Previous Article | Next Article ![]()
Infection and Immunity, June 2006, p. 3387-3395, Vol. 74, No. 6
0019-9567/06/$08.00+0 doi:10.1128/IAI.01985-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Lorraine Walls,1 and
Joshua Fierer1,2*
VA Healthcare System,1 Departments of Medicine and Pathology, University of California San Diego School of Medicine, San Diego, California2
Received 7 December 2005/ Returned for modification 26 January 2006/ Accepted 2 March 2006
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
100,000 new cases of coccidioidomycosis annually (1). The majority of Coccidioides infections in people produce either no symptoms or a self-limited pneumonia. One characteristic manifestation of primary infection is the syndrome of fever, arthralgias, and erythema nodosum known as Valley Fever, after the San Joaquin Valley in central California (18). People who spontaneously resolve their infections have positive skin tests (delayed hypersensitivity) with fungal antigens. A small percentage of infected patients do not recover spontaneously (53). Most patients who do not recover spontaneously develop extrapulmonary infections, and they usually have negative skin tests and high titers of antibodies, suggesting that they make primarily a Th2 immune response. In contrast, patients who recover spontaneously from the pulmonary infection make only low titers of antibody against the fungus and instead develop delayed-type hypersensitivity (48). Very little is known about what determines whether otherwise-healthy people will recover from infection or will develop progressive disseminated disease, but there is clearly a large genetic component, as Filipinos and African Americans are much more likely to develop disseminated coccidioidomycosis than Caucasians (15, 46, 60). In order to study the genetics of resistance to Coccidioides immitis in an experimental animal, we tested several strains of inbred mice for their susceptibility to the fungus; we discovered that DBA/2 mice are quite resistant to C. immitis when arthroconidia are injected intraperitoneally (i.p.), and C57BL/6 (B6), C57BL/10, and BALB/c mice are very susceptible to this infection (31). (Since both DBA/2 and BALB/c mice have the H-2d major histocompatibility complex [MHC] haplotype, the difference in resistance is not determined by the MHC.) Resistance to C. immitis is the dominant phenotype. Cox et al. showed that DBA/2 mice are more resistant than BALB/c mice to pulmonary infection with Coccidioides (7). By studying C57BL/6 x DBA/2 (BXD) recombinant inbred mice, we learned that resistance in mice is a multigenic trait (14). We also found that DBA/2 mice make less interleukin-10 (IL-10) in response to infection than do susceptible mouse strains, and in the BXD recombinant inbred lines the levels of IL-10 mRNA are directly proportional to the severity of infection measured as CFU of fungi in the lungs 14 days after i.p. infection (12). Most importantly, IL-10-deficient B10 and B6 mice are more resistant to C. immitis than the control parental strains, indicating that high levels of IL-10 are necessary for mediating susceptibility to coccidioidomycosis (12, 13). These results imply that high levels of IL-10 are not simply the result of excess antigen but are also responsible in part for inherited susceptibility to this infection in mice (13, 31). However, we have not established that high levels of IL-10 are sufficient to make mice susceptible to C. immitis. In this study we studied the effect of high levels of IL-10 on resistance to coccidioidomycosis by infecting genetically resistant mice that are transgenic for h.IL-10 under the control of an MHC II promoter (22). We confirmed that high levels of IL-10 are sufficient to make mice susceptible to coccidioidomycosis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
IL-10 (/) (32), DBA/2J, and BALB/cJ mice were purchased from Jackson Laboratory (Bar Harbor, ME), and DBF1 mice were purchased from Simonsen Laboratories (Gilroy, CA). We infected only female mice, because male mice are more susceptible to this infection. BALB/c.h.IL-10 (human IL-10) transgenic mice were the gift of Amy Beebe at DNAX (22), and C57BL/6 m.IL-10 (mouse IL-10) transgenics were the gift of Mitchell Kronenberg at La Jolla Allergy and Immunology (24). The h.IL-10 gene is expressed in antigen-presenting cells under the control of the MHC class II EA promoter, and the B6 transgenic expresses IL-10 under the control of the IL-2 promoter. Because BALB/c and B6 are strains are susceptible but resistance to C. immitis is a dominant phenotype (31), we crossed female transgenic mice with male DBA/2 to make F1 transgenic mice and compared them to normal F1 mice. Infection. The RS strain was grown on Mycosel agar with gentamicin, and arthroconidia were harvested by scraping the saline-wetted mat when the culture was mature (58, 59). The mycelia were disrupted by shaking with glass beads. The suspension was passed over a nylon wool column to remove debris. This suspension was kept in saline at 4°C until it was used. An aliquot was cultured to be sure that viability was maintained before each experiment.
