Previous Article | Next Article 
Infection and Immunity, April 2006, p. 2373-2381, Vol. 74, No. 4
0019-9567/06/$08.00+0 doi:10.1128/IAI.74.4.2373-2381.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Deletion of the CaBIG1 Gene Reduces ß-1,6-Glucan Synthesis, Filamentation, Adhesion, and Virulence in Candida albicans
Takashi Umeyama,1
Aki Kaneko,1
Hiroshi Watanabe,2
Asuka Hirai,1,3
Yoshimasa Uehara,1
Masakazu Niimi,1* and
Masayuki Azuma2
Department of Bioactive Molecules, National Institute of Infectious Diseases, Tokyo 162-8640,1
Department of Applied Chemistry and Bioengineering, Graduate School of Engineering, Osaka City University, Osaka 558-8585,2
Department of Pathobiology, Nihon University School of Veterinary Medicine, Kanagawa 252-8510, Japan3
Received 17 October 2005/
Returned for modification 27 November 2005/
Accepted 24 January 2006
 |
ABSTRACT
|
|---|
The human fungal pathogen Candida albicans is able to change its shape in response to various environmental signals. We analyzed the C. albicans BIG1 homolog, which might be involved in ß-1,6-glucan biosynthesis in Saccharomyces cerevisiae. C. albicans BIG1 is a functional homolog of an S. cerevisiae BIG1 gene, because the slow growth of an S. cerevisiae big1 mutant was restored by introduction of C. albicans BIG1. CaBig1p was expressed constitutively in both the yeast and hyphal forms. A specific localization of CaBig1p at the endoplasmic reticulum or plasma membrane similar to the subcellular localization of S. cerevisiae Big1p was observed in yeast form. The content of ß-1,6-glucan in the cell wall was decreased in the Cabig1
strain in comparison with the wild-type or reconstituted strain. The C. albicans BIG1 disruptant showed reduced filamentation on a solid agar medium and in a liquid medium. The Cabig1
mutant showed markedly attenuated virulence in a mouse model of systemic candidiasis. Adherence to human epithelial HeLa cells and fungal burden in kidneys of infected mice were reduced in the Cabig1
mutant. Deletion of CaBIG1 abolished hyphal growth and invasiveness in the kidneys of infected mice. Our results indicate that adhesion failure and morphological abnormality contribute to the attenuated virulence of the Cabig1
mutant.
 |
INTRODUCTION
|
|---|
Candida albicans is an opportunistic fungal pathogen in humans and can cause either systemic or mucosal infection. In immunocompromised patients, this organism can progress to severe systemic invasion, leading to life-threatening circumstances (24, 25). C. albicans is a polymorphic fungus capable of converting its cell shape from budding yeast to filamentous form, including pseudohyphae and true hyphae. This morphological transition has been strongly associated with pathogenicity (9).
The cell wall of yeast is an elastic structure that provides physical protection and osmotic support and determines the shape of the cell (10, 17, 21, 28). Because of its major structural differences from human cells and its importance in fungal growth and virulence, cell wall biogenesis has long been focused on as a fascinating target for new antifungal agents. The mechanical strength of the wall is due mostly to the inner layer, which consists of ß-glucan and chitin. The ß-glucans are the main components in C. albicans, accounting for 50 to 60% by weight of the cell wall. Chitin is a minor (1 to 10%) but important constituent of the C. albicans cell wall, distributed at the septa between independent cell compartments, budding scars, and the ring around the constriction between mother cell and bud. The outer layer, which consists of heavily glycosylated mannoproteins emanating from the cell surface, is involved in cell-cell recognition events. Mannoproteins represent 30 to 40% of the total cell wall polysaccharide and determine the surface properties. Cell wall mannoproteins are covalently linked to the ß-1,3-glucan-chitin network either indirectly through a ß-1,6-glucan moiety or directly (10, 28). C. albicans hyphal cells contain twice as much chitin as the yeast cells do, whereas the increased levels of ß-1,6-glucan and the decreased levels of mannoproteins in hyphal cells are due to the change in the growth temperature. C. albicans strains contain more than 20% ß-1,6-glucan in the cell wall polysaccharides, while ß-1,6-glucan constitutes about 12% of the wall polysaccharides in Saccharomyces cerevisiae. Furthermore, the fine structure of ß-glucan differs between S. cerevisiae and C. albicans: the ß-1,6-glucan polymer is less branched and contains fewer intrachain ß-1,3 linkages in C. albicans than in S. cerevisiae (14).
The S. cerevisiae ß-1,6-glucan is a highly branched polymer consisting of approximately 10% of the cell wall dry weight, with an average size of 350 residues. In C. albicans, ß-1,6-glucan is particularly abundant, being present at almost double the amounts found in S. cerevisiae (14, 23). Based on genetic analyses of null strains, many genes involved in S. cerevisiae ß-1,6-glucan biosynthesis have been identified; these include the kre mutants, which are resistant to the K1 killer toxin, which kills yeast following binding to a ß-1,6-glucan-containing cell surface receptor (1, 5, 7). The proteins encoded by some KRE genes are located along the secretory pathway, including the endoplasmic reticulum (ER), Golgi apparatus, and plasma membrane. Kre5p is an ER protein that shares significant sequence similarity with UDP-glucose:glycoprotein glucosyltransferases and is epistatic to all other KRE genes that have been isolated to date (22). Many other gene products involved in ß-1,6-glucan show no significant similarity to any protein with a known function. For C. albicans, there have also been reported several genes identified by homology with S. cerevisiae genes involved in ß-1,6-glucan biosynthesis: CaKRE5 (14), CaKRE9 (18), CaKRE6, and CaSKN1 (23). These reports describe the association of ß-1,6-glucan biosynthesis with morphogenesis and virulence.
