This Article Abstract Full Text (PDF) An author's correction has been published Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Newton, D. J. Articles by Carding, S. R. Search for Related Content PubMed PubMed Citation Articles by Newton, D. J. Articles by Carding, S. R.

 Previous Article  |  Next Article 

Infection and Immunity, February 2006, p. 1097-1105, Vol. 74, No. 2
0019-9567/06/$08.00+0     doi:10.1128/IAI.74.2.1097-1105.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Identification of Novel T-Cell Subsets following Bacterial Infection in the Absence of V1⁺ T Cells: Homeostatic Control of T-Cell Responses to Pathogen Infection by V1⁺ T Cells

Darren J. Newton, Elizabeth M. Andrew, Jane E. Dalton, Rainy Mears, and Simon R. Carding^*

Research Institute of Molecular and Cellular Biology, University of Leeds, Leeds, United Kingdom

Received 19 August 2005/ Returned for modification 13 October 2005/ Accepted 18 November 2005

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion References

 
Although T cells are a common feature of many pathogen-induced immune responses, the factors that influence, promote, or regulate the response of individual T-cell subsets to infection is unknown. Here we show that in the absence of V1⁺ T cells, novel subsets of T cells, expressing T-cell receptor (TCR)-V chains that normally define TCR⁺ dendritic epidermal T cells (DETCs) (V5⁺), intestinal intraepithelial lymphocytes (iIELs) (V7⁺), and lymphocytes associated with the vaginal epithelia (V6⁺), are recruited to the spleen in response to bacterial infection in TCR-V1^–/– mice. By comparison of phenotype and structure of TCR-V chains and/or -V chains expressed by these novel subsets with those of their epithelium-associated counterparts, the V6⁺ T cells elicited in infected V1^–/– mice were shown to be identical to those found in the reproductive tract, from where they are presumably recruited in the absence of V1⁺ T cells. By contrast, V5⁺ and V7⁺ T cells found in infected V1^–/– mice were distinct from V5⁺ DETCs and V7⁺ iIELs. Functional analyses of the novel T-cell subsets identified for infected V1^–/– mice showed that whereas the V5⁺ and V7⁺ subsets may compensate for the absence of V1⁺ T cells by producing similar cytokines, they do not possess cytocidal activity and they cannot replace the macrophage homeostasis function of V1⁺ T cells. Collectively, these findings identify novel subsets of T cells, the recruitment and activity of which is under the control of V1⁺ T cells.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

 
The two lineages of T lymphocytes, ß and , are distinguished by their T-cell receptor (TCR) expression and have nonoverlapping but complementary roles in immune responses. Whereas ß T cells respond to peptide antigens presented in the context of major histocompatibility complex class I and II molecules and are pivotal in the sterile elimination and generation of long-lived immunity to pathogens, the nature of antigen recognition by T cells and their biological function is uncertain (reviewed in reference 8). T cells appear to have both proinflammatory and regulatory functions: they can act as a bridge between innate and adaptive immunity early in responses and can down-modulate inflammatory responses once the infection is cleared (reviewed in references 1 and 8). T cells are found in a number of different anatomical sites, with localization often associated with the expression of distinct TCR-V chains. Of the commonly expressed V chains, V7⁺ (TCR-V nomeclature used is that of Heilig and Tonegawa [16]) T cells are resident within the intestinal epithelium (35) and contain a high proportion of extrathymically generated cells (5, 29). V5⁺ and V6⁺ T cells are found in the skin and reproductive mucosa, respectively (3, 22), and are among the first T cells to be generated in the fetal thymus (15, 21, 23). Fetal thymic-derived T cells coexpress identical V1 chains and differ from later thymic emigrants in that they express invariant TCRs composed of canonical V5J1C1 or V6J1C1 and V1D2J2C TCRs with no junctional (N-region) diversity (3, 26). V1⁺ and V4⁺ T cells, which are produced later in the thymus, around birth (23, 41), are found primarily in the peripheral lymphoid tissues and the lung, respectively, and are prominent among T cells responding to microbial infection (reviewed in reference 8).

The requirement for T cells in the response to microbial pathogens has been shown by a number of studies of TCR-deficient mice, where exacerbated pathology, due to both increased susceptibility and exaggerated inflammatory responses, occurs during infection with viruses (40, 43, 44), bacteria (11, 14, 30), and parasites (31, 38, 39). The murine model of listeriosis has been extensively used to study the role of T cells in pathogen-induced immune responses (8). The T-cell response to Listeria monocytogenes occurs in two temporally distinct phases (17, 33). Prior to the induction of the adaptive ß T-cell response (2 days postinfection), responding T cells are predominantly proinflammatory, characterized by gamma interferon production (1, 13, 18). Later during infection, coincident with bacterial clearance (6), T cells are required to down-modulate the inflammatory response and eliminate activated macrophages (9, 12, 19). In C57BL/6 mice, both the early- and late-responding T cells are dominated by the V1⁺ T-cell subset.