We infected mice in a safety hood in a biosafety level 3 laboratory, using a protocol that was approved by the local Biosafety Committee. For intranasal (i.n.) infections, the mice were anesthetized with ketamine (30 mg/ml) plus xylazine (4 mg/ml) given intramuscularly. Different strains of mice require different amounts of ketamine-xylazine to achieve adequate anesthesia. We waited until they did not withdraw from a paw squeeze before we placed 20 µl of a suspension of arthroconidia of the RS strain (59) into their nares. If they were not fully anesthetized after 5 min, we gave additional doses of the anesthetic every 5 min until they did not withdraw. Once the inoculum of approximately 100 arthroconidia was inspired, the unconscious mice were held vertically for about 15 seconds to promote aspiration of the fungus into the lungs. Mice were then kept warm on a heating pad until they were able to walk again. For the i.p. infection, we injected 500 to 1,000 arthroconidia in 0.2 ml of saline. Infected mice were housed five per cage in an isolator box (Germfree Laboratories, Miami, FL). Mice were sacrificed at the indicated times after infection, and their lungs and spleens were removed for quantitative cultures. A piece of the left lung was immediately frozen in liquid nitrogen to serve as a source of RNA. Tissues were ground under the safety hood and then serially diluted in saline before being plated on Mycosel agar as previously described (31). The plates were incubated at 24°C until there was visible growth and then colonies were counted.
mRNA. RNA was isolated from frozen lungs using Ultra Spec and reverse transcribed to cDNA with Superscript 2 (Invitrogen, San Diego, Calif.) as previously described (12). For competitive reverse transcription-PCR (RT-PCR), we pooled equal amounts of RNA from three mice/group that were chosen because they had CFU/lung values that were closest to the median values for the group. The amount of mRNA for several cytokines was measured semiquantitatively using competitive RT-PCR. We expressed the result as molecules of specific mRNA/microgram of total RNA, as we have previously described (10). IL-10 mRNA in transgenic mice was measured using real-time PCR on the ABI Prism 7000 detection system with primers that amplified both mouse and human IL-10 cDNA, because the h.IL-10 transgenic mice make both human and mouse IL-10 and both are functional in mice. The following primers were used: forward, TCTTTCAAACAAAGGACCAGCTG; reverse, AAGGCTTGGCAACCCAAGTA. The primers were 87% homologous with mouse and 95% homologous with human IL-10 cDNA and were able to amplify IL-10 cDNA from both human and mouse cells.
NO assays. Three mice were kept in a metabolic cage (Nalgene, Rochester, NY) for 24 h without food but with free access to water. We collected their pooled urine in a tube with gentamicin and ampicillin to prevent bacterial overgrowth and centrifuged the urine to remove debris. Urine samples were then filtered and frozen at 70°C until they were assayed. Each urine sample was diluted between 1:20 and 1:100, and total urinary nitrate excretion was measured using the Griess reaction after reduction of NO3 to NO2 with 1 M Tris, 0.02 mM NADPH, 5 mM glucose-6-phosphate, 10 U/ml of glucose-6-phosphate dehydrogenase, and 1 U/ml of Aspergillus nitrate reductase (Boehringer Mannheim) (20). To correct for the completeness of the collection and for catabolism, we measured urinary creatinine and expressed the ratio of urinary nitrates to urinary creatinine (3).
NOS2 inhibition. We used two inhibitors of inducible nitric oxide synthase (iNOS [NOS2]) (5). We dissolved the L-arginine analogue aminoguanidine (AMG; Sigma) in water to make a 1% (wt/vol) solution. The mice refused to drink the AMG solution, which has a bitter taste, and so we added 75% banana syrup (vol/vol) and 2% glucose to the solution. Control mice received the same solution without the AMG. N6(2-iminoethyl) L-lysine dihydrochloride (L-NIL; Alexis Biochemicals, San Diego, Calif.) at 3 mM was dissolved in drinking water. Treatment with the NOS inhibitors began 3 days before mice were infected and continued until the day of sacrifice. Urine was collected within 48 h after infection, well before animals were ill, and between days 13 and 15 after infection. At the later time point infected mice were drinking less and they had lower urine volumes.
