This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Janes, B. K.
Right arrow Articles by Stibitz, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Janes, B. K.
Right arrow Articles by Stibitz, S.

 Previous Article  |  Next Article 

Infection and Immunity, March 2006, p. 1949-1953, Vol. 74, No. 3
0019-9567/06/$08.00+0     doi:10.1128/IAI.74.3.1949-1953.2006

Routine Markerless Gene Replacement in Bacillus anthracis

Brian K. Janes{dagger} and Scott Stibitz*

Division of Bacterial, Parasitic, and Allergenic Products, Center for Biologics Evaluation and Research, Food and Drug Administration, 8800 Rockville Pike, Bethesda, Maryland 20892

Received 2 November 2005/ Returned for modification 22 November 2005/ Accepted 8 December 2005


arrow
ABSTRACT
 
An improved genetic tool suitable for routine markerless allelic exchange in Bacillus anthracis has been constructed. Its utility was demonstrated by the introduction of insertions, deletions, and missense mutations on the chromosome and plasmid pXO1 of the Sterne strain of B. anthracis.


arrow
TEXT
 
Bacillus anthracis, a gram-positive, spore-forming bacterium, is the causative agent of anthrax. Full virulence requires the production of a toxin and the formation of a protective capsule. The primary genes involved in the production of these two virulence factors are contained within two large nonessential plasmids, pXO1 and pXO2 (13). Distributed elsewhere on the two plasmids and on the chromosome are genes involved in regulating the expression of anthrax toxin, the capsule, and a number of other genes potentially involved in virulence (2, 6, 11). The entire genomic sequence of the Ames strain of B. anthracis has recently been determined, enabling the identification of interesting, potentially virulence-related genes by reverse genetics (19).

The ideal mutation to initially introduce in such "genome-mining" studies is an in-frame deletion of the candidate gene. Such a mutation avoids problems with polarity and other effects on the expression of surrounding genes, which accompany either insertion or less-precise deletion mutations and which can complicate interpretation. In addition, the ability to readily introduce missense mutations, which enables a determination of the effects of single-amino-acid substitutions, is necessary for more-sophisticated genetic analyses of structure-function relationships. Both of these types of desirable mutations are "markerless" in that they are not necessarily associated with a phenotype that can be selected or screened for during genetic manipulation (e.g., antibiotic resistance in the case of an insertion mutation). For B. anthracis, markerless gene replacements for some loci have been reported (3), but the methods by which these mutations have been isolated can be time and labor-intensive. This is due to the lack of a counterselection scheme, in which, by selecting for the loss of a plasmid vector, one can select for the second of two successive crossovers between such a vector and the chromosome in order to achieve gene replacement.

An alternative to counterselection schemes involves the use of the intron-encoded homing restriction enzyme I-SceI. The ability of this enzyme, which recognizes an 18-bp sequence, to cleave an introduced site that is essentially unique in a genome has been exploited in the promotion of homologous recombination in organisms as diverse as bacteria, Drosophila, and other higher eukaryotes (4, 20, 22). In one case, the use of I-SceI in promoting allelic exchange in Escherichia coli has been reported (17). In such a scheme, the integration of a suicide plasmid by a cloned region of homology containing the desired genetic change results in one of the two crossovers required to effect allelic exchange. To promote the second, the synthesis of the I-SceI enzyme results in cleavage at the unique I-SceI site within the vector. This double-stranded break is a potent substrate for host recombination systems that can repair the break by homologous recombination of the regions of sequence homology that flank the ends of the break as a result of the initial plasmid cross-in. As in allelic-exchange schemes driven by counterselectable markers, the loss of the plasmid sequences by homologous recombination leads to a population in which approximately 50% will have undergone the desired gene replacement. We have adapted this procedure for use with B. anthracis.