Listeria infection of TCR-V1-deficient (V1^–/–) mice results in the accumulation of activated macrophages in sites of bacterial infection, consistent with the nonredundant role of V1⁺ T cells in macrophage homeostasis (2). An unexpected observation with Listeria-infected V1^–/– mice was the accumulation in the spleen late in infection of T cells expressing V chains normally associated with epithelium-associated T cells found in the skin (V5⁺), small intestine (V7⁺), and reproductive tract (V6⁺). In this study, we have examined these unusual populations of cells in more detail, characterizing their phenotype and origins and determining their potential functional significance.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mice and infection. Male and female mice were used at 6 to 8 weeks of age, with three to six mice per group. C57BL/6 TCR-V1^–/– mice were generated as described previously (2) and backcrossed onto a C57BL/6 background for at least six generations, C57BL/6 TCR^–/– mice were obtained from the Jackson Laboratory (Bar Harbor, ME), wild-type (WT) C57BL/6 mice were obtained from Harlan (Bicester, United Kingdom), and all were housed in the animal facility at the University of Leeds. Mice were infected intraperitoneally with 1.5 x 10⁴ bacterial CFU Listeria monocytogenes (strain 10403S).

Cell preparation. Standard protocols were used to isolate lymphocytes from the spleen, thymus, and liver (25). Tissues were homogenized, contaminating erythrocytes were lysed with 0.84% (wt/vol) ammonium chloride solution, and the cell suspension was washed and passed through a 0.7-µm nylon filter before use. For intestinal intraepithelial lymphocyte (iIELs) isolation, whole small intestines were flushed through with phosphate-buffered saline, and the mesentery and Peyer's patches were removed, opened longitudinally, and cut into 1- to 2-cm fragments. The intestinal fragments were then incubated with dithioerythritol-EDTA solution (0.3 mg/ml dithioerythritol, 5 mM EDTA, 10% fetal bovine serum in Hanks balanced salt solution [HBSS]) at 37°C for 30 min to remove the epithelial layer. Cells were then pelleted at 500 x g for 5 min at 20°C, resuspended in 5 ml 80% Percoll (Amersham Biosciences), overlaid with 9 ml 40% Percoll, and centrifuged at 800 x g for 20 min at 20°C. iIELs were isolated from the 40/80 interface and washed in HBSS-10% fetal calf serum. Peritoneal exudate cells (PECs) were collected by peritoneal lavage with HBSS containing 10 U/ml heparin.

RT-PCR. Cells (10⁷) were pelleted and RNA extracted using Tri-reagent (Sigma, Poole, United Kingdom) following the manufacturer's instructions. The resultant RNA was subjected to reverse transcription-PCR (RT-PCR) using ImpromII reverse transcriptase (Promega, Southampton, United Kingdom) and the cDNA amplified with Reddy-mix Taq polymerase (Abgene, Epsom, United Kingdom), using primers for TCR V chains as described previously (2). Products were run out on 2% agarose gels and visualized with ethidium bromide.

Spectratyping and DNA sequencing. PCR products (1 µl) were used as templates in a 10-cycle runoff reaction using Reddy-mix polymerase with a 6-carboxyfluorescein-labeled J-region-specific primer (for J1, CTTAGTTCCTTCTGCAAATACC; for J2, ATGAGCTTTGTTCCTTCTGC; or for J4, TACGAGCTTTGTCCCTTTG). Products were electrophoretically separated (Lark Technologies, Inc., Takeley, United Kingdom) and analyzed using Genescanview4 software (CRIBI, Padua, Italy). For sequencing, PCR-amplified TCR-V products were excised from agarose gel slices following electrophoresis by use of a Genelute gel purification kit (Sigma, Poole, United Kingdom) and ligated into the T-cloning vector pGEM-T Easy (Promega, Southampton, United Kingdom). DNA, prepared using a Genelute miniprep kit (Sigma, Poole, United Kingdom), was then sequenced using universal cloning vector primers (Lark Technologies, Inc., Takeley, United Kingdom).