Statistics. Colony counts were log transformed, and the geometric means were calculated. The differences between geometric mean colony counts in different groups of mice and other variables were compared using the unpaired t test and an analysis of variance (Graphpad Prism, San Diego, Calif.). We considered a P value of <0.05 to be significant.
| RESULTS |
|---|
|
|
|---|
|
|
|
2-fold, while the transgenic mice with the IL-10 gene under control of the MHC promoter had nearly a 15-fold increase in IL-10 mRNA. In contrast, the transgenic mice that express IL-10 under the control of the IL-2 promoter had only a twofold increase in IL-10 mRNA, even less than the increase in the F1 controls for that experiment.
|
|
) and IL-12 p40 mRNA on day 15 after infection and 25 times more NOS2 mRNA than h.IL-10+/ transgenic mice. There was no significant difference in IL-4, IL-2, or tumor necrosis factor alpha (TNF-
) mRNA levels in the two strains after infection.
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Inbred mice also vary in their susceptibility to C. immitis. In previous studies we showed that B6 mice were more susceptible then DBA/2 mice to C. immitis peritonitis, and in this study we extended that observation to show that B6 mice are also more susceptible to i.n. infection with C. immitis RS, but B6 IL-10/ mice are resistant. We repeated those experiments with i.n. infection because there is some evidence that the immune response to inhaled pathogens is different than the response to the same pathogen injected intravenously or i.p., possibly because pulmonary macrophages have a fairly distinct phenotype that is largely antiinflammatory (6, 34, 54).
We found that, as in the peritonitis model, i.n.-infected B6 mice had higher levels of IL-10 and IL-4 mRNA in their lungs, even before the infection had disseminated to their spleens. The question remained whether high levels of IL-10 are sufficient to make mice more susceptible to C. immitis infection. To answer this question we bred DB/c F1 h.IL-10+/ mice that expressed higher levels of biologically active IL-10. In fact, even though these mice had only one transgenic chromosome, they had nearly 15 times more IL-10 mRNA (Fig. 5) and they were more susceptible to this infection. We also infected a different IL-10 transgenic strain that expresses the m.IL-10 transgene under the control of the IL-2 promoter; those mice increased IL-10 mRNA production only twofold, and they were not more susceptible to C. immitis. Others have shown that the mice with IL-10 expressed from the IL-2 promoter are more susceptible to tuberculosis, but they were studied as homozygous animals (two copies of the transgene) (56).
Moore et al. (41) recently reviewed the subject of IL-10 and susceptibility to infections. IL-10 is vitally important for modulating the inflammatory response to microbial products that can otherwise result in septic shock and other pathologies (33). However, too much IL-10 can compromise the host's ability to resist bacterial, viral, fungal, and protozoan infections (26, 30, 49, 57). Resistance to infections is almost always increased when IL-10 is eliminated, whether with neutralizing antibody or by mutating IL-10 genes. Even normally resistant mice benefit from having less IL-10 when they are infected experimentally (9). Conversely, artificially high levels of IL-10, whether the cytokine is administered exogenously or endogenously synthesized by transgenic mice, are often deleterious (22). Interestingly, humans with tuberculosis who make high levels of IL-10 are anergic and remain so even after successful treatment with antituberculosis drugs (4).
IL-10 is a major immunoregulatory cytokine, which accounts for its activity in so many diverse experimental infections. IL-10 down-regulates the effector functions of macrophages and polymorphonuclear leukocytes (42), including release of reactive oxygen intermediates and proinflammatory cytokines, such as IL-12, TNF-
, IL-6, and IL-1 (50, 51). Similarly, mice that lack the IL-10 transcription factor STAT3 in their macrophages have an overexuberant inflammatory response to infection (39). IL-10 also affects the acquired immune response by down-regulating the expression of MHC class II and costimulatory molecules on antigen-presenting cells (29). The suppression of IL-12 secretion by accessory cells probably contributes to the Th2 bias that is attributed to IL-10 (55). Recently it was shown that dendritic cells from IL-10/ and normal B6 mice activate different programs of protein expression after they are pulsed with chlamydial elementary bodies, but how that biases the stimulated T cells to IFN-
production is not yet known (25). IL-10 also promotes the generation of regulatory T cells (Tr1) that in turn suppress antigen-specific immune responses in part through the secretion of IL-10 (23).
