt, and M. K. Jenkins. 2002. Tracking Salmonella-specific CD4 T cells in vivo reveals a local mucosal response to a disseminated infection. Immunity 16:365-377.[CrossRef][Medline]
  66. 34
  67. Mendel, I., and E. M. Shevach. 2006. Activated T cells express the OX40 ligand: requirements for induction and costimulatory function. Immunology 117:196-204.[CrossRef][Medline]
  68. 35
  69. Monack, D. M., D. Hersh, N. Ghori, D. Bouley, A. Zychlinsky, and S. Falkow. 2000. Salmonella exploits caspase-1 to colonize Peyer's patches in a murine typhoid model. J. Exp. Med. 192:249-258.[Abstract/Free Full Text]
  70. 36
  71. Niedergang, F., A. Didierlaurent, J. P. Kraehenbuhl, and J. C. Sirard. 2004. Dendritic cells: the host Achille's heel for mucosal pathogens? Trends Microbiol. 12:79-88.[CrossRef][Medline]
  72. 37
  73. Niedergang, F., J. C. Sirard, C. T. Blanc, and J. P. Kraehenbuhl. 2000. Entry and survival of Salmonella typhimurium in dendritic cells and presentation of recombinant antigens do not require macrophage-specific virulence factors. Proc. Natl. Acad. Sci. USA 97:14650-14655.[Abstract/Free Full Text]
  74. 38
  75. Ochman, H., F. C. Soncini, F. Solomon, and E. A. Groisman. 1996. Identification of a pathogenicity island required for Salmonella survival in host cells. Proc. Natl. Acad. Sci. USA 93:7800-7804.[Abstract/Free Full Text]
  76. 39
  77. Porgador, A., J. W. Yewdell, Y. Deng, J. R. Bennink, and R. N. Germain. 1997. Localization, quantitation, and in situ detection of specific peptide-MHC class I complexes using a monoclonal antibody. Immunity 6:715-726.[CrossRef][Medline]
  78. 40
  79. Robertson, J. M., P. E. Jensen, and B. D. Evavold. 2000. DO11.10 and OT-II T cells recognize a C-terminal ovalbumin 323-339 epitope. J. Immunol. 164:4706-4712.[Abstract/Free Full Text]
  80. 41
  81. Srinivasan, A., J. Foley, R. Ravindran, and S. J. McSorley.2004 . Low-dose Salmonella infection evades activation of flagellin-specific CD4 T cells. J. Immunol. 173:4091-4099.[Abstract/Free Full Text]
  82. 42
  83. Stagg, A. J., A. L. Hart, S. C. Knight, and M. A. Kamm. 2003. The dendritic cell: its role in intestinal inflammation and relationship with gut bacteria.Gut 52:1522-1529.[Abstract/Free Full Text]
  84. 43
  85. Steinman, R. M., D. Hawiger, and M. C. Nussenzweig.2003 . Tolerogenic dendritic cells. Annu. Rev. Immunol. 21:685-711.[CrossRef][Medline]
  86. 44
  87. Svensson, M., C. Johansson, and M. J. Wick. 2000. Salmonella enterica Serovar Typhimurium-induced maturation of bone marrow-derived dendritic cells. Infect. Immun. 68:6311-6320.[Abstract/Free Full Text]
  88. 45
  89. Svensson, M., B. Stockinger, and M. J. Wick. 1997. Bone marrow-derived dendritic cells can process bacteria for MHC-I and MHC-II presentation to T cells. J. Immunol. 158:4229-4236.[Abstract]
  90. 46
  91. Tau, G. Z., S. N. Cowan, J. Weisburg, N. S. Braunstein, and P. B. Rothman. 2001. Regulation of IFN-gamma signaling is essential for the cytotoxic activity of CD8+ T cells. J. Immunol. 167:5574-5582.[Abstract/Free Full Text]
  92. 47
  93. Tobar, J. A., P. A. Gonzalez, and A. M. Kalergis. 2004. Salmonella escape from antigen presentation can be overcome by targeting bacteria to Fc gamma receptors on dendritic cells. J. Immunol. 173:4058-4065.[Abstract/Free Full Text]
  94. 48
  95. Uchiya, K., M. A. Barbieri, K. Funato, A. H. Shah, P. D. Stahl, and E. A. Groisman.1999 . A Salmonella virulence protein that inhibits cellular trafficking. EMBO J. 18:3924-3933.[CrossRef][Medline]
  96. 49
  97. van der Velden, A. W., M. K. Copass, and M. N. Starnbach. 2005. Salmonella inhibit T cell proliferation by a direct, contact-dependent immunosuppressive effect.Proc. Natl. Acad. Sci. USA 102:17769-17774.[Abstract/Free Full Text]
  98. 50