Flow cytometry. Antibodies for surface staining were F(ab)₂ fragments of antibodies specific for TCR (clone GL3), intact antibody specific for TCR-V7 (clone F2.67 provided by Pablo Pereira [Institut Pasteur, Paris, France]), the anti-V5/V1 clonotype antibody 17D1 (provided by Adrian Hayday, Kings College, London, United Kingdom), and commercial preparations of anti-TCR (GL3), -CD3 (145-2C11), -TCR-V2 (V4; UC3-10A6), -TCR-V3 (V5; 536), -F4/80, -CD8 (CT-CD8a), -CD103 (M290), -NKG2D (CX5), -Fas (Jo2), and -FasL (MFL3), obtained from Caltag-Medsystems (Towcester, United Kingdom) or PharMingen (Oxford, United Kingdom). Streptavidin conjugates of phycoerythrin, fluorescein isothiocyanate (FITC) (Caltag), or Alexa Fluor 633 (Molecular Probes, Eugene, OR) were used as secondary reagents. To block nonspecific antibody binding, cells were preincubated with an anti-Fc-receptor antibody cocktail (anti-CD16/32; Caltag). Isotype-matched antibodies of irrelevant specificity were used to determine the level of nonspecific staining. Stained cells were analyzed with a FACSCalibur flow cytometer by use of Cellquest software (Becton Dickinson, Oxford, United Kingdom).

Mononuclear cell killing assay. Peritoneal exudate-derived macrophages or splenocytes (5 x 10⁵) from day 8 L. monocytogenes-infected TCR^–/– mice were incubated on 8-well chamber slides (ICN Pharmaceuticals, Ltd., Basingstoke, United Kingdom) with Live/Dead cell reagent (Molecular Probes) containing fluorescent dyes that identify intracellular esterase activity of viable cells (calcein AM) or are incorporated in the nuclei of dead cells (ethidium bromide homodimer 1), as previously described (9). Splenocytes (1 x 10⁶) from day 8 L. monocytogenes-infected TCR-V1^–/– or wild-type mice were added and cultures were incubated at 37°C in RPMI (Sigma-Aldrich) with 10% fetal bovine serum for 1 h. Viable and dead cells were visualized and quantitated under UV illumination by using a Zeiss Axiovert 200 M microscope (Welwyn Garden City, Herts, United Kingdom) and Axiovison image analysis software (Imaging Associates, Ltd., Bicester, United Kingdom), counting at least 100 cells in four separate fields of view.

Intracellular-cytokine analysis. Intracellular cytokines were detected by cytoplasmic staining of cells cultured in the presence of brefeldin A (10 µg/ml) (Sigma). The cells were stained for surface markers, fixed in 1% paraformaldehyde, and permeabilized with 0.5% of saponin (Sigma) before being stained with phycoerythrin-conjugated anti-mouse cytokine monoclonal antibodies to interleukin 2 (IL-2), IL-4, IL-5, IL-6, IL-10, gamma interferon, and tumor necrosis factor alpha, from Caltag-Medsystems (Towcester, United Kingdom) or PharMingen (Oxford, United Kingdom), or FITC-conjugated polyclonal antibodies to monocyte chemoattractant protein 1 (Sigma). FITC (Sigma-Aldrich, Dorset, United Kingdom) was conjugated to the antibodies by standard procedures.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Novel T-cell subsets accumulate in spleens of V1^–/– mice following Listeria infection. We have previously shown that the recruitment of T-cell subsets to the spleen during Listeria infection is regulated by V1⁺ T cells and that, in the absence of these cells, subsets which are epithelium associated and thought to be resident only in the skin (V5), reproductive tract (V6), and intestine (V7) appear in the spleen in the late stage of infection (2). This unusual finding raised the questions of whether these cells had been recruited from their epithelial sites, what their functional significance might be in the spleen at a time when the infection was being cleared, and when in wild-type mice the inflammatory response would be downmodulated by V1⁺ T cells (2, 9, 12). After verifying the expression of V chain mRNA (Fig. 1A) and the presence of T cells which stained antibody positive for these subsets (Fig. 1B) in the spleen 8 days after Listeria infection, the phenotypic and functional characteristics of splenic V subsets and the spectratypes of PCR-derived TCR-V transcripts were compared with those from epithelial sites to identify similarities or differences that might shed light on their origins and function.

View larger version (25K): [in this window] [in a new window]   FIG. 1. Appearance of unusual subsets of T cells elicited by microbial infection in the absence of V1+ T cells. (A) Profile of TCR-V chain expression in the spleens of wild-type (C57BL/6) and TCR-V1–/– mice 8 days after infection with Listeria, as determined by RT-PCR analysis. The results shown are representative of those obtained from more than 10 mice of each strain. (B) Representative flow cytometric staining profiles of T cells expressing V4, V5, or V7 receptors among spleen cells recovered from TCR-V1–/– mice 8 days after Listeria infection (n = 10). Percentages of cells positive for each marker are shown on the dot plots.

Pathogen-elicited T cells in V1^–/– mice express distinct TCRs.

