This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Keller, C.
Right arrow Articles by Ehlers, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Keller, C.
Right arrow Articles by Ehlers, S.

 Previous Article  |  Next Article 

Infection and Immunity, July 2006, p. 4295-4309, Vol. 74, No. 7
0019-9567/06/$08.00+0     doi:10.1128/IAI.00057-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Genetically Determined Susceptibility to Tuberculosis in Mice Causally Involves Accelerated and Enhanced Recruitment of Granulocytes

Christine Keller,1* Reinhard Hoffmann,2 Roland Lang,3 Sven Brandau,4 Corinna Hermann,5 and Stefan Ehlers1

Molecular Infection Biology, Research Center Borstel, Parkallee 22, 23845 Borstel, Germany,1 Max von Pettenkofer Institute, Pettenkoferstrasse 9a, 80336 Munich, Germany,2 Institute of Medical Microbiology, Immunology and Hygiene, Technical University Munich, Trogerstrasse 9, 81675 Munich, Germany,3 Division of Immunotherapy, Research Center Borstel, Parkallee 26b, 23845 Borstel, Germany,4 Biochemical Pharmacology, University of Konstanz, 78457 Konstanz, Germany5

Received 11 January 2006/ Returned for modification 10 February 2006/ Accepted 19 April 2006


arrow
ABSTRACT
 
Classical twin studies and recent linkage analyses of African populations have revealed a potential involvement of host genetic factors in susceptibility or resistance to Mycobacterium tuberculosis infection. In order to identify the candidate genes involved and test their causal implication, we capitalized on the mouse model of tuberculosis, since inbred mouse strains also differ substantially in their susceptibility to infection. Two susceptible and two resistant mouse strains were aerogenically infected with 1,000 CFU of M. tuberculosis, and the regulation of gene expression was examined by Affymetrix GeneChip U74A array with total lung RNA 2 and 4 weeks postinfection. Four weeks after infection, 96 genes, many of which are involved in inflammatory cell recruitment and activation, were regulated in common. One hundred seven genes were differentially regulated in susceptible mouse strains, whereas 43 genes were differentially expressed only in resistant mice. Data mining revealed a bias towards the expression of genes involved in granulocyte pathophysiology in susceptible mice, such as an upregulation of those for the neutrophil chemoattractant LIX (CXCL5), interleukin 17 receptor, phosphoinositide kinase 3 delta, or gamma interferon-inducible protein 10. Following M. tuberculosis challenge in both airways or peritoneum, granulocytes were recruited significantly faster and at higher numbers in susceptible than in resistant mice. When granulocytes were efficiently depleted by either of two regimens at the onset of infection, only susceptible mice survived aerosol challenge with M. tuberculosis significantly longer than control mice. We conclude that initially enhanced recruitment of granulocytes contributes to susceptibility to tuberculosis.


arrow
INTRODUCTION
 
Tuberculosis (TB) has been declared a global emergency by the World Health Organization (26). The etiological agent, Mycobacterium tuberculosis, has infected one-third of the world's population and causes nine million new cases of active disease annually, resulting in two million deaths, mostly in developing countries (18).

A strong effort is being made to develop a more effective vaccine, and markers predictive for protective immunity (or the lack thereof) would be particularly useful to accelerate validation of novel vaccine strategies in the field (34). With the advent of new tools in genetic epidemiology, the influence of the genetic background on susceptibility or resistance to tuberculosis has therefore become the focus of recent attention.

Several twin studies showed significant differences in the development of tuberculosis between monozygotic and dizygotic twins (32). With respect to individual candidate genes, a variant of the vitamin D receptor was found to be associated with the development of tuberculosis in a case control study in The Gambia (9). Also, among the Gujarati Indians in London, vitamin D receptor gene polymorphisms were correlated with tuberculosis infection (68). Several studies have indicated a partially protective effect of heterozygosity for mannan binding lectin variant alleles against TB (23, 29), whereas others have pointed toward an increased susceptibility for TB in homozygous carriers of mannan binding lectin variant alleles (47). In general, a genetically determined impairment of release or response to gamma interferon (IFN-{gamma}) or interleukin 12 (IL-12) is associated with an enhanced risk of developing tuberculosis (15, 17). Conversely, an increased transcription of IFN-{gamma} caused by a polymorphism in the IFN-{gamma} gene was associated with resistance to tuberculosis in South Africans and Sicilians (8, 42).