In S. cerevisiae, BIG1 was first described as a multicopy suppressor of the synthetic lethality of the rot1-1 rot2-1 double mutant; both mutations were identified by their ability to suppress the loss of TOR2, an essential phosphatidylinositol kinase homolog (4). The deletion of BIG1 and ROT1 leads to a remarkable reduction of the amount of ß-1,6-glucan in the cell wall composition and thereby significant growth defects occur (2, 19, 26). Big1p is an N-glycosylated integral membrane protein with a type I topology and is located in the ER membrane (2). It is an indisputable fact that Big1p might play some role in ß-1,6-glucan biosynthesis; however, the exact role of Big1p in the cell wall biosynthesis remains unknown. A homolog of S. cerevisiae BIG1 has also been identified in the pathogenic fungus C. albicans (2). Here, we characterize C. albicans BIG1 to determine the importance of Big1p to ß-1,6-glucan synthesis and the impact that it has on hyphal growth and virulence. Big1p is expressed constitutively and is localized to ER or plasma membrane. Deletion of BIG1 in C. albicans did not affect the rate of vegetative growth but did lead to defects in filamentation, adhesion, and virulence.
 |
MATERIALS AND METHODS
|
|---|
Strains, growth conditions, and basic techniques.
Table 1 lists the S. cerevisiae and C. albicans strains used in this study. Cells were grown in yeast extract-peptone-dextrose (YPD) (adjusted to pH 5.6; Qbiogene Inc.), SD-URA, or SD-AU (6.7 g liter1 yeast nitrogen base without amino acids [Difco], 2% glucose, CSM-URA, or CSM-ARG-URA [Qbiogene Inc.]) with shaking to induce the yeast form or in YPD (adjusted to pH 7.2) plus 10% serum at 37°C with shaking to induce hyphae. For S. cerevisiae, yeast nitrogen base (YNB) agar [0.17% yeast nitrogen base without amino acids and ammonium sulfate (Difco), 0.5% (NH4)2SO4, 2% galactose, 0.006% leucine, 0.002% histidine, 0.001% methionine, 0.0015% lysine, 2% agar] was used. The rate of growth was measured by determining the optical density at 660 nm with a TN-1506 biophotorecorder (Advantec, Japan). For determinations of filamentous growth on solid medium, strains were grown for 7 days at 37°C on 10% calf serum solidified with the addition of 2% agar.
Chlamydospore formation was performed as described by Martin et al. (20). Briefly, cells were grown overnight at 30°C in YPD medium and diluted 1:250 in sterile water. Three microliters of this suspension was spotted onto cornmeal-Tween agar (1.7% cornmeal agar [Nissui, Japan] plus 1% Tween 80). Coverslips were placed on top of the spots, and the plates were kept for 7 days at 25°C in the dark.
Escherichia coli XL1-Blue and cloning vector pUC19 (32) were used for DNA manipulation. General recombinant DNA procedures were performed as described by Sambrook and Russell (27). C. albicans was transformed by the method described by Umeyama et al. (29). An Applied Biosystems model 3100 automated capillary sequencer was used for nucleotide sequencing. Western analysis using anti-hemagglutinin (HA) or anti-PSTAIRE antibody, recognizing CaCdc28 or CaPho85 in C. albicans, was performed as described by Umeyama et al. (29). Microscopic observation was performed using a conventional fluorescence microscope (IX81; Olympus, Japan) equipped with a DP70 digital camera (Olympus, Japan).
Plasmid construction.
For plasmids used in S. cerevisiae, a DNA fragment containing ScBIG1 or CaBIG1 was amplified using primers ScBIG1-N (5'-CGCGGATCCATTCTTTAATTATATCGA) and ScBIG1-C (5'-CCGGAATTCGTATATAACGAACCATAA) or CaBIG1-N (5'-CCCAAGCTTGATAAAATGAGATTATTCGTCCTA) and CaBIG1-C (5'-CGGGATCCTTAATCTAATTTCTTATCGTCAGCA) with pRS426-BIG1 (2) or CAI-4 chromosomal DNA, respectively, as a template. Each DNA fragment was digested with BamHI and EcoRI or HindIII and BamHI and then cloned into the BamHI-EcoRI or HindIII-BamHI sites of pYES2.0 to generate pYES2.0-ScBIG1 or pYES2.0-CaBIG1, respectively.
A green fluorescent protein (GFP) sequence-containing XhoI-EcoRI DNA fragment of pGFP-ACT1 (29) was cloned into the XhoI-EcoRI sites of pFLAG-MET3 (30) to generate pGFP-MET3. For plasmids containing the CaBIG1 gene, a DNA fragment containing CaBIG1 was PCR amplified using two primers, BIG1-N (5'-GCCGGATCCAGGATGAGATTATTCGTCCTACTAG) and BIG1-C (5'-GGCGCATGCATCTAATTTCTTATCGTCAGC), with TUA4 chromosomal DNA as a template; digested with BamHI and SphI; and then cloned into the BamHI-SphI sites of p3HA-ACT1 (29) and pGFP-MET3 to generate p3HA-BIG1 and pGFP-BIG1, respectively. The nucleotide sequences of the cloned fragments were confirmed.
Strain construction.
Gene disruption was performed using a method similar to that described by Hanaoka et al. (13). Briefly, two fragments, disBIG1-A and disBIG1-B, were amplified with primers disBIG1-1 (5'-ACATGGTGAATCAGTATGAGCACC) and disBIG1-2 (5'-GTCGTGACTGGGAAAACCCTGGCGATCTCAAGAAACGAACTTTTGAGC) and disBIG1-3 (5'-CCTGTGTGAAATTGTTATCCGCTCCAAAATATAGTGATGGGTCCAAAC) and disBIG1-4 (5'-TCAAATTGTGTTGACAGTGGGACC), respectively, and used as flanking homology regions for a gene disruption cassette. The PCR-amplified disruption cassette containing an hph200-URA3-hph200 or ARG4 marker was transformed into the TUA4 arg4 ura3 strain. Finally, both alleles of the CaBIG1 locus were replaced with hph200 and ARG4, yielding strain BIG103. For a complementation test, the empty vector p3HA-ACT1 or the plasmid p3HA-ACT1-BIG1 was introduced into BIG103, yielding strain BIG104 or BIG105, respectively.