The method, described as follows, uses two plasmids, pBKJ236 and pBKJ223. These are illustrated schematically in Fig. 1, and the steps in the method are depicted in Fig. 2. Gene replacement constructs are first cloned into plasmid pBKJ236 for integration into the B. anthracis chromosome by homologous recombination. This vector was constructed by modification of pJRS233, which contains an erythromycin resistance gene, a replication origin for stable maintenance in Escherichia coli, and a temperature-sensitive replication origin for conditional maintenance in gram-positive organisms (16). In addition to these features, we added the oriT from RP4 to facilitate conjugative transfer from E. coli to B. anthracis (26) and the 18-bp recognition site for I-SceI. It should be noted that any suicide vector can be modified for use in this method simply by inserting an I-SceI site. We chose to separate the steps of plasmid transfer and recombination with the chromosome in order to overcome the relatively low efficiencies of genetic transfer from E. coli to B. anthracis. Thus, plasmid integrants are isolated by a shift to the replication-nonpermissive temperature after conjugative transfer and growth at the permissive temperature. The second plasmid, pBKJ233, is then introduced by electroporation and selection for tetracycline resistance. A derivative of pUTE29 (8), this plasmid contains the gene for the I-SceI enzyme under the control of a hybrid amylase promoter and gram-positive ribosome-binding site. Transformants are streaked twice on solid medium containing tetracycline, and then single colonies are scored for loss of erythromycin resistance. Following screening by PCR for the incorporation of the desired mutation, the pBKJ233 plasmid is lost spontaneously by streaking the cells twice on medium lacking tetracycline and scoring a small number of colonies for tetracycline sensitivity. The replicational instability of the pUTE29 vector has been previously described (21).


Figure 1
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 1. Plasmids used in allelic exchange. pBKJ236 was created by the addition of an approximately 250-bp Bam-HindIII fragment from pSS1910 (25) containing the oriT of RP4 into the same sites of pJRS233 (16) and the subsequent addition at the KpnI site of the complementary oligonucleotides CATAGGGATAACAGGGTAATTGAATTCGGTAC and CGAATTCAATTACCCTGTTATCCCTATGGTAC containing an I-SceI site. To create pBKJ223, two PCR-generated fragments were added between the SalI and KpnI sites of pUTE29 (8). One fragment, from XhoI to NdeI, was created using the primers CGCGAATTCCTCGAGAAGCTTGAAGAAGACCATAAAAATACCTTGTC and CGCTCTAGACATATGCGTTCTCCTTTCATTTTCTTATACAAATTATATTTT with Bacillus amyloliquefaciens chromosomal DNA as a template and was based on that described by Cohen etal. (5). This fragment contains the promoter for amylase and the ribosome-binding site of B. anthracis pagA (incorporated into one primer). The promoter sequence differs from the published sequence (5, 15) at several positions: an AT-to-TA transversion at positions –80 and –79 (with respect to the initiating codon) and a T-to-G change at position –63, presumably due to PCR errors. The other fragment, from NdeI to KpnI, was created using the primers CGCTCTAGACATATGCATCAAAAAAACCAGGTAATGAAC and CGCGGTACCTTATTATTTCAGGAAAGTTTCGGAGGAGAT with pUCRP12 (17) as a template and comprised the ORF for the I-SceI enzyme.