An interesting aspect of the relationship between IL-10 and resistance to murine coccidioidomycosis is the genetic control over the IL-10 response; infected B6 and BALB/c mice make more IL-10 than do DBA/2 mice (12). The IL-10 response of mice to Candida albicans infection is also under genetic control, but in that fungal infection DBA/2 mice make more IL-10 and are more susceptible than B6 mice (51). Thus, there are similarities between our studies with C. immitis and the C. albicans studies, but the two fungi induce the opposite IL-10 response in the same pair of mice; C. immitis stimulates more IL-10 in B6 mice while C. albicans stimulates more IL-10 in DBA/2 mice. The fungal products of C. immitis and C. albicans that are responsible for stimulating IL-10 production in mice are not known in either case.
Resistance to most pathogens involves a rapid, innate immune response that is followed by an antigen-specific adaptive immune response (40). This is of course an oversimplification, since the innate immune response usually continues through the course of infection, and the nature of the adaptive immune response is strongly influenced by the innate response (44). Resistance to C. immitis requires a well-coordinated immune response that has several crucial components. Magee and Cox have shown that IFN-
and IL-12 are both necessary for an effective immune response in mice (37, 38). The early production of IL-10 could interfere with the production or the effects (or both) of those cytokines. Infected B6 IL-10/ mice made more IL-12 p40 mRNA than B6 mice, showing that they were capable of making even more IL-12 p40 in response to infection. Conversely, the infected h.IL-10 transgenic mice had less IL-12 p40 mRNA than the F1 controls, indicating that IL-10 can suppress transcription of IL-12 p40 even in genetically resistant mice. This could mean that in murine coccidioidomycosis IL-10 acts in part to suppress transcription of IL-12 p40, and IL-12 is pivotal in directing the immune response toward a Th1 T-cell response (55). IL-10 produced during the early phase of infection can act directly on T cells, inhibiting chemotaxis of CD4+ cells and IL-2 production, and it can act on antigen-presenting cells to bias them toward T regulatory cells (41).
High levels of IL-4 are also detrimental to mice infected with C. immitis (37). IL-4 is a cytokine that biases the immune response to Th2 (16), and IL-4 levels are at least transiently higher in genetically susceptible mice than in resistant mice (Fig. 2) (37). IL-4 is a potent inducer of IL-10 in T cells (35). However, BALB/c mice treated with neutralizing antibody against IL-4 showed only a modest increase in resistance to C. immitis (37), and IL-4/ mice are only slightly more resistant to C. immitis infections (12). Of course, there is no reason why IL-4 and IL-10 cannot both down-regulate the immune response to C. immitis in susceptible mice. Interestingly, even in L. major infections in mice, where the amount of IL-4 made is genetically determined and is crucial for determining whether or not the lesions heal, IL-10 has been shown to be important for promoting susceptibility, and IL-4/IL-10 double-knockout mice are more resistant than either single knockout (45). Similarly, mice that are doubly deficient in IL-10 and IL-4 do not make a Th2 response to Schistosoma mansoni eggs, whereas mice deficient in either cytokine still make a weak Th2 response and have more pulmonary granulomas (61).
Part of the deleterious effect of IL-10 in C. albicans infection is due to down-regulation of NO production, inhibiting the candicidal activity of macrophages (51). We too found that IL-10 overproduction down-regulated NOS2 expression transcriptionally. IL-10 modulates macrophage expression of NOS2 (51). When we found that DBA/2 mice had higher lung levels of NOS2 mRNA than B6 mice and that h.IL-10 transgenic mice had lower levels of NOS2 mRNA, we postulated induction of NOS2 was an important mechanism for controlling the growth of this fungus. NO is a well-known antimicrobial agent that is active against a variety of bacteria, parasites, and even fungi (8). To determine the role of NO in coccidioidomycosis, we treated DBA/2 mice with the NOS inhibitor AMG. We did not use NOS2/ mice, because they are on a B6 background, which is a susceptible strain. DBA/2 mice treated with oral AMG had approximately 10-fold more C. immitis in both their lungs and spleens, and 3/10 AMG-treated mice died of infection. Since AMG is not a specific inhibitor of NOS2, we cannot be certain that the exacerbation of the infection was due solely to inhibition of NOS2. We did attempt to treat mice orally with the more specific NOS2 inhibitor L-NIL at a 3 mM concentration in drinking water. However, this dose achieved only a 50% reduction in excretion of urinary nitrate in infected mice, and there was only about a threefold increase in lung CFU (data not shown) that barely reached statistical significance (P = 0.05). Nevertheless, the trend was toward confirmation of the AMG result, and we think this provides additional support for the idea that NOS2 contributes to resistance to C. immitis. AMG- and L-NIL-treated DBA/2 mice were still not as susceptible as B6 mice, which could mean that DBA/2 mice have other important resistance mechanisms that are not inhibited by those drugs, or it could reflect our inability to completely inhibit NO synthesis with oral inhibitors. AMG treatment has been shown to exacerbate several other granulomatous infections in mice, including Salmonella enterica and New World trypanosomiasis (36, 52, 62). In some cases AMG also decreases IL-10 release from activated macrophages (27). Whether AMG has a similar effect on macrophage inhibition of C. immitis remains to be established. L-NIL-treated mice were not as susceptible, but with the dose we used of oral L-NIL we were unable to inhibit NO production by more than 50%, which could explain why it was less effective than AMG.