In order to evaluate whether any of the genes found in association studies to correlate with susceptibility to tuberculosis are involved in the pathogenesis of disease and thus potentially provide novel targets for preventive or therapeutic immunomodulation, animal models are required. Medina and North documented substantial differences in the development of M. tuberculosis growth in the lung and survival time between different inbred strains of mice, with C57BL/6 and BALB/c segregating with higher resistance and CBA/J, C3H, and DBA/2 showing higher susceptibility (43). In a linkage analysis using C57BL/6, C3H mice, and their crossbreeds, Kramnik et al. identified the gene locus sst1 (susceptibility to tuberculosis 1) and later Ipr-1 (intracellular pathogen resistance), a gene within sst1 on mouse chromosome 1 that controls several parameters of tuberculosis disease, such as survival time, bacterial loads in lungs and spleens, and lung pathology (37, 48). In another linkage study using C57BL/6, DBA/2 mice, and their crossbreeds, Mitsos et al. identified a gene locus on chromosome 19 named Trl4 that was responsible for regulating replication of M. tuberculosis in the lung after aerosol infection (46). Susceptibility has also been associated in this model with earlier dissemination of mycobacteria from the lung (13).

We recently used two resistant (C57BL/6; BALB/c) and two susceptible (DBA/2; CBA/J) mouse strains to comprehensively determine gene expression profiles in macrophages infected with M. tuberculosis in vitro (35). Microarray data from that study suggested that macrophages from susceptible mice predominantly stimulate the recruitment of cells that contribute disproportionately to tissue damage rather than to microbial elimination. We have now extended these studies and determined transcriptome regulation in the lungs of the same strains of mice following aerosol infection with M. tuberculosis.

We found differential regulation in a number of genes involved in the recruitment and function of granulocytes to be characteristically regulated in susceptible mouse strains. Since previous studies with rodent models of infection failed to indicate a detrimental role for granulocytes in tuberculosis infection (2, 33, 62), we further determined whether depletion of granulocytes in susceptible mice would indeed alter the course of tuberculosis in mice. Collectively, our data support the hypothesis that early and enhanced recruitment of granulocytes contributes to susceptibility to tuberculosis.


arrow
MATERIALS AND METHODS
 
Mouse strains. C57BL/6 and BALB/c (resistant strains) and CBA/J and DBA/2 (susceptible strains) 6 to 8 week-old female mice (Jackson Laboratories, Bar Harbor, Maine) were bought certified specific pathogen free and maintained with a sterilized food and water supply. Mice were housed in a biosafety level 3 facility within individually ventilated cages. All animal experiments were approved by the Ministry of the Environment, Nature Protection and Agriculture (Kiel, Germany).

Bacteria. M. tuberculosis (strain H37Rv) was grown in Middlebrook 7H9 broth (Difco, Detroit, MI) supplemented with oleic acid, albumin, dextrose, and catalase enrichment medium (OADC) (Life Technologies, Gaithersburg, MD), 0.2% glycerol, and 0.05% Tween 80 (VWR International GmbH, Darmstadt, Germany). Mid-log-phase cultures were harvested, aliquoted, and frozen at –80°C. After thawing, viable cell counts were determined by plating serial dilutions of the cultures on Middlebrook 7H10 agar containing 10% OADC followed by incubation at 37°C for 3 weeks. To ensure proper dispersion of mycobacteria, 1 ml of the suspension was drawn through a nonpyrogenic needle (Microlance3, 26G A3/8 0.45 x 10; BD, Drogheda, Ireland). Afterwards, this suspension containing 2.5 x 107 CFU was sonicated in a 1.5-ml plastic tube (Eppendorf, Germany) using bath sonification in a Bandelin Sonorex 52 ultrasound bath (Bandelin Electronics, Berlin, Germany), for 5 min at a frequency of 35 kHz.

Infection of mice. Aerogenic infection was carried out in a Glas-Col aerosol infection device (Glas-Col, Terre-Haute, IN), essentially as described previously (30). In order to deposit 1,000 CFU into the lungs, mice were exposed for 40 min to an aerosol generated by nebulizing ~5.5 ml of a suspension containing 2.5 x 107 CFU/ml M. tuberculosis (H37Rv). Inoculum size was confirmed 24 h postinfection by determining the bacterial load in undiluted lung homogenates of three infected mice. Bacterial loads in lung, liver, and spleen were evaluated at different time points after infection with M. tuberculosis to follow the course of infection. Organs from four to five sacrificed animals per time point were removed aseptically, weighed, and homogenized in distilled sterile water. Tenfold serial dilutions of organ homogenates were plated in duplicate onto Middlebrook 7H10 agar plates containing 10% OADC and incubated at 37°C for 21 days. Colonies on plates were enumerated, and results were expressed as log10 CFU per organ. In accordance with the Animal Research Ethics Board of the Ministry of the Environment, mice that lost 25% of their original weight during the course of infection were scored as moribund and had to be sacrificed.