Figure 2
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 2. Schematic of allelic-exchange procedure. (a) A modified chromosomal segment containing a deletion of orfY with flanking orfX and orfZ sequences was cloned into pBKJ236 and introduced into B. anthracis by conjugation. For conjugation, the desired pBKJ236 construct was first transformed into the E. coli dam dcm strain SCS110 (Stratagene, La Jolla, CA). It has previously been reported that propagation of plasmids in E. coli strains deficient in adenine and cytosine methylation increases their efficiency of transfer into B. anthracis (10). Overnight cultures of this strain grown in LB medium (12) plus 300 µg/ml erythromycin, SS1827 (24) grown in LB medium plus 200 µg/ml ampicillin, and B. anthracis Sterne grown in brain heart infusion (BHI) agar (Difco) were washed two times by pelleting them in a microcentrifuge and resuspending them in LB medium. Equal amounts of each suspension were mixed, and 150 µl was spotted onto a BHI agar plate and allowed to dry. The plates were incubated at room temperature for 24 h, at which time the accumulated growth was recovered by scraping and resuspended in 200 µl LB medium, and 150 µl was spotted onto BHI agar containing 5 µg/ml erythromycin and 60 units/ml polymyxin B. After the plates were dried and streaked for single colonies, they were incubated for 48 h at room temperature. (b) B. anthracis recombinants harboring the allelic-exchange construct integrated by homologous recombination between cloned and chromosomal sequences were isolated by shifting them to 37°C, a nonpermissive temperature for plasmid replication, while maintaining selection for erythromycin resistance. Exconjugant colonies arising in the previous step were inoculated into BHI broth plus 5 µg erythromycin and grown with shaking at room temperature overnight. The resulting saturated cultures were diluted 1:1,000 in fresh BHI broth plus erythromycin and incubated with shaking at 37°C until saturated (usually 6 to 8 h, although cultures incubated overnight were used successfully as well). A 200-µl sample of these cultures was spotted onto BHI agar plus erythromycin, allowed to dry, streaked for single colonies, and incubated at 37°C overnight. (c) Synthesis of the I-SceI restriction enzyme directed by pBKJ223 resulted in the cleavage of the integrated pBKJ236 vector, creating a potent substrate for bacterial-host recombinational repair systems. Integrant colonies arising in the previous step were inoculated into LB medium plus 0.1% glucose and 5 µg/ml erythromycin, grown with shaking overnight at 37°C, subcultured into fresh medium of the same composition, and used to prepare electrocompetent cells by the method of Quinn and Dancer (18). Plasmid DNA was prepared from SCS110(pBKJ223) using a spin mini-prep kit (QIAGEN, Inc., Valencia, CA). Electrocompetent cells (400 µl) and plasmid DNA (5 µl) were combined in a 0.4-cm-gap electroporation cuvette on ice. Samples were electroporated using a gene pulser (Bio-Rad, Hercules, CA) set at 2.5 V, 200 {Omega}, and 25 µF, returned to ice, diluted with 0.5 ml of LB medium plus glucose, incubated with shaking for 2 to 4 h, plated on BHI agar plus 10 µg tetracycline, and incubated overnight at 37°C. (d) Repair of the double-stranded break by homologous recombination between flanking repeat sequences results in plasmid excision. Recombination occurring on the same side of orfY as the integration event (denoted by circled "1") leads to regeneration of the wild-type sequence. Recombination occurring on the opposite side (denoted by circled "2") leads to the integration of the {Delta}orfY mutation. Tetracycline-resistant colonies arising from electroporation in the previous step were pooled, restreaked on the same medium, and incubated overnight at 37°C. This process was repeated with streaking of colonies from areas of confluent growth. Single colonies from the second streaking were patched onto BHI agar and BHI agar plus erythromycin to screen for erythromycin sensitivity. Chromosomal DNA was prepared from patches of sensitive colonies from the BHI agar (Colony Fast-Screen kit; Epicentre Biotechnologies, Madison, WI) and screened by PCR (FailSafe PCR system; Epicentre Biotechnologies, Madison, WI) with appropriate primers (see legend to Fig. 3) to detect the desired gene replacements. Strains so selected were restreaked on BHI agar and incubated overnight at 37°C, and single colonies were patched onto BHI agar and BHI agar plus tetracycline to screen for spontaneous loss of pBKJ223.