View larger version (26K): [in this window] [in a new window]   FIG. 2. Structural analysis of CDR3 region of TCR-V chains expressed by Listeria-elicited T cells in wild-type and V1–/– mice. (A) TCR CDR3 spectraype analysis of V2 and V4 transcripts expressed in the spleens of WT and V1–/– mice prior to (d0) and 8 days after (d8) Listeria infection. (B) Collated profiles of two or more mice of each strain.

View larger version (30K): [in this window] [in a new window]   FIG. 3. Structural analysis of epithelium-associated TCR-V chains expressed by splenic T cells in infected V1–/– mice. TCR CDR3 spectratypes were generated from V5 (top), V6 (middle), and V7 (bottom) transcripts expressed in the spleens of V1–/– mice infected 8 days previously with Listeria. Representative profiles obtained from cDNA samples of a single mouse are shown in the plots on the right side of the figure, and the cumulative profiles of more than three mice are shown in the bar graphs on the left side of the figure. The spectratypes of V7 transcripts expressed in the spleens of day 8 (d8) infected V1–/– mice are compared to those of iIELs from noninfected WT and V1–/– mice.

View this table: [in this window] [in a new window]   TABLE 1. Sequence analysis of V5 and V6 clonesa

V5⁺ and V7⁺ T cells do not conform to DETC or IEL phenotypes.

View larger version (31K): [in this window] [in a new window]   FIG. 4. Phenotype of Listeria-elicited T-cell subsets in V1–/– mice. (A and B) Splenocytes and iIELs from V1–/– mice 8 days after Listeria infection and iIELs from WT mice were analyzed by flow cytometry for expression of cell surface antigens CD8, CD103, FasL, Fas, and NKG2D. The dot plots in panel A are examples of individual staining profiles for positive populations showing percentages of double-positive cells from day 8 V1–/– infected spleen (left) and day 0 WT IEL (right), and the bar graph in panel B summarizes the data obtained from the analysis of iIELs and splenocytes of eight mice. (C) Distribution (left) and phenotype (right) of V5+ T cells in the spleens of V1–/– mice 8 days postinfection with Listeria. The data show the mean values obtained from more than eight mice. (D) Distribution of different T-cell subsets in the thymuses of adult V1–/– mice 8 days after Listeria infection, as determined by flow cytometric analysis of more than five mice.

The possibility that the Listeria-elicited V5⁺ and V7⁺ T cells in V1^–/– mice were thymically derived was investigated by attempting to demonstrate their presence in the thymuses of V1^–/– mice. The thymuses of adult wild-type and V1^–/– mice contained a small population of V7⁺ cells but very few if any V5⁺ cells (Fig. 4D). This raises the possibility that the source of the unusual V7⁺ T cells present in the spleens of infected V1^–/– mice may be the thymus.

Pathogen-elicited subsets in V1^–/– mice produce anti-inflammatory cytokines but play no role in macrophage homeostasis. During the late stage of Listeria infection, V1⁺ cells are a major source of T-cell-derived cytokines (IL-10, IL-6, and IL-2) (2) and via a Fas-FasL mechanism eliminate pathogen-elicited macrophages (10). We therefore determined whether the V5⁺, V6⁺, V7⁺, and V4⁺ T cells recruited to sites of infection in the absence of V1⁺ T cells in V1^–/– mice could compensate for or replace V1⁺ T-cell function. The only cytokines synthesized by V4, V5, or V7 subsets during the late stage of the infection in V1^–/– mice were IL-10, IL-2, and IL-6 (summarized in Fig. 5B, with representative plots shown in Fig. 5A), which is similar to the profile of cytokines produced by V1⁺ T cells in response to Listeria infection (2). Among V4⁺ T cells, IL-10 was the most prominent cytokine synthesized, with approximately 20% of cells being positive and with a smaller proportion (10%) synthesizing IL-6. This pattern of expression was similar to that of V5⁺ cells, though a small number of V5⁺ cells also produced tumor necrosis factor alpha. Together, these two subsets of T cells might compensate for the absence of anti-inflammatory V1⁺ cells that display a similar profile of cytokine production late during the course of Listeria infection in wild-type mice (2). Of note was the finding that V7⁺ T cells do not appear to produce any of the cytokines analyzed (Fig. 5A), and they did not express either Fas or FasL (Fig. 4B).