To obtain a strain in which CaBig1p is tagged at the C terminus with a triple repeat of the HA tag, we used p3HA-ACT1 (29) as a template for PCR-mediated transformation. A DNA cassette for integration was amplified using the primers iBIG1-5' (5'-AAGATCATTTCCTTCTTCAATTACTTGAAACAAAAAATAATACAAAAGAAACAACAAAAATCGAAGCGAGGTATTATTGCTGACGATAAGAAATTAGATTGCAGGCTCGAGGGTGCATGC) and iBIG1-3' (5'-TAGCAAAAACTAGTTATAGAAAGTGTATATAAACATGAGTATGAATTTTTCTTAAAACATTCTAACAAAAAGCATTGCCAAACAACATTATTCTCTGAGCGGATAACAATTTCACACAGG) and introduced into TUA4. After selection on SD-URA plates, nucleotide sequencing confirmed that the colony PCR-amplified DNAs encoding the corresponding proteins were tagged correctly.
Quantification of cell wall component.
Alkali-insoluble ß-glucan levels were determined as described previously (16). Cells were cultured in 500-ml flasks containing 100 ml YPD plus 0.6 M sorbitol (for S. cerevisiae) or YPD with or without 10% serum (for C. albicans), harvested by centrifugation, and washed. The cells were broken with glass beads on ice, and the cell wall fraction was obtained by centrifugation at 2,600 x g for 15 min. Alkali-insoluble ß-glucans were extracted three times in 3% (wt/vol) NaOH at 75°C for 1 h. The pellet was washed three times, resuspended in 0.01 M Tris-HCl (pH 7.5) containing ß-1,3-glucanase (Zymolyase 100T, 1.0 mg/ml), and incubated overnight at 37°C. After dialysis, the ß-1,6-glucan was obtained. The total alkali-insoluble glucan level was measured as the hexose content before dialysis. The alkali-insoluble ß-1,3-glucan level was calculated by subtraction of the ß-1,6-glucan content from the total glucan content. Chitin was quantified as described previously (8), except that we used ß-glucuronidase instead of cytohelicase.
Preparation of total cell lysates and solubility test of CaBig1p protein.
Cells were collected and disrupted with glass beads in NP-40 buffer (10 mM Tris-HCl [pH 8], 1 mM EDTA, 150 mM NaCl, 10% glycerol, 1% NP-40) by use of a bead shocker (Yasui Kikai, Japan). After centrifugation at 10,000 x g for 10 min, the supernatant was extracted for Western analysis. To demonstrate membrane association, aliquots of total cell lysate extracted with lysis buffer (50 mM Tris-HCl [pH 8], complete protease inhibitor cocktail [Roche]) were separately treated with 0.6 M NaCl, 0.1 M Na2CO3, 1.6 M urea, or 0.5% Triton X-100 at 4°C for 30 min and subsequently centrifuged at 30,000 x g at 4°C for 30 min. The supernatant was withdrawn and the pellets were resuspended in a volume of lysis buffer equal to that of the supernatant.
Adherence assay.
The adherence assay was conducted fundamentally as previously described (3). Briefly, C. albicans cells from an overnight culture in YPD medium at 30°C were washed and diluted in Dulbecco's modified Eagle's medium containing 10% calf serum. A suspension containing 105 CFU/ml was then preincubated for 1 h at 37°C. HeLa cells were grown to confluence in Dulbecco's modified Eagle's medium containing 10% calf serum at 37°C (5% CO2) in 96-well culture plates. They were then washed once with 1x PBS buffer (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4; pH 7.4), and then 100 µl of the Candida cell suspension was added. After incubation at 37°C for 30 min, the nonadherent Candida cells were washed away three times with PBS. The adherent Candida cells were released by lysing the HeLa cells with sterile water. The recovered Candida cells were plated onto YPD. After incubation at 30°C for 24 h, the number of CFU was determined.
Animal study.
For each group, five male CD-1 (ICR) mice of 4 weeks of age (Charles River, Japan) weighing approximately 21 to 25 g were inoculated with 106 CFU by intravenous injection. Survival curves were calculated using the Kaplan-Meier method and then compared by use of the log rank test. A P value of less than 0.05 was considered significant. To quantify the colony-forming C. albicans units in the kidneys, three mice were euthanized by CO2 5 days after injection, after which the organs were homogenized and plated onto an SD-AU medium for colony counting. For histopathological examination of the kidney, the kidneys were fixed in 10% phosphate-buffered formalin, embedded, sectioned, and stained with periodic acid-Schiff (PAS) stain.
 |
RESULTS
|
|---|
C. albicans BIG1 encodes a functional homolog of S. cerevisiae Big1p.
A C. albicans CaBIG1 homolog (CaO19.2334 and CaO19.9870) encodes a protein of 322 amino acids, showing 29% identity to its S. cerevisiae counterpart (2). In this paper, we prefix a gene name with "Sc" or "Ca" to avoid confusing S. cerevisiae and C. albicans genes. In order to determine whether C. albicans CaBig1p is a functional homolog of S. cerevisiae ScBig1p, S. cerevisiae Scbig1
cells were transformed with plasmid pYES2.0-CaBIG1 containing the C. albicans CaBIG1 gene under control of the GAL1 promoter. The Scbig1
mutant has a growth defect and requires osmotic support (2). Figure 1A
shows that C. albicans CaBIG1 complemented the growth deficiency of S. cerevisiae Scbig1 mutants on YNB agar plates. We then analyzed the cell wall composition and found that C. albicans CaBIG1 increased the ß-1,6-glucan content of the S. cerevisiae Scbig1
cells (Fig. 1B). There was a significant difference between Scbig1
harboring the pYES2.0 empty vector and that harboring pYES2.0-CaBIG1, with a P value of <0.005, whereas CaBIG1 did not restore the reduced content of ß-1,6-glucan as much as ScBIG1 did. These results suggest some functional conservation between the Big1p homologs of C. albicans and S. cerevisiae.
Constitutive expression and localization of CaBig1p.