In order to demonstrate the utility of this approach, a number of mutations were introduced into B. anthracis 7702 (Sterne). We have also used this method with success with a similar strain, 34F2 (data not shown). The structures of the lesions are presented in Table 1, and the efficiency of the pBKJ233-encoded I-SceI nuclease in stimulating the second crossover event and allelic exchange is presented in Table 2. In separate control experiments with the strain harboring the pBKJ240 plasmid integrant, the pUTE29 vector showed no such stimulation (data not shown). Figure 3 shows the results of the PCR analysis demonstrating the incorporation of the altered allele in the resulting mutant strains. The plcR locus was used as an initial test of this method because it has previously been documented that the plcR gene is nonfunctional in B. anthracis due to a frameshift mutation (1). Both a clean, in-frame deletion of the plcR gene ({Delta}plcR240) and a deletion marked with a spectinomycin resistance cassette (plcR241::spc) were successfully introduced. The scrB gene was chosen since it presented a target with a potentially scorable colonial phenotype. This gene is predicted to encode sucrose-6-phosphate hydrolase, which is essential for the metabolism of sucrose by the sucrose phosphoenolpyruvate-dependent phosphotransferase system (7, 9). Analysis of the B. anthracis (Ames) genome suggested that no other pathway for catabolizing sucrose existed. Indeed, both the insertion mutation (scrB239::spc) and a missense mutation (scrB237) (G214Q) conferred a sucrose utilization defect visible as a change of colony color from yellow (wild type) to pink on nutrient agar supplemented with 1% sucrose and 0.0025% phenol red. This result validates the prediction that scrB represents the only pathway for sucrose utilization in B. anthracis. Since sporulation is also an easily scorable phenotype, we introduced an in-frame deletion (spo0A245) into the spo0A gene, a transcription factor required in the early steps of sporulation (14). As expected, the resultant mutant strain, BA722, yielded no detectable spores (CFU after treatment at 65°C for 30 min) under conditions (growth in Difco sporulation medium) which, for the B. anthracis 7702 parent strain, resulted in nearly 50% of the CFU being spores (data not shown). The identification of a deletion encompassing the spo0A gene in B. anthracis has been previously reported (27). However, this spontaneous deletion had endpoints in flanking DNA and thus affects other open reading frames (ORF) as well. To ascertain whether the method described here could be used for the replacement of genes on the large virulence plasmids of B. anthracis, the genes encoding the three components of anthrax toxin, pagA, lef, and cya, were targeted. Each of the three single mutant strains which resulted demonstrated a lack of production of the corresponding toxin component, but not of the other two toxin components, when tested by Western blotting (data not shown). Finally, in order to demonstrate the use of this tool to perform sequential mutageneses, a double lef cya mutant (BA721) was constructed. Synthesis of protective antigen, the product of the pagA gene, was normal for this strain, while lethal factor and edema factor were undetectable (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Description of mutants


View this table:
[in this window]
[in a new window]
 
TABLE 2. Frequencies of allelic exchanges generated by the I-SceI system


Figure 3
View larger version (69K):
[in this window]
[in a new window]
 
FIG. 3. Diagnostic PCR of the mutant strains made in this study. Refer to Table 1 for more information on each strain and mutant allele, including the expected size differences in the PCR products. PCR products were separated on a 1% agarose gel and visualized by staining with ethidium bromide. Primers that functioned in regions outside and flanking the cloned regions were chosen so that amplification of the plasmid-borne allele would not occur. Primers were as follows: for plcR, GGCATAATCAAGGTTTCTCTCACTTAAAAG and CCAAGTGAAGATTTAGCTGCATCG; for scrB, ATGTCAAAATATAAAACAATACTGCAATC and TCATACAATCCCTCTTTTCAGCTTATATTG; for spo0A, GCATAATCCCCCACAACAGGG and GAAATTAGCGAGGTTCTCACCAGATC; for pagA, CGCATATAAGCAAATACTTAATTGGTC and GGATAGGGTTTAACAACTTAATAATCCC; for lef, CACGAGAAGAGTATTTAAAGAAAATC and AACTATAGGACAATATTCATTACCATG; and for cya, ATATCAAGTTTAATTGTTAAGTTTGAAGG and CCCGCGGCCGCAACCAAATGGTTTTCATTTCTTAG.

In summary, the gene replacement procedure described here has been demonstrated to perform efficiently with B. anthracis and has been used to achieve allelic exchange of both marked and unmarked mutations, including deletions, insertions, and gene replacements as large as 1 kb or as small as 1 bp. This procedure can be used to target both chromosomal and plasmid-borne genes and is relatively fast. Once the initial crossover event has occurred, candidates for final screening can be generated in less than a week with little effort. An additional virtue is that genetic modification of the B. anthracis strain of interest is not required as it is in counterselection schemes such as that based on rpsL mutation and streptomycin sensitivity. Indeed, the natural resistance of B. anthracis to the antibiotic polymyxin B renders unnecessary even the introduction of a chromosomal marker for use in selection against the donor E. coli in conjugation experiments. As a result, any B. anthracis strain can be used, and engineered strains will be isogenic with the parent strain, with the exception of the introduced mutation(s). The ability to routinely introduce engineered alleles which are not marked with antibiotic resistance allows for the serial introduction of an unlimited number of such alterations. It also expands the repertoire of mutations that can be introduced to include single-base-pair changes, thus allowing detailed genetic analyses of the structure-function relationships of proteins and DNA sites in a B. anthracis genetic background.