View larger version (24K): [in this window] [in a new window]   FIG. 5. Functional properties of T cells responding to Listeria infection in V1–/– mice. Cytokine synthesis by V4+, V5+, and V7+ T cells elicited in response to Listeria infection was determined by staining splenocytes with TCR-, CD3-, and TCR-V-specific antibodies in conjunction with anticytokine antibodies and flow cytometric analysis as described in Materials and Methods. Representative dot plots are shown (A), with percentages of V4 T cells positive for each marker indicated, and results for V4, V5, and V7 subsets were compiled from three independent experiments (B). The ability of splenocytes from Listeria-infected V1–/– mice (TCR-V1–/– infected) enriched for V4+, V5+, V6+, and V7+ T cells to kill target peritoneal macrophage obtained from day 8 Listeria-infected TCR–/– mice was determined using a fluorescent-based cytotoxicity assay as described in Materials and Methods (C). As controls, target PECs were cultured alone (M alone), and splenocytes from noninfected wild-type (C57BL/6), V1–/–, or TCR–/– mice were used as additional sources of effector cells. IFN, gamma interferon; TNF, tumor necrosis factor alpha; MCP-1, monocyte chemoattractant protein 1; No., number.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

 
Although T cells are a common feature of many pathogen-induced immune responses, the factors that influence, promote, or regulate the response of individual populations of T cells to infection is largely unknown. In addition to providing more evidence of the immunoregulatory properties of the V1⁺ T-cell population of T cells, the study described here provides evidence for their involvement in regulating the response of other, novel T-cell populations to microbial infection. While the absence of V1⁺ T cells has little impact on T-cell repertoires in primary lymphoid tissues of naïve, noninfected, adult mice, their absence has a profound effect on T cells during the course of infection. This is characterized by the appearance of T cells expressing V-encoded TCRs normally found among epithelium-associated T cells (V5, V6, and V7), although detailed structural analyses of their V chains have shown that most of them are unique and distinct from epithelium-associated T cells.

The expression of V5-encoded TCRs has been reported only for the neonatal thymuses and skin of adult mice (34). DETC V5 transcripts are invariant and are generated only in the fetal thymus, from which they migrate early as a single wave to populate the epidermis (15). The majority of V5 CDR3 sequences expressed in the spleens of infected V1^–/– mice are by comparison noncanonical and display a degree of N-region diversity, which would suggest they are generated later. These cells can be further distinguished from DETCs by the absence of expression of the DETC-associated integrin CD103, required for epithelial localization (28), their lack of reactivity with a DETC V5/V1 TCR anticlonotype-specific antibody (17D1), and low to moderate levels of expression of the killing receptor NKG2D, which is generally expressed by the majority of tissue-associated cells (24). The inability to detect any V5⁺ T cells in thymuses of 6- to 8-week-old V1^–/– mice that express noncanonical sequences suggests that these cells either are of extrathymic origin or represent a population of V5⁺ cells which leaves the thymus at other times during thymic development and after DETC progenitors have left to occupy an as-yet-unidentified tissue.

V6 cells expressing an invariant -chain are usually associated with the epithelia of the reproductive tract and tongue (22). They have also been identified at sites of inflammation, among V6⁺ hybridomas generated from Listeria-evoked and autoimmune orchiditis (32), and from the livers and kidneys of Listeria-infected wild-type mice (20, 37). Structural analyses of Listeria-elicited V6⁺ T cells in V1^–/– mice revealed that these cells express a single, fetal-type, invariant V6 chain, consistent with them being related to and perhaps being mobilized from the tissues in which cells bearing these TCRs normally reside. The absence of a specific monoclonal antibody for this receptor restricted any further phenotypic characterization and analysis of the potential functional significance of these cells.

V7⁺ T cells form the major component of the iIELs compartment in the small intestine and have been shown to express high levels of the CD8 homodimer (27). As shown by the expression of NKG2D and the absence of CD8 expression, V7⁺ cells found in the spleens of day 8 Listeria-infected V1^–/– mice are distinct from V7⁺ iIELs, which show similar expression patterns with both WT and V1^–/– mice. The possibility remains, however, that the cells found in spleens of infected V1^–/– mice are related to the CD8^– fraction of the gut-associated iIELs. Whatever their relationship to V7⁺ iIELs, their presence in the thymus suggests they may be thymic in origin.

The functional properties of these unusual populations of T cells in the spleens of V1^–/– mice are unclear, although these cells do appear to be distinct from the known effector functions of epithelium-associated T cells that express the same V chains. Their cytokine profile is different from that of iIELs or DETCs, and they do not appear to be cytotoxic, which is a characteristic feature of both DETCs and iIELs. This does not, however, exclude the possibility that these unusual V5⁺ and V7⁺ T cells produce cytokines other than those assayed for here and/or possess cytotoxic activity that is directed at target cells other than peritoneal macrophages. The mechanism by which these unusual T-cell populations are recruited to the spleens of V1^–/– mice during the late phase of infection with Listeria is also not known. Since these mice can resolve bacterial infection in the absence of any tissue pathology and liver necrosis (2), the alteration in T-cell homeostasis seen with these animals may be a result of the failure of V1^–/– mice to eliminate activated macrophages which can elicit (e.g., via specific chemokines) the recruitment of T cells. Alternatively, it may be a direct consequence of the absence of V1⁺ T cells, which would normally restrict or prevent the mobilization of other T-cell populations to the spleen. The recent description of T-cell homeostasis being controlled in part by T-cell-specific factors (4) is consistent with this interpretation. In characterizing the aberrant recruitment of subtypes following Listeria infection, we have shown a central, nonredundant role for V1 cells in T-cell recruitment, although the mechanism by which this is achieved requires further study.