To determine whether CaBig1p is posttranslationally modified like N glycosylation of ScBig1p and whether CaBig1p expression alters during the cell cycle or in response to hyphal induction, CaBig1p was tagged with three tandem repeats of HA at the C terminus, and protein samples were prepared from yeast or hyphal cells for Western blot analysis. Yeast cells were cultured in YPD, pH 5.6, at 30°C with or without a cell cycle toxin such as hydroxyurea or nocodazole. Hyphal growth was induced in YPD, pH 7.2, containing 10% serum or Spider medium at 37°C. There was no significant difference in signal strengths or mobilities in sodium dodecyl sulfate-polyacrylamide gel electrophoresis assays between the conditions (Fig. 2A).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2. CaBig1p localized in the ER and plasma membrane of C. albicans yeast cells. (A) Western blotting for the detection of CaBig1p-3xHA. TUA4 cells expressing CaBig1p tagged with three tandem repeats of HA (CaBig1p-3xHA) from its native promoter were used. Each lane was processed using a total cell extract with the following culture conditions: AS, asynchronous cells cultured for three hours at 30°C; -Glc, unbudded cells collected by YNB medium (without glucose); HU, synchronized cells with 0.1 M hydroxyurea; NOC, synchronized cells with 20 µg/ml nocodazole; Ser, hyphal cells cultured in YPD containing 10% serum for 1 or 3 hours as indicated; Spi, hyphal cells cultured in Spider medium for 1 or 3 hours as indicated. Western blotting using anti-PSTAIRE antibody was performed as a loading control. (B) Fluorescence microscopy for the detection of CaBig1p-GFP. TUA4 cells expressing GFP-tagged CaBig1p were grown overnight at 30°C, inoculated into fresh YPD (pH 5.6) medium, fixed in 3% formaldehyde, and viewed under a fluorescence microscope and differential interference contrast (DIC) optics. DAPI (4',6'-diamidino-2-phenylindole)-stained cells, CaBig1p-GFP, and differential interference contrast images are shown. Bar, 5 µm. (C) Solubility test of CaBig1p-3xHA. Cell lysate from yeast or hyphal forms of the wild-type TUA6 (lane 1) or wild-type cells expressing CaBig1p-3xHA was left untreated (lanes 2 and 3) or was treated with NaCl (lanes 4 and 5), Na2CO3 (lanes 6 and 7), urea (lanes 8 and 9), or Triton X-100 (lanes 10 and 11) and subsequently centrifuged and separated into pellet (P) and supernatant (S) fractions.
|
|
To examine CaBig1p localization in Candida cells, a fragment encoding the GFP was fused in frame to the 3' end of CaBIG1. The fusion construct was placed under control of the MET3 promoter in pGFP-MET3 plasmid containing RP10/URA3. Yeast cells containing CaBig1p-GFP showed ring-like GFP fluorescence surrounding the nucleus, which implies localization in the ER membrane, and dot-like fluorescence in the plasma membrane (Fig. 2B), while the wild-type cells, which contain no GFP fusion protein, showed almost no fluorescent signals under the same circumstances of fluorescence, as in the case of CaBig1p-GFP (data not shown). However, CaBig1p-GFP was not localized in specific areas of the hyphal cells under our laboratory conditions (data not shown). Thus, these results suggested that CaBig1p is associated with the ER and plasma membrane in a manner similar to that of its homolog in S. cerevisiae (2).
In cell fractionation experiments, we further examined whether CaBig1p is localized in cellular membranes. Cell lysates of CaBig1p-3xHA-expressing cells were treated with different agents that solubilize peripheral membrane proteins (12). As shown in Fig. 2C, 1% Triton X-100 solubilized CaBig1p partially from the pellet fraction (lanes 10 and 11), while neither NaCl, urea, nor Na2CO3 did (lanes 2 to 9), suggesting that CaBig1p is an integral membrane protein. Along with the GFP data, these results indicate that CaBig1p was localized in the ER membranes and/or plasma membranes of the C. albicans yeast cells.
Cell wall component of C. albicans cells lacking CaBig1p.
To study the relationship of the cell wall component and CaBIG1, we constructed strain BIG103, which lacked both alleles of the CaBIG1 locus, by PCR-based gene disruption (13). Strain BIG103 was transformed with the empty p3HA-ACT1 vector to generate BIG104. A reconstituted strain, BIG105, was obtained by the introduction of p3HA-BIG1 into a Cabig1
null mutant. Both the null mutant BIG104 and the reconstituted strain BIG105 have a single copy of URA3 at the RP10 locus. The amounts of whole-cell alkali-soluble ß-1,6-glucan in the wild-type, Cabig1
, and reconstituted strains were compared by measuring alkali-insoluble ß-glucan treated or untreated with the ß-1,3-glucan digestive enzyme, zymolyase 100T. As shown in Fig. 3A, alkali-insoluble ß-1,6-glucan in C. albicans Cabig1
cells was almost undetectable and was restored to its normal level in the reconstituted strain, suggesting that CaBIG1 is required for ß-1,6-glucan biosynthesis. Moreover, an increased level of chitin seen in the Cabig1
mutant (Fig. 3B) implies that this increase may compensate for the defect in ß-1,6-glucan biosynthesis. In contrast, no distinguishable difference in ß-1,3-glucan levels was observed for the parent, the Cabig1
strain, and the revertant (Fig. 3A), unlike what was seen for S. cerevisiae Scbig1
, which showed a significant increase in the level of ß-1,3-glucan (2). Thus, the deletion of the CaBIG1 gene significantly affected ß-1,6-glucan biosynthesis.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3. Repression of ß-1,6-glucan biosynthesis in Cabig1 mutants. Alkali-insoluble ß-1,6-glucans (closed bars) and ß-1,3-glucans (open bars) (A) and chitin (B) were measured. Cells, including wild-type (TUA6), Cabig1 (BIG104), and reconstituted (BIG105) strains, were grown for 4 h at 30°C in YPD, pH 5.6 (YPD) or at 37°C in YPD, pH 7.2, containing 10% serum (Ser). The data shown represent the results of at least three experiments. Error bars represent standard deviations.
|
|
C. albicans CaBig1p is required for yeast morphology.
The ability to generate a viable Cabig1/Cabig1 null mutant strain indicates that CaBIG1 is not an essential gene in C. albicans. Deletion of the S. cerevisiae ScBIG1 gene is lethal, but the gene was partially restored by adding sorbitol to the medium as osmotic support (2). Unlike what was seen for the S. cerevisiae Scbig1 mutant, growth of the wild-type, Cabig1
, and reconstituted strains showed no difference in doubling time in YPD medium (data not shown).