Future work is required for the refinement of this system to accommodate select agents in cases where the use of some of the antibiotic markers implemented here would be prohibited. However, much experimental work is being performed with the non-human-pathogenic strain (Sterne) used in this study. The speed and efficiency of the techniques reported here allow the construction of multiple mutations in parallel and thus will enable types of comprehensive genetic analysis that have not been feasible for B. anthracis to date. It is our hope that these methods will facilitate the genetic study and manipulation of this fascinating and currently all-too-important bacterial pathogen.


arrow
ACKNOWLEDGMENTS
 
We are indebted to Theresa Koehler for helpful discussions; to Gyorgi Posfai, June Scott, Robert Hartley, and Tod Merkel for providing strains; and to Drusilla Burns and Michael Schmitt for their critical reading of the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Division of Bacterial Products, CBER/FDA, 8800 Rockville Pike, Bethesda, MD 20892. Phone: (301) 827-5156. Fax: (301) 402-2776. E-mail: stibitz{at}helix.nih.gov. Back

Editor: J. T. Barbieri

{dagger} Present address: Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, Mich. Back


arrow
REFERENCES
 
    1
  1. Agaisse, H., M. Gominet, O. A. Okstad, A. B. Kolsto, and D. Lereclus. 1999. PlcR is a pleiotropic regulator of extracellular virulence factor gene expression in Bacillus thuringiensis. Mol. Microbiol. 32:1043-1053.[CrossRef][Medline]
  2. 2
  3. Bourgogne, A., M. Drysdale, S. G. Hilsenbeck, S. N. Peterson, and T. M. Koehler. 2003. Global effects of virulence gene regulators in a Bacillus anthracis strain with both virulence plasmids. Infect. Immun. 71:2736-2743.[Abstract/Free Full Text]
  4. 3
  5. Brossier, F., M. Weber-Levy, M. Mock, and J.-C. Sirard. 2000. Role of toxin functional domains in anthrax pathogenesis. Infect. Immun. 68:1781-1786.[Abstract/Free Full Text]
  6. 4
  7. Choulika, A., A. Perrin, B. Dujon, and J. F. Nicolas. 1995. Induction of homologous recombination in mammalian chromosomes by using the I-SceI system of Saccharomyces cerevisiae. Mol. Cell. Biol. 15:1968-1973.[Abstract]
  8. 5
  9. Cohen, S., I. Mendelson, Z. Altboum, D. Kobiler, E. Elhanany, T. Bino, M. Leitner, I. Inbar, H. Rosenberg, Y. Gozes, R. Barak, M. Fisher, C. Kronman, B. Velan, and A. Shafferman. 2000. Attenuated nontoxinogenic and nonencapsulated recombinant Bacillus anthracis spore vaccines protect against anthrax. Infect. Immun. 68:4549-4558.[Abstract/Free Full Text]
  10. 6
  11. Drysdale, M., A. Bourgogne, S. G. Hilsenbeck, and T. M. Koehler. 2004. atxA controls Bacillus anthracis capsule synthesis via acpA and a newly discovered regulator, acpB. J. Bacteriol. 186:307-315.[Abstract/Free Full Text]
  12. 7
  13. Hayakawa, M., H. Aoki, and H. K. Kuramitsu. 1986. Isolation and characterization of the sucrose 6-phosphate hydrolase gene from Streptococcus mutans. Infect. Immun. 53:582-586.[Abstract/Free Full Text]
  14. 8
  15. Koehler, T. M., Z. Dai, and M. Kaufman-Yarbray. 1994. Regulation of the Bacillus anthracis protective antigen gene: CO2 and a trans-acting element activate transcription from one of two promoters. J. Bacteriol. 176:586-595.[Abstract/Free Full Text]
  16. 9
  17. Lunsford, R. D., and F. L. Macrina. 1986. Molecular cloning and characterization of scrB, the structural gene for the Streptococcus mutans phosphoenolpyruvate-dependent sucrose phosphotransferase system sucrose-6-phosphate hydrolase. J. Bacteriol. 166:426-434.[Abstract/Free Full Text]
  18. 10
  19. Marrero, R., and S. L. Welkos. 1995. The transformation frequency of plasmids into Bacillus anthracis is affected by adenine methylation. Gene 152:75-78.[CrossRef][Medline]
  20. 11
  21. Mignot, T., M. Mock, and A. Fouet. 2003. A plasmid-encoded regulator couples the synthesis of toxins and surface structures in Bacillus anthracis. Mol. Microbiol. 47:917-927.[CrossRef][Medline]