| ACKNOWLEDGMENTS |
|---|
This work was supported by a grant from the Research Service of the Department of Veterans Affairs.
| FOOTNOTES |
|---|
Present address: Grupo de Micología Médica y Experimental, Corporación para Investigaciones Biológicas, Medellín, Columbia. ![]()
| REFERENCES |
|---|
|
|
|---|
| 1. | Bacon, C. M., D. W. McVicar, J. R. Ortaldo, R. C. Rees, J. J. O'Shea, and J. A. Johnston. 1995. Interleukin 12 (IL-12) induces tyrosine phosphorylation of JAK2 and TYK2: differential use of Janus family tyrosine kinases by IL-2 and IL-12. J. Exp. Med. 181:399-404. |
| 2. | Bogdan, C., M. Röllinghoff, and A. Diefenbach. 2000. Reactive oxygen and reactive nitrogen intermediates in innate and specific immunity. Curr. Opin. Immunol. 12:64-76.[CrossRef][Medline] |
| 3. | Boockvar, K. S., D. L. Granger, R. M. Poston, M. Maybodi, M. K. Washington, J. B. Hibbs, Jr., and R. L. Kurlander. 1994. Nitric oxide produced during murine listeriosis is protective. Infect. Immun. 62:1089-1100. |
| 4. | Boussiotis, V. A., E. Y. Tsai, E. J. Yunis, S. Thim, J. C. Delgado, C. C. Dascher, A. Berezovskaya, D. Rousset, J.-M. Reynes, and A. E. Goldfeld. 2000. IL-10-producing T cells suppress immune responses in anergic tuberculosis patients. J. Clin. Investig. 105:1317-1325.[Medline] |
| 5. | Chan, J., and J. Flynn. 1999. Nitric oxide in Mycobacterium tuberculosis infection, p. 281-310. In F. C. Fang (ed.), Nitric oxide and infection. Kluwer Academic/Plenum Publishers, New York, N.Y. |
| 6. | Chen, W., H. Shen, A. Webb, R. KuoLee, and J. W. Conlan. 2003. Tularemia in BALB/c and C57BL/6 mice vaccinated with Francisella tularensis LVS and challenged intradermally, or by aerosol with virulent isolates of the pathogen: protection varies depending on pathogen virulence, route of exposure, and host genetic background. Vaccine 21:3690-3700.[CrossRef][Medline] |
| 7. | Cox, R. A., W. Kennell, L. Boncyk, and J. W. Murphy. 1988. Induction and expression of cell-mediated immune responses in inbred mice infected with Coccidioides immitis. Infect. Immun. 56:13-17. |
| 7a. | Cox, R. A., and D. M. Magee. 1998. Protective immunity in coccidioidomycosis. Res. Immunol. 149:417-428.[CrossRef][Medline] |
| 8. | DeGroote, M. A., and F. C. Fang. 1999. Antimicrobial properties of nitric oxide, p. 231-261. In F. C. Fang (ed.), Nitric oxide and infection. Kluwer Academic/Plenum Publishers, New York, N.Y. |
| 9. | Del Sero, G., A. Mencacci, E. Cenci, C. F. d'Ostiani, C. Montagnoli, A. Bacci, P. Mosci, M. Kopf, and L. Romani. 1999. Antifungal type 1 responses are upregulated in IL-10-deficient mice. Microbes Infect. 1:1169-1180.[CrossRef][Medline] |
| 10. | Eckmann, L., J. Fierer, and M. F. Kagnoff. 1996. Genetically resistant (Ityr) and susceptible (Itys) congenic mouse strains show similar cytokine responses following infection with Salmonella dublin. J. Immunol. 156:2894-2900.[Abstract] |
| 11. | Fang, F. C. 1997. Perspectives series: host/pathogen interactions. Mechanisms of nitric oxide-related antimicrobial activity. J. Clin. Investig. 99:2818-2825.[Medline] |
| 12. | Fierer, J., L. Walls, L. Eckmann, T. Yamamoto, and T. N. Kirkland. 1998. Importance of interleukin-10 in genetic susceptibility of mice to Coccidioides immitis. Infect. Immun. 66:4397-4402. |
| 13. | Fierer, J., L. Walls, and T. N. Kirkland. 2000. Genetic evidence for the role of the Lv locus in early susceptibility but not IL-10 synthesis in experimental coccidioidomycosis in C57BL mice. J. Infect. Dis. 181:681-685.[CrossRef][Medline] |