Disruption of the C. albicans BIG1 gene generated a slightly abnormal cell shape. When vegetatively grown in liquid YPD medium, null mutant cells were slightly elongated or distorted and tended to aggregate (Fig. 4). A large aggregate of Cabig1
cells could be easily separated into chains of two to eight cells by vigorous pipetting, indicating that the aggregation was caused not only by cell-to-cell attachment but also by a partial cytokinesis defect. However, more than 80% of cells in stationary phase, obtained by overnight culture in YPD medium at 30°C, showed budded or unbudded single cells (data not shown). Unlike C. albicans cells lacking the CaKRE5 gene (14), which reduces the levels of ß-1,6-glucan synthesis and shows aberrant shape, the average sizes of the cells and vacuoles of the Cabig1 disruptant were the same as were those of the wild type.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 4. Morphology of C. albicans strains in liquid medium. Cells, including wild-type (TUA6), Cabig1 (BIG104), and reconstituted (BIG105) strains, were grown for 4 h under the conditions indicated above. Bar, 10 µm.
|
|
C. albicans CaBig1p is required for hyphal morphogenesis.
C. albicans cells lacking CaKre5p (14) or CaKre9p (18), both of which are involved in ß-1,6-glucan synthesis, showed deficient filamentation. In order to examine whether the absence of C. albicans CaBig1p affected hyphal morphogenesis in C. albicans, we investigated hyphal morphogenesis of the wild-type, Cabig1
/Cabig1
, and reconstituted strains under several conditions on both solid and liquid media. Initially, we investigated possible roles of CaBIG1 in hyphal growth in liquid media. We found that unlike the C. albicans Cakre5
/Cakre5
or Cakre9
/Cakre9
mutant, the Cabig1
homozygous mutant underwent hyphal transition at 37°C in liquid YPD plus 10% calf serum, but its hyphal cells tended to be slightly distorted compared to those of the wild-type or reconstituted strain (Fig. 4). In addition, the Cabig1
cells grown at 37°C in liquid Spider medium showed a pseudohyphal cell shape. The defects in filamentation were partially restored by the addition of 1.25% N-acetylglucosamine to the medium, as in Cakre5
cells (14), and also by the addition of 0.6 M sorbitol as an osmotic support (data not shown).
Next, we investigated the effects of CaBIG1 deletion on solid agar medium. Cells were grown overnight at 30°C in YPD liquid medium, and 106 cells were spotted on Spider agar medium or agar plus 10% serum medium. The homozygous Cabig1
/Cabig1
mutant did not form lateral hyphae at 30°C on Spider medium and formed only short filamentation at 37°C on serum agar medium. The addition of 1.25% N-acetylglucosamine to the Spider medium slightly restored the deficiency in filamentation (Fig. 5), as in the liquid medium, but had no effect on serum agar (data not shown). Combining these results demonstrated that the deletion of C. albicans CaBIG1 reduced the ability to elongate hyphal cells, but the ability to undergo yeast-to-hyphae transition remained.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 5. Morphology of C. albicans strains on solid agar medium. Cells, including wild-type (TUA6), Cabig1 (BIG104), and reconstituted (BIG105) strains, were grown overnight at 30°C. Then, 106 cells were spotted onto the indicated agar plate and grown for 7 days at 30°C on Spider medium and at 37°C on agar medium containing 10% serum. Photographs of the colony edge were taken by phase-contrast microscopy at x20 magnification.
|
|
Cabig1
produces a chlamydospore at the tip of short hyphae.
The chlamydospore is a distinctive morphological feature of the fungal pathogen C. albicans. In order to examine the association between ß-1,6-glucan biosynthesis and chlamydospore formation, cornmeal agar was used to compare the phenotypes of the wild-type, Cabig1
mutant, and reconstituted strains. The Cabig1
mutant apparently formed chlamydospores accompanied by short hyphae close to the edge of the colony, whereas the wild-type and reconstituted strains formed normal chlamydospores at the end of long hyphae (Fig. 6).

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 6. Phenotypes of the wild-type (TUA6), Cabig1 (BIG104), and reconstituted (BIG105) strains grown in cornmeal agar under glass coverslips for 7 days at 25°C in the dark. The chlamydospores, several of which are indicated by arrows, are the large round refractile cells at the end of the hyphae. Magnification, x10.
|
|
Deletion of CaBIG1 in C. albicans reduces adherence to HeLa cells.
Herrero et al. (14) demonstrated that the ability of the CaKRE5 mutant to adhere to epithelial cells was reduced. To study the CaBIG1 gene in relation to adherence, we examined the abilities of the wild-type, the disruptant, and the reconstituted strains to adhere to a monolayer of human HeLa cells. Cells were cultured overnight in YPD medium at 30°C; this showed that more than 80% in culture were single cells. Yeast cells (105 CFU/ml) were preincubated in 10% serum for 1 h at 37°C, resulting in short hyphae, and then were placed on a HeLa monolayer for 1 h. Adherence was determined by comparison with the CFU counts of the wild-type TUA6 cells attached to a monolayer of HeLa cells. The adherences of the disruptant BIG104 and the reconstructed strain BIG105 were 45.7% ± 4.7% and 93.5% ± 9.8% (mean ± standard deviation), respectively, with a P value of <0.005 compared to that of the wild type.
CaBIG1 is required for virulence.
Using the mouse systemic candidiasis model, we found that 80% of the mice infected with 106 CFU cells of Cabig1
remained alive 40 days postinfection, whereas the same inoculum of the wild-type or of the reconstructed strain killed all infected mice within 20 days (Fig. 7A). To determine whether the reduced virulence of the Cabig1
mutant against the mouse model infection correlated with reduced levels of tissue infection, we determined the fungal burden on the kidneys. The number of Candida cells colonized in the kidneys of mice infected with the Cabig1
mutant was 1 order of magnitude below that of those infected with the wild-type strain or with the CaBIG1 revertant (Fig. 7B). To investigate the morphology of the Cabig1
cells in the kidney of systemically infected mice, mice injected via tail vein with 106 cells were killed after 2 days, and the kidneys were removed for histopathological examination. PAS-stained kidney sections showed that the Cabig1
mutant did not form hyphae in the infected lesion, whereas distinguishable hyphae penetrating into tissue formed in the wild-type and reconstituted strains (Fig. 8), demonstrating that CaBig1p is required for filamentation in mice. These results show that CaBIG1 is required for C. albicans virulence and support the concept that hyphal morphogenesis and adherence are important for the pathogenesis of this organism.