  22. 12
  23. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  24. 13
  25. Mock, M., and A. Fouet. 2001. Anthrax. Annu. Rev. Microbiol. 55:647-671.[CrossRef][Medline]
  26. 14
  27. Molle, V., M. Fujita, S. T. Jensen, P. Eichenberger, J. E. Gonzalez-Pastor, J. S. Liu, and R. Losick. 2003. The Spo0A regulon of Bacillus subtilis. Mol. Microbiol. 50:1683-1701.[CrossRef][Medline]
  28. 15
  29. Palva, I., R. F. Pettersson, N. Kalkkinen, P. Lehtovaara, M. Sarvas, H. Soderlund, K. Takkinen, and L. Kaariainen. 1981. Nucleotide sequence of the promoter and NH2-terminal signal peptide region of the alpha-amylase gene from Bacillus amyloliquefaciens. Gene 15:43-51.[CrossRef][Medline]
  30. 16
  31. Perez-Casal, J., J. A. Price, E. Maguin, and J. R. Scott. 1993. An M protein with a single C repeat prevents phagocytosis of Streptococcus pyogenes: use of a temperature-sensitive shuttle vector to deliver homologous sequences to the chromosome of S. pyogenes. Mol. Microbiol. 8:809-819.[Medline]
  32. 17
  33. Posfai, G., V. Kolisnychenko, Z. Bereczki, and F. R. Blattner. 1999. Markerless gene replacement in Escherichia coli stimulated by a double-strand break in the chromosome. Nucleic Acids Res. 27:4409-4415.[Abstract/Free Full Text]
  34. 18
  35. Quinn, C. P., and B. N. Dancer. 1990. Transformation of vegetative cells of Bacillus anthracis with plasmid DNA. J. Gen. Microbiol. 136:1211-1215.[Abstract/Free Full Text]
  36. 19
  37. Read, T. D., S. N. Peterson, N. Tourasse, L. W. Baillie, I. T. Paulsen, K. E. Nelson, H. Tettelin, D. E. Fouts, J. A. Eisen, S. R. Gill, E. K. Holtzapple, O. A. Okstad, E. Helgason, J. Rilstone, M. Wu, J. F. Kolonay, M. J. Beanan, R. J. Dodson, L. M. Brinkac, M. Gwinn, R. T. DeBoy, R. Madpu, S. C. Daugherty, A. S. Durkin, D. H. Haft, W. C. Nelson, J. D. Peterson, M. Pop, H. M. Khouri, D. Radune, J. L. Benton, Y. Mahamoud, L. Jiang, I. R. Hance, J. F. Weidman, K. J. Berry, R. D. Plaut, A. M. Wolf, K. L. Watkins, W. C. Nierman, A. Hazen, R. Cline, C. Redmond, J. E. Thwaite, O. White, S. L. Salzberg, B. Thomason, A. M. Friedlander, T. M. Koehler, P. C. Hanna, A. B. Kolsto, and C. M. Fraser. 2003. The genome sequence of Bacillus anthracis Ames and comparison to closely related bacteria. Nature 423:81-86.[CrossRef][Medline]
  38. 20
  39. Rong, Y., S. W. Titen, H. B. Xie, M. M. Golic, M. Bastiani, P. Bandyopadhyay, B. M. Olivera, M. Brodsky, G. M. Rubin, and K. G. Golic. 2002. Targeted mutagenesis by homologous recombination in D. melanogaster. Genes Dev. 16:1568-1581.[Abstract/Free Full Text]
  40. 21
  41. Saile, E., and T. M. Koehler. 2002. Control of anthrax toxin gene expression by the transition state regulator abrB. J. Bacteriol. 184:370-380.[Abstract/Free Full Text]
  42. 22
  43. Schmidt-Puchta, W., N. Orel, A. Kyryk, and H. Puchta. 2004. Intrachromosomal homologous recombination in Arabidopsis thaliana. Methods Mol. Biol. 262:25-34.[Medline]
  44. 23
  45. Steinmetz, M., and R. Richter. 1994. Easy cloning of mini-Tn10 insertions from the Bacillus subtilis chromosome. J. Bacteriol. 176:1761-1763.[Abstract/Free Full Text]
  46. 24
  47. Stibitz, S., and N. H. Carbonetti. 1994. Hfr mapping of mutations in Bordetella pertussis that define a genetic locus involved in virulence gene regulation. J. Bacteriol. 176:7260-7266.[Abstract/Free Full Text]
  48. 25
  49. Stibitz, S., and M.-S. Yang. 1997. Genomic fluidity of Bordetella pertussis assessed by a new method for chromosomal mapping. J. Bacteriol. 179:5820-5826.[Abstract/Free Full Text]
  50. 26
  51. Trieu-Cuot, P., C. Carlier, C. Poyart-Salmeron, and P. Courvalin. 1991. Shuttle vectors containing a multiple cloning site and a lacZ alpha gene for conjugal transfer of DNA from Escherichia coli to gram-positive bacteria. Gene 102:99-104.[CrossRef][Medline]
  52. 27
  53. Worsham, P. L., and M. R. Sowers. 1999. Isolation of an asporogenic (Spo0A) protective antigen-producing strain of Bacillus anthracis. Can. J. Microbiol. 45:1-8.[CrossRef][Medline]