| 14. | Fierer, J., L. Walls, F. Wright, and T. N. Kirkland. 1999. Genes influencing resistance to Coccidioides immitis and the interleukin-10 response map to chromosomes 4 and 6 in mice. Infect. Immun. 67:2916-2919. |
| 15. | Flynn, N. M., P. D. Hoeprich, M. M. Kawachi, K. K. Lee, R. M. Lawrence, E. Goldstein, G. W. Jordan, R. S. Kundargi, and G. A. Wong. 1979. An unusual outbreak of windborne coccidioidomycosis. N. Engl. J. Med. 301:358-362.[Medline] |
| 16. | Fresno, M., M. Kopf, and L. Rivas. 1997. Cytokines and infectious diseases. Trends Immunol. Today 18:56-58. |
| 17. | Galgiani, J. 1993. Coccidioidomycosis. West. J. Med. 159:153-171.[Medline] |
| 18. | Galgiani, J. N. 1999. Coccidioidomycosis: a regional disease of national importance. Ann. Intern. Med. 130:293-300. |
| 19. | Granger, D., N. M. Anstey, W. C. Miller, and J. B. Weinberg. 1999. Measuring nitric oxide production in human clinical studies. Methods Enzymol. 301:49-61.[Medline] |
| 20. | Granger, D. L., R. R. Taintor, K. S. Boockvar, and J. B. Hibbs, Jr. 1996. Measurement of nitrate and nitrite in biological samples using nitrate reductase and Griess reaction. Methods Enzymol. 268:142-151.[Medline] |
| 21. | Gray, G. C., E. F. Fogle, and K. L. Albright. 1998. Risk factors for primary pulmonary coccidioidomycosis hospitalizations among United States Navy and Marine Corps personnel, 1981-1994. Am. J. Trop. Med. Hyg. 58:309-312.[Abstract] |
| 22. | Groux, H., F. Cottrez, M. Rouleau, S. Mauze, S. Antonenko, S. Hurst, T. McNeil, M. Bigler, M.-G. Roncarolo, and R. L. Coffman. 1999. A transgenic model to analyze the immunoregulatory role of IL-10 secreted by antigen-presenting cells. J. Immunol. 162:1723-1729. |
| 23. | Groux, H., A. O'Garra, M. Bigler, M. Rouleau, S. Antonenko, J. E. de Vries, and M. G. Roncarolo. 1997. A CD4+ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature 389:737-742.[CrossRef][Medline] |
| 24. | Hagenbaugh, A., S. Sharma, S. M. Dubinett, S. H. Y. Wei, R. Aranda, H. Cheroutre, D. J. Fowell, S. Binder, B. Tsao, R. M. Locksley, K. W. Moore, and M. Kronenberg. 1997. Altered immune responses in interleukin 10 transgenic mice. J. Exp. Med. 185:2101-2110. |
| 25. | He, Q., T. T. Moore, F. O. Eko, D. Lyn, G. A. Ananaba, A. Martin, S. Singh, L. James, J. Stiles, C. M. Black, and J. U. Igietseme. 2005. Molecular basis for the potency of IL-10 deficient dendritic cells as a highly efficient APC system for activating Th1 response. J. Immunol. 174:4860-4869. |
| 26. | Helminen, M. E., S. Kilpinen, M. Virta, and M. Hurme. 2001. Susceptibility to primary Epstein-Barr virus infection is associated with interleukin-10 gene promoter polymorphism. J. Infect. Dis. 184:777-780.[CrossRef][Medline] |
| 27. | Hill, J. R., J. A. Corbett, G. Kwon, C. A. Marshall, and M. L. McDaniel. 1996. Nitric oxide regulates interleukin 1 bioactivity released from murine macrophages. J. Biol. Chem. 271:22672-22678. |
| 28. | Hooper, R., R. Curley, G. Poppell, S. Husted, and R. Schillaci. 1980. Coccidioidomycosis among military personnel in southern California. Mil. Med. 145:620-623.[Medline] |
| 29. | Joss, A., M. Akdis, A. Faith, K. Blaser, and C. A. Akdis. 2000. IL-10 directly acts on T cells by specifically altering the CD28 co-stimulation pathway. Eur. J. Immunol. 30:1683-1690.[CrossRef][Medline] |
| 30. | Kelly, J. P., and G. J. Bancroft. 1996. Administration of interleukin-10 abolishes innate resistance to Listeria monocytogenes. Eur. J. Immunol. 26:356-364.[Medline] |