View larger version (84K):
[in this window]
[in a new window]
|
FIG. 8. Histopathological analysis of the kidneys of C. albicans-infected mice. The kidneys of the infected mice were removed at day 2 postinfection, fixed, sectioned, and PAS stained. Bar, 20 µm.
|
|
 |
DISCUSSION
|
|---|
We have characterized a C. albicans gene that is the sole homolog of the BIG1 gene of S. cerevisiae. A homozygous Cabig1
gene disruptant was constructed by combining a PCR-amplified deletion cassette with a split Ura-blaster technique and analyzed with respect to cell wall composition, morphology, adherence, and virulence. The amino acid sequence identity between ScBig1p and CaBig1p is 29% (2), and the growth defect of the Scbig1
mutant was partially complemented by the expression of the CaBIG1 gene, indicating that CaBig1p is a functional homolog of ScBig1p. However, the effect caused by deletion of the CaBIG1 gene differs substantially from that of ScBIG1. A major phenotypic difference is growth rate. S. cerevisiae big1 disruptants failed to grow, whereas addition of an osmotic reagent, such as sorbitol, slightly restored growth (2). In contrast, Cabig1
cells grew normally, like the wild-type cells, indicating that CaBIG1 is not essential for C. albicans vegetative growth. In addition, the growth rate of the S. cerevisiae ScKRE5 deletion mutant is much slower than that of the C. albicans Cakre5
mutant; Kre5p is considered a glucosyltransferase that is involved in the initiation of ß-1,6-glucan synthesis (14). The differences in the roles of these gene products between S. cerevisiae and C. albicans might be derived from the characteristic that the cell wall composition in C. albicans is different from that in S. cerevisiae (14, 23).
The protein functions of C. albicans CaBig1p and of ScBig1p in S. cerevisiae remain unknown. Since deletion of the BIG1 gene in both organisms leads to a defect in ß-1,6-glucan biosynthesis, Big1p must be involved either directly or indirectly in cell wall biogenesis. What is the function of the Big1p protein molecule? As no homologs other than those in a family of budding yeast have thus far been identified, the function of Big1p could not be deduced from the similarity to other known proteins. Both CaBig1p and ScBig1p localize to the ER integral membrane, while most other known factors that affect ß-1,6-glucan synthesis have been localized along the protein secretory pathway (28). Based on these facts, multiple events within the ER-Golgi apparatus are thought to be required for the proper biosynthesis of the ß-1,6-glucan polymer. Taken together, these results indicate that Big1p might play a role as an enzyme that catalyzes the addition or modification of the sugar chain or as an adaptor protein that captures such enzymes. At present, we consider CaBig1p to be an adaptor protein rather than a functional enzyme because neither CaBig1p nor ScBig1p contains any amino acid motifs associated with carbohydrate-active enzymes. Using a tandem affinity purification technique, we are currently investigating whether CaBig1p and ScBig1p have binding partner proteins (15).
The results presented here revealed that CaBig1p is required for ß-1,6-glucan biosynthesis and filamentation in C. albicans. Four C. albicans genes, CaSKN1 (23), CaKRE5 (14), CaKRE6 (23), and CaKRE9 (18), have been identified based on their homology with S. cerevisiae ß-1,6-glucosylation, and their functions have been elucidated by null mutant analysis. The homozygous CaKRE9 and CaKRE5 deletion mutants and the heterozygous CaKRE6 deletion mutant showed 0, 20, and 60% reductions of the level of ß-1,6-glucan synthesis, respectively. Although the Cakre6
mutant, which has no severe reduction in ß-1,6-glucosylation, shows no significant difference in morphology, no filamentation was observed in the Cakre5
and Cakre9
gene disruptants. Likewise, our studies demonstrated that only a small amount of ß-1,6-glucan was detected in Cabig1
. However, the observation of Cabig1
mutant morphology was slightly different from that of the Cakre5
or Cakre9
mutant morphology. Under all conditions tested, no germ tube formation was observed in the Cakre5
or Cakre9
mutant, whereas the ability to form germ tubes partially remained in serum medium in the Cabig1
mutant. Thus, the Cabig1
mutant did not affect filamentation as severely as the other mutants did, despite the low level of ß-1,6-glucan synthesis. Perhaps CaKre5p and CaKre9p may be functionally epistatic to CaBig1p. Thereby, the function of CaBig1p might be restricted to ß-1,6-glucan synthesis. CaKre5p might be involved in protein sorting via glucosylation, as are other functions besides cell wall biogenesis. The reason for this might be that the Cakre5
cells showed large-vacuole morphology, probably because of the accumulation of polypeptides that failed to acquire a mature conformation and are degraded in this organelle (14).
Why did the ß-1,6-glucosylation-defective cells fail to form hyphae? We propose two answers to this question. First, ß-1,6-glucan synthesis itself is indispensable for hyphal morphogenesis but not for yeast growth. The apical growth of hyphae requires rapid reshaping and expansion of the cell wall at the apical tip. Second, proteins including CaKre5p or CaBig1p play a pivotal role in directing proteins which are required for hyphal formation and/or ß-1,6-glucan synthesis to the site where the cell wall is actively assembled. The possibility remains that CaBig1p catalyzes ß-1,6-glucosylation directly.