	FOOTNOTES

 
* Corresponding author. Mailing address: Research Institute of Cellular and Molecular Biology, University of Leeds, Leeds, LS2 9JT, United Kingdom. Phone: 44 113 3431404. Fax: 44 113 3431421. E-mail: s.r.carding{at}leeds.ac.uk.

Editor: J. D. Clements

Authors contributed equally to this study.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion References

 

1.	Andrew, E. M., and S. R. Carding. 2005. Murine gammadelta T cells in infections: beneficial or deleterious? Microbes Infect. 7:529-536.[CrossRef][Medline]
2.	Andrew, E. M., D. J. Newton, J. E. Dalton, C. E. Egan, S. J. Goodwin, D. Tramonti, P. Scott, and S. R. Carding. 2005. Delineation of the function of a major gamma delta T cell subset during infection. J. Immunol. 175:1741-1750.[Abstract/Free Full Text]
3.	Asarnow, D. M., W. A. Kuziel, M. Bonyhadi, R. E. Tigelaar, P. W. Tucker, and J. P. Allison. 1988. Limited diversity of gamma delta antigen receptor genes of Thy-1+ dendritic epidermal cells. Cell 55:837-847.[CrossRef][Medline]
4.	Baccala, R., D. Witherden, R. Gonzalez-Quintial, W. Dummer, C. D. Surh, W. L. Havran, and A. N. Theofilopoulos. 2005. Gamma delta T cell homeostasis is controlled by IL-7 and IL-15 together with subset-specific factors. J. Immunol. 174:4606-4612.[Abstract/Free Full Text]
5.	Bandeira, A., S. Itohara, M. Bonneville, O. Burlen-Defranoux, T. Mota-Santos, A. Coutinho, and S. Tonegawa. 1991. Extrathymic origin of intestinal intraepithelial lymphocytes bearing T-cell antigen receptor gamma delta. Proc. Natl. Acad. Sci. USA 88:43-47.[Abstract/Free Full Text]
6.	Belles, C., A. K. Kuhl, A. J. Donoghue, Y. Sano, R. L. O'Brien, W. Born, K. Bottomly, and S. R. Carding. 1996. Bias in the gamma delta T cell response to Listeria monocytogenes. V delta 6.3+ cells are a major component of the gamma delta T cell response to Listeria monocytogenes. J. Immunol. 156:4280-4289.[Abstract]
7.	Carding, S. R., and P. J. Egan. 2000. The importance of gamma delta T cells in the resolution of pathogen-induced inflammatory immune responses. Immunol. Rev. 173:98-108.[CrossRef][Medline]
8.	Carding, S. R., and P. J. Egan. 2002. Gammadelta T cells: functional plasticity and heterogeneity. Nat. Rev. Immunol. 2:336-345.[CrossRef][Medline]
9.	Dalton, J. E., J. Pearson, P. Scott, and S. R. Carding. 2003. The interaction of gamma delta T cells with activated macrophages is a property of the V gamma 1 subset. J. Immunol. 171:6488-6494.[Abstract/Free Full Text]
10.	Dalton, J. E., G. Howell, J. Pearson, P. Scott, and S. R. Carding. 2004. Fas-Fas ligand interactions are essential for the binding to and killing of activated macrophages by gamma delta T cells. J. Immunol. 173:3660-3667.[Abstract/Free Full Text]
11.	D'Souza, C. D., A. M. Cooper, A. A. Frank, R. J. Mazzaccaro, B. R. Bloom, and I. M. Orme. 1997. An anti-inflammatory role for gamma delta T lymphocytes in acquired immunity to Mycobacterium tuberculosis. J. Immunol. 158:1217-1221.[Abstract]
12.	Egan, P. J., and S. R. Carding. 2000. Downmodulation of the inflammatory response to bacterial infection by gammadelta T cells cytotoxic for activated macrophages. J. Exp. Med. 191:2145-2158.[Abstract/Free Full Text]
13.	Ferrick, D. A., M. D. Schrenzel, T. Mulvania, B. Hsieh, W. G. Ferlin, and H. Lepper. 1995. Differential production of interferon-gamma and interleukin-4 in response to Th1- and Th2-stimulating pathogens by gamma delta T cells in vivo. Nature 373:255-257.[CrossRef][Medline]
14.	Fu, Y. X., C. E. Roark, K. Kelly, D. Drevets, P. Campbell, R. O'Brien, and W. Born. 1994. Immune protection and control of inflammatory tissue necrosis by gamma delta T cells. J. Immunol. 153:3101-3115.[Abstract]