| 31. | Kirkland, T. N., and J. Fierer. 1983. Inbred mouse strains differ in resistance to lethal Coccidioides immitis infection. Infect. Immun. 40:912-916. |
| 32. | Kuhn, R., J. Lohler, D. Rennick, K. Rajewsky, and W. Muller. 1993. Interleukin-10 deficient mice develop chronic enterocolitis. Cell 75:263-274.[CrossRef][Medline] |
| 33. | Latifi, S. Q., M. A. O'Riordan, and A. D. Levine. 2002. Interleukin-10 controls the onset of irreversible septic shock. Infect. Immun. 70:4441-4446. |
| 34. | Leemans, J. C., T. Thepen, S. Weijer, S. Florquin, N. van Rooijen, J. G. van de Winkel, and T. van der Poll. 2005. Macrophages play a dual role during pulmonary tuberculosis in mice. J. Infect. Dis. 191:65-74.[CrossRef][Medline] |
| 35. | Löhning, M., A. Richter, T. Stamm, J. Hu-Li, M. Assenmacher, W. E. Paul, and A. Radbruch. 2003. Establishment of memory for IL-10 expression in developing T helper 2 cells requires repetitive IL-4 costimulation and does not impair proliferation. Proc. Natl. Acad. Sci. USA 100:12307-12312. |
| 35a. | Lucey, D. R., M. Clerici, and G. M. Shearer. 1996. Type 1 and type 2 cytokine dysregulation in human infectious, neoplastic, and inflammatory disease. Clin. Microbiol. Rev. 9:532-562.[Abstract] |
| 36. | MacFarlane, A. S., M. G. Schwacha, and T. K. Eisenstein. 1999. In vivo blockage of nitric oxide with aminoguanidine inhibits immunosuppression induced by an attenuated strain of Salmonella typhimurium, potentiates Salmonella infection, and inhibits macrophage and polymorphonuclear leukocyte influx into the spleen. Infect. Immun. 67:891-898. |
| 37. | Magee, D. M., and R. A. Cox. 1995. Roles of gamma interferon and interleukin-4 in genetically determined resistance to Coccidioides immitis. Infect. Immun. 63:3514-3519.[Abstract] |
| 38. | Magee, D. M., and R. A. Cox. 1996. Interleukin-12 regulation of host defenses against Coccidioides immitis. Infect. Immun. 64:3609-3613.[Abstract] |
| 39. | Matsukawa, A., K. Takeda, S. Kudo, T. Maeda, M. Kagayama, and S. Akira. 2003. Aberrant inflammation and lethality to septic peritonitis in mice lacking STAT3 in macrophages and neutrophils. J. Immunol. 171:6198-6205. |
| 40. | Medzhitov, R., and C. Janeway, Jr. 2000. Innate immunity. N. Engl. J. Med. 343:338-344. |
| 41. | Moore, K. W., R. de Waal Malefyt, R. L. Coffman, and A. O'Garra. 2001. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 19:683-765.[CrossRef][Medline] |
| 42. | Moore, K. W., A. O'Garra, R. de Waal Malefyt, P. Viera, and T. R. Mosmann. 1993. Interleukin-10. Annu. Rev. Immunol. 11:165-190.[CrossRef][Medline] |
| 43. | Nathan, C., and M. U. Shiloh. 2000. Reactive oxygen and nitrogen intermediates in the relationship between mammalian hosts and microbial pathogens. Proc. Natl. Acad. Sci. USA 97:8841-8848. |
| 44. | Netea, M. G., C. van der Graaf, J. W. M. Van der Meer, and B. J. Kullberg. 2004. Toll-like receptors and the host defense against microbial pathogens: bringing specificity to the innate-immune system. J. Leukoc. Biol. 75:749-755. |
| 45. | Noben-Trauth, N., R. Lira, H. Nagase, W. E. Paul, and D. L. Sacks. 2003. The relative contribution of IL-4 receptor signaling and IL-10 to susceptibility to Leishmania major. J. Immunol. 170:5152-5158. |
| 46. | Pappagianis, D. 1980. Epidemiology of coccidioidomycosis, p. 63-85. In D. A. Stevens (ed.), Coccidioidomycosis: a text. Plenum Medical Book Co., New York, N.Y. |