  99. van der Velden, A. W. M., M. Velasquez, and M. N. Starnbach. 2003. Salmonella rapidly kill dendritic cells via a caspase-1- dependent mechanism.J. Immunol. 171:6742-6749.[Abstract/Free Full Text]
  100. 51
  101. Waterman, S. R., and D. W. Holden. 2003. Functions and effectors of the Salmonella pathogenicity island 2 type III secretion system. Cell Microbiol. 5:501-511.[CrossRef][Medline]
  102. 52
  103. Wick, M. J. 2003. The role of dendritic cells in the immune response to Salmonella. Immunol. Lett. 85:99-102.[CrossRef][Medline]
  104. 53
  105. Yrlid, U., M. Svensson, A. Kirby, and M. J. Wick.2001 . Antigen-presenting cells and anti-Salmonella immunity. Microbes Infect. 3:1239-1248.[CrossRef][Medline]
  106. 54
  107. Yu, X. J., J. Ruiz-Albert, K. E. Unsworth, S. Garvis, M. Liu, and D. W. Holden. 2002. SpiC is required for secretion of Salmonella pathogenicity island 2 type III secretion system proteins. Cell Microbiol. 4:531-540.[CrossRef][Medline]


Infection and Immunity, November 2006, p. 6438-6448, Vol. 74, No. 11
0019-9567/06/$08.00+0     doi:10.1128/IAI.00063-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Elgueta, R., Tobar, J. A., Shoji, K. F., De Calisto, J., Kalergis, A. M., Bono, M. R., Rosemblatt, M., Saez, J. C. (2009). Gap Junctions at the Dendritic Cell-T Cell Interface Are Key Elements for Antigen-Dependent T Cell Activation. J. Immunol. 183: 277-284 [Abstract] [Full Text]  
  • Sundquist, M., Wick, M. J. (2009). Salmonella induces death of CD8{alpha}+ dendritic cells but not CD11cintCD11b+ inflammatory cells in vivo via MyD88 and TNFR1. J. Leukoc. Biol. 85: 225-234 [Abstract] [Full Text]  
  • Ramirez, K., Capozzo, A. V. E., Lloyd, S. A., Sztein, M. B., Nataro, J. P., Pasetti, M. F. (2009). Mucosally Delivered Salmonella Typhi Expressing the Yersinia pestis F1 Antigen Elicits Mucosal and Systemic Immunity Early in Life and Primes the Neonatal Immune System for a Vigorous Anamnestic Response to Parenteral F1 Boost. J. Immunol. 182: 1211-1222 [Abstract] [Full Text]  
  • Halici, S., Zenk, S. F., Jantsch, J., Hensel, M. (2008). Functional Analysis of the Salmonella Pathogenicity Island 2-Mediated Inhibition of Antigen Presentation in Dendritic Cells. Infect. Immun. 76: 4924-4933 [Abstract] [Full Text]  
  • Gonzalez, P. A., Prado, C. E., Leiva, E. D., Carreno, L. J., Bueno, S. M., Riedel, C. A., Kalergis, A. M. (2008). Respiratory syncytial virus impairs T cell activation by preventing synapse assembly with dendritic cells. Proc. Natl. Acad. Sci. USA 105: 14999-15004 [Abstract] [Full Text]  
  • Mittal, R., Prasadarao, N. V. (2008). Outer Membrane Protein A Expression in Escherichia coli K1 Is Required to Prevent the Maturation of Myeloid Dendritic Cells and the Induction of IL-10 and TGF-{beta}. J. Immunol. 181: 2672-2682 [Abstract] [Full Text]  
  • Chan, S. S. M., Mastroeni, P., McConnell, I., Blacklaws, B. A. (2008). Salmonella infection of afferent lymph dendritic cells. J. Leukoc. Biol. 83: 272-279 [Abstract] [Full Text]  
  • Alaniz, R. C., Deatherage, B. L., Lara, J. C., Cookson, B. T. (2007). Membrane Vesicles Are Immunogenic Facsimiles of Salmonella typhimurium That Potently Activate Dendritic Cells, Prime B and T Cell Responses, and Stimulate Protective Immunity In Vivo. J. Immunol. 179: 7692-7701 [Abstract] [Full Text]  
  • Herrada, A. A., Contreras, F. J., Tobar, J. A., Pacheco, R., Kalergis, A. M. (2007). Immune complex-induced enhancement of bacterial antigen presentation requires Fc{gamma} Receptor III expression on dendritic cells. Proc. Natl. Acad. Sci. USA 104: 13402-13407 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tobar, J. A.
Right arrow Articles by Kalergis, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tobar, J. A.
Right arrow Articles by Kalergis, A. M.