15.	Havran, W. L., and J. P. Allison. 1988. Developmentally ordered appearance of thymocytes expressing different T-cell antigen receptors. Nature 335:443-445.[CrossRef][Medline]
16.	Heilig, J. S., and S. Tonegawa. 1986. Diversity of murine gamma genes and expression in fetal and adult T lymphocytes. Nature 322:836-840.[CrossRef][Medline]
17.	Hiromatsu, K., G. Matsuzaki, Y. Tauchi, Y. Yoshikai, and K. Nomoto. 1992. Sequential analysis of T cells in the liver during murine listerial infection. J. Immunol. 149:568-573.[Abstract]
18.	Hiromatsu, K., Y. Yoshikai, G. Matsuzaki, S. Ohga, K. Muramori, K. Matsumoto, J. A. Bluestone, and K. Nomoto. 1992. A protective role of gamma/delta T cells in primary infection with Listeria monocytogenes in mice. J. Exp. Med. 175:49-56.[Abstract/Free Full Text]
19.	Hsieh, B., M. D. Schrenzel, T. Mulvania, H. D. Lepper, L. Molfetto-Landon, and D. A. Ferrick. 1996. In vivo cytokine production in murine listeriosis. Evidence for immunoregulation by gamma delta+ T cells. J. Immunol. 156:232-237.[Abstract]
20.	Ikebe, H., H. Yamada, M. Nomoto, H. Takimoto, T. Nakamura, K. H. Sonoda, and K. Nomoto. 2001. Persistent infection with Listeria monocytogenes in the kidney induces anti-inflammatory invariant fetal-type gammadelta T cells. Immunology 102:94-102.[CrossRef][Medline]
21.	Ito, K., M. Bonneville, Y. Takagaki, N. Nakanishi, O. Kanagawa, E. G. Krecko, and S. Tonegawa. 1989. Different gamma delta T-cell receptors are expressed on thymocytes at different stages of development. Proc. Natl. Acad. Sci. USA 86:631-635.[Abstract/Free Full Text]
22.	Itohara, S., A. G. Farr, J. J. Lafaille, M. Bonneville, Y. Takagaki, W. Haas, and S. Tonegawa. 1990. Homing of a gamma delta thymocyte subset with homogeneous T-cell receptors to mucosal epithelia. Nature 343:754-757.[CrossRef][Medline]
23.	Itohara, S., N. Nakanishi, O. Kanagawa, R. Kubo, and S. Tonegawa. 1989. Monoclonal antibodies specific to native murine T-cell receptor gamma delta: analysis of gamma delta T cells during thymic ontogeny and in peripheral lymphoid organs. Proc. Natl. Acad. Sci. USA 86:5094-5098.[Abstract/Free Full Text]
24.	Jamieson, A. M., A. Diefenbach, C. W. McMahon, N. Xiong, J. R. Carlyle, and D. H. Raulet. 2002. The role of the NKG2D immunoreceptor in immune cell activation and natural killing. Immunity 17:19-29.[CrossRef][Medline]
25.	Kruisbeek, A. M. 2000. Isolation and fractionation of mononuclear cell populations, p. 311-315. In J. E. Coligan, A. M. Kruisbeek, D. H. Marguiles, E. M. Shevach, and W. Strober (ed.), Current protocols in immunology. John Wiley & Sons, Inc., New York, N.Y.
26.	Lafaille, J. J., A. DeCloux, M. Bonneville, Y. Takagaki, and S. Tonegawa. 1989. Junctional sequences of T cell receptor gamma delta genes: implications for gamma delta T cell lineages and for a novel intermediate of V-(D)-J joining. Cell 59:859-870.[CrossRef][Medline]
27.	LeFrancois, L. 1991. Intraepithelial lymphocytes of the intestinal mucosa: curiouser and curiouser. Semin. Immunol. 3:99-108.[Medline]
28.	LeFrancois, L., T. A. Barrett, W. L. Havran, and L. Puddington. 1994. Developmental expression of the alpha IEL beta 7 integrin on T cell receptor gamma delta and T cell receptor alpha beta T cells. Eur. J. Immunol. 24:635-640.[Medline]
29.	LeFrancois, L., R. LeCorre, J. Mayo, J. A. Bluestone, and T. Goodman. 1990. Extrathymic selection of TCR gamma delta + T cells by class II major histocompatibility complex molecules. Cell 63:333-340.[CrossRef][Medline]
30.	Mombaerts, P., J. Arnoldi, F. Russ, S. Tonegawa, and S. H. Kaufmann. 1993. Different roles of alpha beta and gamma delta T cells in immunity against an intracellular bacterial pathogen. Nature 365:53-56.[CrossRef][Medline]