Deletion of CaBIG1 leads to reduced pathogenicity in a mouse model of systemic infection. The attenuated virulence of Cabig1
can be accounted for by two major in vivo properties: the inability to change shape to the filamentous form in the kidney and the reduced fungal burden. Loss of morphological transition of Cabig1
in the kidneys of infected mice, shown by histological observation, is consistent with the phenotype of the disruptant either on a solid medium or in a liquid medium inducing filamentation. The decreased number of C. albicans Cabig1
cells colonized in the kidney is supported by the adhesion experiment, in which the ability of the Cabig1
cells to adhere to HeLa cells is less than half that of the wild type. The CaKRE5 deletion mutant also showed similar virulence properties (14). Although there are only two reports, including our study, that indicate that a defect in ß-1,6-glucan synthesis leads to avirulence, animal studies with other C. albicans mutants involved in ß-1,6-glucan synthesis should explore all that is known about pathogenicity-associated cell wall biogenesis.
To conclude, the deletion of CaBIG1 in C. albicans leads to a decreased amount of ß-1,6-glucan in the cell wall composition, thereby resulting in defects in filamentation, adhesion, and pathogenicity. Since no other sequences similar to Big1p have been identified in vertebrate animals so far, the ß-1,6-glucan synthetic pathway, including Big1p, could be a good target for the development of novel antifungal drugs.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Yuki Utena-Abe for technical assistance in DNA analysis. We thank Keiko Ishino for technical advice for the adherence experiment. We thank the other members of our laboratory.
A. Kaneko is supported by the Cooperative System for Supporting Priority Research, Japan Science and Technology Corporation (JST). This work was supported in part by grants KH53315 and SH24405 from the Japan Health Sciences Foundation. This work was supported by the Health Science Research Grants for Research on Emerging and Re-emerging Infectious Diseases of the Ministry of Health, Labor and Welfare of Japan.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Laboratory of Mycology, Department of Bioactive Molecules, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, Tokyo 162-8640, Japan. Phone: 81 3 5285-1111. Fax: 81 3 5285-1272. E-mail: niimi{at}nih.go.jp. 
Editor: A. Casadevall
 |
REFERENCES
|
|---|
| 1. | Al-Aidroos, K., and H. Bussey. 1978. Chromosomal mutants of Saccharomyces cerevisiae affecting the cell wall binding site for killer factor. Can. J. Microbiol. 24:228-237.[Medline] |
| 2. | Azuma, M., J. N. Levinson, N. Page, and H. Bussey. 2002. Saccharomyces cerevisiae Big1p, a putative endoplasmic reticulum membrane protein required for normal levels of cell wall beta-1,6-glucan. Yeast 19:783-793.[CrossRef][Medline] |
| 3. | Bektic, J., C. P. Lell, A. Fuchs, H. Stoiber, C. Speth, C. Lass-Florl, M. Borg-von Zepelin, M. P. Dierich, and R. Wurzner. 2001. HIV protease inhibitors attenuate adherence of Candida albicans to epithelial cells in vitro. FEMS Immunol. Med. Microbiol. 31:65-71.[CrossRef][Medline] |
| 4. | Bickle, M., P. A. Delley, A. Schmidt, and M. N. Hall. 1998. Cell wall integrity modulates RHO1 activity via the exchange factor ROM2. EMBO J. 17:2235-2245.[CrossRef][Medline] |
| 5. | Boone, C., S. S. Sommer, A. Hensel, and H. Bussey. 1990. Yeast KRE genes provide evidence for a pathway of cell wall beta-glucan assembly. J. Cell Biol. 110:1833-1843.[Abstract/Free Full Text] |
| 6. | Brachmann, C. B., A. Davies, G. J. Cost, E. Caputo, J. Li, P. Hieter, and J. D. Boeke. 1998. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14:115-132.[CrossRef][Medline] |
| 7. | Brown, J. L., Z. Kossaczka, B. Jiang, and H. Bussey. 1993. A mutational analysis of killer toxin resistance in Saccharomyces cerevisiae identifies new genes involved in cell wall (1->6)-beta-glucan synthesis. Genetics 133:837-849.[Abstract] |
| 8. | Bulawa, C. E., M. Slater, E. Cabib, J. Au-Young, A. Sburlati, W. L. Adair, Jr., and P. W. Robbins. 1986. The S. cerevisiae structural gene for chitin synthase is not required for chitin synthesis in vivo. Cell 46:213-225.[CrossRef][Medline] |
| 9. | Calderone, R. A. 2002. Candida and candidiasis. American Society for Microbiology, Washington, D.C. |
| 10. | Chaffin, W. L., J. L. Lopez-Ribot, M. Casanova, D. Gozalbo, and J. P. Martinez. 1998. Cell wall and secreted proteins of Candida albicans: identification, function, and expression. Microbiol. Mol. Biol. Rev. 62:130-180.[Abstract/Free Full Text] |
| 11. | Fonzi, W. A., and M. Y. Irwin. 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717-728.[Abstract] |
| 12. | Fujiki, Y., S. Fowler, H. Shio, A. L. Hubbard, and P. B. Lazarow. 1982. Polypeptide and phospholipid composition of the membrane of rat liver peroxisomes: comparison with endoplasmic reticulum and mitochondrial membranes. J. Cell Biol. 93:103-110.[Abstract/Free Full Text] |
| 13. | Hanaoka, N., T. Umeyama, K. Ueno, K. Ueda, T. Beppu, H. Fugo, Y. Uehara, and M. Niimi. 2005. A putative dual-specific protein phosphatase encoded by YVH1 controls growth, filamentation and virulence in Candida albicans. Microbiology 151:2223-2232.[Abstract/Free Full Text] |