| 47. | Pappagianis, D., S. Lindsay, S. Beall, and P. Williams. 1979. Ethnic background and the clinical course of coccidioidomycosis. Am. Rev. Respir. Dis. 120:959-961.[Medline] |
| 48. | Pappagianis, D., and B. L. Zimmer. 1990. Serology of coccidioidomycosis. Clin. Microbiol. Rev. 3:247-268. |
| 49. | Qureshi, M. H., A. G. Harmsen, and B. A. Garvy. 2003. IL-10 modulates host responses and lung damage induced by Pneumocystis carinii infection. J. Immunol. 170:1002-1009. |
| 50. | Riley, J. K., K. Takeda, S. Akira, and R. D. Schreiber. 1999. Interleukin-10 receptor signaling through the JAK-STAT pathway. Requirement for two distinct receptor-derived signals for anti-inflammatory action. J. Biol. Chem. 274:16513-16521. |
| 51. | Romani, L., P. Puccetti, A. Mencacci, E. Cenci, R. Spaccapelo, L. Tonnetti, U. Grohmann, and F. Bistoni. 1994. Neutralization of IL-10 up-regulates nitric oxide production and protects susceptible mice from challenge with Candida albicans. J. Immunol. 152:3514-3521.[Abstract] |
| 52. | Saeftel, M., B. Fleischer, and A. Hoerauf. 2001. Stage-dependent role of nitric oxide in control of Trypanosoma cruzi infection. Infect. Immun. 69:2252-2259. |
| 53. | Smith, C. E., R. R. Beard, E. G. Whiting, and H. G. Rosenberger. 1946. Varieties of coccidioidal infection in relation to the epidemiology and control of the diseases. Am. J. Public Health 36:1394-1402. |
| 54. | Stout, R. D., and J. Suttles. 2004. Functional plasticity of macrophages: reversible adaptation to changing microenvironments. J. Leukoc. Biol. 76:509-513. |
| 55. | Trinchieri, G. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. 3:133-146.[CrossRef] |
| 56. | Turner, J., M. Gonzalez-Juarrero, D. L. Ellis, R. J. Basaraba, A. Kipnis, I. M. Orme, and A. M. Cooper. 2002. In vivo IL-10 production reactivates chronic pulmonary tuberculosis in C57BL/6 mice. J. Immunol. 169:6343-6351. |
| 57. | Vazquez-Torres, A., J. Jones-Carson, R. D. Wagner, T. Warner, and E. Balish. 1999. Early resistance of interleukin-10 knockout mice to acute systemic candidiasis. Infect. Immun. 67:670-674. |
| 58. | Walch, H. A., and A. Kalvoda. 1971. Immunization of mice with induced mutants of Coccidioides immitis. I. Characterization of mutants and preliminary studies of their use as viable vaccines. Sabouraudia 9:173-184.[Medline] |
| 59. | Walch, H. A., and R. K. Walch. 1967. Studies with induced mutants of Coccidioides immitis, p. 339-347. In L. Ajello (ed.), Coccidioidomycosis: proceedings of the second coccidioidomycosis symposium, Phoenix, Ariz., December 8-10, 1965. The University of Arizona Press, Tucson. |
| 60. | Williams, P. L., D. L. Sable, P. Mendez, and L. T. Smyth. 1979. Symptomatic coccidioidomycosis following a severe natural dust storm. Chest 76:566-570. |
| 61. | Wynn, T. A., R. Morawetz, T. Scharton-Kersten, S. Hieny, H. C. I. Morse, R. Kühn, W. Müller, A. W. Cheever, and A. Sher. 1997. Analysis of granuloma formation in double cytokine-deficient mice reveals a central role for IL-10 in polarizing both T helper cell 1- and T helper cell 2-type cytokine responses in vivo. J. Immunol. 159:5014-5023.[Abstract] |
| 62. | Zhou, X., D. A. Potoka, P. Boyle, E. P. Nadler, K. McGinnis, and H. R. Ford. 2002. Aminoguanidine renders inducible nitric oxide synthase knockout mice more susceptible to Salmonella typhimurium infection. FEMS Microbiol. Lett. 206:93-98.[CrossRef][Medline] |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|