31.	Moretto, M., B. Durell, J. D. Schwartzman, and I. A. Khan. 2001. Gamma delta T cell-deficient mice have a down-regulated CD8+ T cell immune response against Encephalitozoon cuniculi infection. J. Immunol. 166:7389-7397.[Abstract/Free Full Text]
32.	Mukasa, A., M. Lahn, E. K. Pflum, W. Born, and R. L. O'Brien. 1997. Evidence that the same gamma delta T cells respond during infection-induced and autoimmune inflammation. J. Immunol. 159:5787-5794.[Abstract]
33.	Ohga, S., Y. Yoshikai, Y. Takeda, K. Hiromatsu, and K. Nomoto. 1990. Sequential appearance of gamma/delta- and alpha/beta-bearing T cells in the peritoneal cavity during an i.p. infection with Listeria monocytogenes. Eur. J. Immunol. 20:533-538.[Medline]
34.	Payer, E., A. Elbe, and G. Stingl. 1991. Circulating CD3+/T cell receptor V gamma 3+ fetal murine thymocytes home to the skin and give rise to proliferating dendritic epidermal T cells. J. Immunol. 146:2536-2543.[Abstract]
35.	Pereira, P., D. Gerber, S. Y. Huang, and S. Tonegawa. 1995. Ontogenic development and tissue distribution of V gamma 1-expressing gamma/delta T lymphocytes in normal mice. J. Exp. Med. 182:1921-1930.[Abstract/Free Full Text]
36.	Pereira, P., D. Gerber, A. Regnault, S. Y. Huang, V. Hermitte, A. Coutinho, and S. Tonegawa. 1996. Rearrangement and expression of Vzeta1, Vzeta2 and Vzeta3 TCR zeta genes in C57BL/6 mice. Int. Immunol. 8:83-90.[Abstract/Free Full Text]
37.	Roark, C. E., M. K. Vollmer, P. A. Campbell, W. K. Born, and R. L. O'Brien. 1996. Response of a gamma delta+ T cell receptor invariant subset during bacterial infection. J. Immunol. 156:2214-2220.[Abstract]
38.	Roberts, S. J., A. L. Smith, A. B. West, L. Wen, R. C. Findly, M. J. Owen, and A. C. Hayday. 1996. T-cell ß+ and + deficient mice display abnormal but distinct phenotypes toward a natural, widespread infection of the intestinal epithelium. Proc. Natl. Acad. Sci. USA 93:11774-11779.[Abstract/Free Full Text]
39.	Seixas, E. M., and J. Langhorne. 1999. gammadelta T cells contribute to control of chronic parasitemia in Plasmodium chabaudi infections in mice. J. Immunol. 162:2837-2841.[Abstract/Free Full Text]
40.	Selin, L. K., P. A. Santolucito, A. K. Pinto, E. Szomolanyi-Tsuda, and R. M. Welsh. 2001. Innate immunity to viruses: control of vaccinia virus infection by gamma delta T cells. J. Immunol. 166:6784-6794.[Abstract/Free Full Text]
41.	Takagaki, Y., N. Nakanishi, I. Ishida, O. Kanagawa, and S. Tonegawa. 1989. T cell receptor-gamma and -delta genes preferentially utilized by adult thymocytes for the surface expression. J. Immunol. 142:2112-2121.[Abstract]
42.	Tigelaar, R. E., and J. M. Lewis. 1995. Immunobiology of mouse dendritic epidermal T cells: a decade later, some answers, but still more questions. J. Investig. Dermatol. 105:43S-49S.[CrossRef][Medline]
43.	Wallace, M., M. Malkovsky, and S. R. Carding. 1995. Gamma/delta T lymphocytes in viral infections. J. Leukoc. Biol. 58:277-283.[Abstract]
44.	Wang, T., E. Scully, Z. Yin, J. H. Kim, S. Wang, J. Yan, M. Mamula, J. F. Anderson, J. Craft, and E. Fikrig. 2003. IFN-gamma-producing gamma delta T cells help control murine West Nile virus infection. J. Immunol. 171:2524-2531.[Abstract/Free Full Text]

This article has been cited by other articles:

• Li, Z., Burns, A. R., Rumbaut, R. E., Smith, C. W. (2007). {gamma}{delta} T Cells Are Necessary for Platelet and Neutrophil Accumulation in Limbal Vessels and Efficient Epithelial Repair after Corneal Abrasion. Am. J. Pathol. 171: 838-845 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) An author's correction has been published Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Newton, D. J. Articles by Carding, S. R. Search for Related Content PubMed PubMed Citation Articles by Newton, D. J. Articles by Carding, S. R.