Infection and Immunity, March 2006, p. 1949-1953, Vol. 74, No. 3
0019-9567/06/$08.00+0     doi:10.1128/IAI.74.3.1949-1953.2006




This article has been cited by other articles:

  • Ebrahimi, C. M., Kern, J. W., Sheen, T. R., Ebrahimi-Fardooee, M. A., van Sorge, N. M., Schneewind, O., Doran, K. S. (2009). Penetration of the Blood-Brain Barrier by Bacillus anthracis Requires the pXO1-Encoded BslA Protein. J. Bacteriol. 191: 7165-7173 [Abstract] [Full Text]  
  • Lopez, C. M., Rholl, D. A., Trunck, L. A., Schweizer, H. P. (2009). Versatile Dual-Technology System for Markerless Allele Replacement in Burkholderia pseudomallei. Appl. Environ. Microbiol. 75: 6496-6503 [Abstract] [Full Text]  
  • Vasudevan, P., McElligott, J., Attkisson, C., Betteken, M., Popham, D. L. (2009). Homologues of the Bacillus subtilis SpoVB Protein Are Involved in Cell Wall Metabolism. J. Bacteriol. 191: 6012-6019 [Abstract] [Full Text]  
  • Giebel, J. D., Carr, K. A., Anderson, E. C., Hanna, P. C. (2009). The Germination-Specific Lytic Enzymes SleB, CwlJ1, and CwlJ2 Each Contribute to Bacillus anthracis Spore Germination and Virulence. J. Bacteriol. 191: 5569-5576 [Abstract] [Full Text]  
  • Pomerantsev, A. P., Camp, A., Leppla, S. H. (2009). A New Minimal Replicon of Bacillus anthracis Plasmid pXO1. J. Bacteriol. 191: 5134-5146 [Abstract] [Full Text]  
  • Chandramohan, L., Ahn, J.-S., Weaver, K. E., Bayles, K. W. (2009). An Overlap between the Control of Programmed Cell Death in Bacillus anthracis and Sporulation. J. Bacteriol. 191: 4103-4110 [Abstract] [Full Text]  
  • Heffron, J. D., Orsburn, B., Popham, D. L. (2009). Roles of Germination-Specific Lytic Enzymes CwlJ and SleB in Bacillus anthracis. J. Bacteriol. 191: 2237-2247 [Abstract] [Full Text]  
  • Cybulski, R. J. Jr., Sanz, P., Alem, F., Stibitz, S., Bull, R. L., O'Brien, A. D. (2009). Four Superoxide Dismutases Contribute to Bacillus anthracis Virulence and Provide Spores with Redundant Protection from Oxidative Stress. Infect. Immun. 77: 274-285 [Abstract] [Full Text]  
  • Loving, C. L., Khurana, T., Osorio, M., Lee, G. M., Kelly, V. K., Stibitz, S., Merkel, T. J. (2009). Role of Anthrax Toxins in Dissemination, Disease Progression, and Induction of Protective Adaptive Immunity in the Mouse Aerosol Challenge Model. Infect. Immun. 77: 255-265 [Abstract] [Full Text]  
  • Lambert, E. A., Popham, D. L. (2008). The Bacillus anthracis SleL (YaaH) Protein Is an N-Acetylglucosaminidase Involved in Spore Cortex Depolymerization. J. Bacteriol. 190: 7601-7607 [Abstract] [Full Text]  
  • Bongiorni, C., Fukushima, T., Wilson, A. C., Chiang, C., Mansilla, M. C., Hoch, J. A., Perego, M. (2008). Dual Promoters Control Expression of the Bacillus anthracis Virulence Factor AtxA. J. Bacteriol. 190: 6483-6492 [Abstract] [Full Text]  