| 14. | Herrero, A. B., P. Magnelli, M. K. Mansour, S. M. Levitz, H. Bussey, and C. Abeijon. 2004. KRE5 gene null mutant strains of Candida albicans are avirulent and have altered cell wall composition and hypha formation properties. Eukaryot. Cell 3:1423-1432.[Abstract/Free Full Text] |
| 15. | Kaneko, A., T. Umeyama, N. Hanaoka, B. C. Monk, Y. Uehara, and M. Niimi. 2004. Tandem affinity purification of the Candida albicans septin protein complex. Yeast 21:1025-1033.[CrossRef][Medline] |
| 16. | Kapteyn, J. C., P. Van Egmond, E. Sievi, H. Van Den Ende, M. Makarow, and F. M. Klis. 1999. The contribution of the O-glycosylated protein Pir2p/Hsp150 to the construction of the yeast cell wall in wild-type cells and beta 1,6-glucan-deficient mutants. Mol. Microbiol. 31:1835-1844.[CrossRef][Medline] |
| 17. | Klis, F. M., P. Mol, K. Hellingwerf, and S. Brul. 2002. Dynamics of cell wall structure in Saccharomyces cerevisiae. FEMS Microbiol. Rev. 26:239-256.[CrossRef][Medline] |
| 18. | Lussier, M., A. M. Sdicu, S. Shahinian, and H. Bussey. 1998. The Candida albicans KRE9 gene is required for cell wall beta-1,6-glucan synthesis and is essential for growth on glucose. Proc. Natl. Acad. Sci. USA 95:9825-9830.[Abstract/Free Full Text] |
| 19. | Machi, K., M. Azuma, K. Igarashi, T. Matsumoto, H. Fukuda, A. Kondo, and H. Ooshima. 2004. Rot1p of Saccharomyces cerevisiae is a putative membrane protein required for normal levels of the cell wall 1,6-beta-glucan. Microbiology 150:3163-3173.[Abstract/Free Full Text] |
| 20. | Martin, S. W., L. M. Douglas, and J. B. Konopka. 2005. Cell cycle dynamics and quorum sensing in Candida albicans chlamydospores are distinct from budding and hyphal growth. Eukaryot. Cell 4:1191-1202.[Abstract/Free Full Text] |
| 21. | Masuoka, J. 2004. Surface glycans of Candida albicans and other pathogenic fungi: physiological roles, clinical uses, and experimental challenges. Clin. Microbiol. Rev. 17:281-310.[Abstract/Free Full Text] |
| 22. | Meaden, P., K. Hill, J. Wagner, D. Slipetz, S. S. Sommer, and H. Bussey. 1990. The yeast KRE5 gene encodes a probable endoplasmic reticulum protein required for (1-6)-beta-D-glucan synthesis and normal cell growth. Mol. Cell. Biol. 10:3013-3019.[Abstract/Free Full Text] |
| 23. | Mio, T., T. Yamada-Okabe, T. Yabe, T. Nakajima, M. Arisawa, and H. Yamada-Okabe. 1997. Isolation of the Candida albicans homologs of Saccharomyces cerevisiae KRE6 and SKN1: expression and physiological function. J. Bacteriol. 179:2363-2372.[Abstract/Free Full Text] |
| 24. | Odds, F. C. 1988. Candida and candidosis, 2nd ed. Bailliere Tindall, London, United Kingdom. |
| 25. | Odds, F. C. 1994. Pathogenesis of Candida infections. J. Am. Acad. Dermatol. 31:S2-S5.[Medline] |
| 26. | Page, N., M. Gerard-Vincent, P. Menard, M. Beaulieu, M. Azuma, G. J. Dijkgraaf, H. Li, J. Marcoux, T. Nguyen, T. Dowse, A. M. Sdicu, and H. Bussey. 2003. A Saccharomyces cerevisiae genome-wide mutant screen for altered sensitivity to K1 killer toxin. Genetics 163:875-894.[Abstract/Free Full Text] |
| 27. | Sambrook, J., and D. W. Russell. 2001. Molecular cloning, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 28. | Shahinian, S., and H. Bussey. 2000. ß-1,6-Glucan synthesis in Saccharomyces cerevisiae. Mol. Microbiol. 35:477-489.[CrossRef][Medline] |
| 29. | Umeyama, T., A. Kaneko, Y. Nagai, N. Hanaoka, K. Tanabe, Y. Takano, M. Niimi, and Y. Uehara. 2005. Candida albicans protein kinase CaHsl1p regulates cell elongation and virulence. Mol. Microbiol. 55:381-395.[CrossRef][Medline] |
| 30. | Umeyama, T., Y. Nagai, M. Niimi, and Y. Uehara. 2002. Construction of FLAG tagging vectors for Candida albicans. Yeast 19:611-618.[CrossRef][Medline] |
| 31. | Winzeler, E. A., D. D. Shoemaker, A. Astromoff, H. Liang, K. Anderson, B. Andre, R. Bangham, R. Benito, J. D. Boeke, H. Bussey, A. M. Chu, C. Connelly, K. Davis, F. Dietrich, S. W. Dow, M. El Bakkoury, F. Foury, S. H. Friend, E. Gentalen, G. Giaever, J. H. Hegemann, T. Jones, M. Laub, H. Liao, N. Liebundguth, D. J. Lockhart, A. Lucau-Danila, M. Lussier, N. M'Rabet, P. Menard, M. Mittmann, C. Pai, C. Rebischung, J. L. Revuelta, L. Riles, C. J. Roberts, P. Ross-MacDonald, B. Scherens, M. Snyder, S. Sookhai-Mahadeo, R. K. Storms, S. Veronneau, M. Voet, G. Volckaert, T. R. Ward, R. Wysocki, G. S. Yen, K. Yu, K. Zimmermann, P. Philippsen, M. Johnston, and R. W. Davis. 1999. Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285:901-906.[Abstract/Free Full Text] |
| 32. | Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119.[CrossRef][Medline] |
Infection and Immunity, April 2006, p. 2373-2381, Vol. 74, No. 4
0019-9567/06/$08.00+0 doi:10.1128/IAI.74.4.2373-2381.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Nakamata, K., Kurita, T., Bhuiyan, M. S. A., Sato, K., Noda, Y., Yoda, K.
(2007). KEG1/YFR042w Encodes a Novel Kre6-binding Endoplasmic Reticulum Membrane Protein Responsible for beta-1,6-Glucan Synthesis in Saccharomyces cerevisiae. J. Biol. Chem.
282: 34315-34324
[Abstract]
[Full Text]
-
Stevens, D. A., Ichinomiya, M., Koshi, Y., Horiuchi, H.
(2006). Escape of Candida from Caspofungin Inhibition at Concentrations above the MIC (Paradoxical Effect) Accomplished by Increased Cell Wall Chitin; Evidence for {beta}-1,6-Glucan Synthesis Inhibition by Caspofungin.. Antimicrob. Agents Chemother.
50: 3160-3161
[Abstract]
[Full Text]