  • Paige, C., Reid, S. D., Hanna, P. C., Claiborne, A. (2008). The Type III Pantothenate Kinase Encoded by coaX Is Essential for Growth of Bacillus anthracis. J. Bacteriol. 190: 6271-6275 [Abstract] [Full Text]  
  • Wilson, A. C., Hoch, J. A., Perego, M. (2008). Virulence Gene Expression Is Independent of ResDE-Regulated Respiration Control in Bacillus anthracis. J. Bacteriol. 190: 5522-5525 [Abstract] [Full Text]  
  • Hsu, L.-C., Ali, S. R., McGillivray, S., Tseng, P.-H., Mariathasan, S., Humke, E. W., Eckmann, L., Powell, J. J., Nizet, V., Dixit, V. M., Karin, M. (2008). A NOD2-NALP1 complex mediates caspase-1-dependent IL-1{beta} secretion in response to Bacillus anthracis infection and muramyl dipeptide. Proc. Natl. Acad. Sci. USA 105: 7803-7808 [Abstract] [Full Text]  
  • Brahmbhatt, T. N., Janes, B. K., Stibitz, E. S., Darnell, S. C., Sanz, P., Rasmussen, S. B., O'Brien, A. D. (2007). Bacillus anthracis Exosporium Protein BclA Affects Spore Germination, Interaction with Extracellular Matrix Proteins, and Hydrophobicity. Infect. Immun. 75: 5233-5239 [Abstract] [Full Text]  
  • Bergman, N. H., Anderson, E. C., Swenson, E. E., Janes, B. K., Fisher, N., Niemeyer, M. M., Miyoshi, A. D., Hanna, P. C. (2007). Transcriptional Profiling of Bacillus anthracis during Infection of Host Macrophages. Infect. Immun. 75: 3434-3444 [Abstract] [Full Text]  
  • Passalacqua, K. D., Bergman, N. H., Lee, J. Y., Sherman, D. H., Hanna, P. C. (2007). The Global Transcriptional Responses of Bacillus anthracis Sterne (34F2) and a {Delta}sodA1 Mutant to Paraquat Reveal Metal Ion Homeostasis Imbalances during Endogenous Superoxide Stress. J. Bacteriol. 189: 3996-4013 [Abstract] [Full Text]  
  • Szurmant, H., Mohan, M. A., Imus, P. M., Hoch, J. A. (2007). YycH and YycI Interact To Regulate the Essential YycFG Two-Component System in Bacillus subtilis. J. Bacteriol. 189: 3280-3289 [Abstract] [Full Text]  
  • Bongiorni, C., Stoessel, R., Perego, M. (2007). Negative Regulation of Bacillus anthracis Sporulation by the Spo0E Family of Phosphatases. J. Bacteriol. 189: 2637-2645 [Abstract] [Full Text]  
  • Lee, J. Y., Janes, B. K., Passalacqua, K. D., Pfleger, B. F., Bergman, N. H., Liu, H., Hakansson, K., Somu, R. V., Aldrich, C. C., Cendrowski, S., Hanna, P. C., Sherman, D. H. (2007). Biosynthetic Analysis of the Petrobactin Siderophore Pathway from Bacillus anthracis. J. Bacteriol. 189: 1698-1710 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Janes, B. K.
Right arrow Articles by Stibitz, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Janes, B. K.
Right arrow Articles by Stibitz, S.