Depletion of neutrophils in mice. Hestdal et al. showed differences in sorted mouse bone marrow cells between low-, median-, and high-Ly6G (RB6-8C5)-expressing cells. High expression is restricted to mature granulocytes (28). For in vivo neutrophil depletion, mice were injected with 100 µg of the monoclonal antibody (MAb) RB6-8C5 1 day before and 3 days after infection. This protocol was specifically shown by Seiler et al. to spare cells other than neutrophilic granulocytes (59). Alternatively, 100 µl of an anti-granulocyte-colony-stimulating factor (anti-GCSF) sheep antiserum was injected intravenously 5 and 3 days before infection, as described previously (6). As a control, the same amount of rat or sheep immunoglobulin G (IgG) was administered. To assess the degree of granulocyte depletion, blood smears were prepared and stained with Hemacolor (Merck, Darmstadt, Germany), and white cell subsets were counted under the microscope at several time points after antibody administration. Depletion reproducibly reduced granulocyte counts to below 2% of total cell numbers (Fig. 1).


Figure 1
View larger version (12K):
[in this window]
[in a new window]
  		FIG. 1. Depletion of granulocytes after treatment with either RB6-8C5 or anti-GCSF. Mice were depleted of granulocytes with either 100 µl RB6-8C5 antibody 1 day before and 3 days after infection or 100 µl anti-GCSF antiserum 5 and 3 days before infection. The appropriate amount of IgG was injected as a control. Cells were counted in blood smears from several animals at different time points. Data shown are means ± standard deviations for four mice at 1 day after the last application of the antibody or IgG.

Histopathological analysis. For immunohistochemistry, lung lobes were instilled with 33% TissueTec (Leica, Munich, Germany). Cryosections of lung tissue were prepared and placed in 100% acetone/chloroform for 10 min each and washed with Tris-buffered saline. RB6-8C5 MAb (21) was applied for 45 min as a primary antibody for staining neutrophil granulocytes. As a bridging antibody, appropriately diluted goat antirabbit IgG peroxidase (Dianova, Hamburg, Germany), and as a tertiary antibody, diluted rabbit antigoat IgG peroxidase (Dianova), were used in sequential incubations of 45 min each. Development was performed with diaminobenzidine tetrahydrochloride (Sigma, St. Louis, MO) and urea superoxide (Sigma), and hemalum was used to counterstain the slides. Isotype-matched antibody was used on separate sections to confirm that staining was specific.

Bronchioalveolar and peritoneal lavage. Mice were sacrificed under CO2 anesthesia. Afterwards, a cannula (1.2 mm; Acufirm, Dreieich, Germany) was inserted into the trachea, and the lung was lavaged five times with 1 ml phosphate-buffered saline (PBS). Cells were then centrifuged and counted using a light microscope. Total cell numbers were between 3 x 105 and 6 x 105 cells/ml, depending on the time after infection.

For intraperitoneal granulocyte recruitment assays, either the cytokine neutrophil-activating peptide 2 (kind gift of E. Brandt, Borstel, Germany) or lipopolysaccharide (LPS)-induced CXC chemokine (LIX) (R&D, Wiesbaden, Germany) or 1.2 x 107 CFU M. tuberculosis was injected into the peritoneal cavity. After peritoneal lavage, cells were counted using the light microscope and incubated in consecutive steps for 20 min with optimal concentrations of Gr1-phycoerythrin and MAC1-allophycocyanin antibodies (Becton Dickinson, Heidelberg, Germany). Here, total cell numbers were between 2 x 106 and 7 x 106 cells/ml, depending on the time after infection.

Flow-cytometric analysis of surface markers. For flow-cytometric analysis of surface markers, bronchioalveolar cells were obtained and incubated with a mixture containing anti-Fc{gamma}RIII/II MAb (clone 2.4G2) and mouse and rat serum to block nonspecific binding to Fc{gamma}Rs. Cells were then incubated in consecutive steps for 20 min with optimal concentrations of the following antibodies: Gr1-PE, MAC1-APC, annexin V-fluorescein isothiocyanate (FITC), and propidium iodide. Fluorescence intensity was analyzed on a FACSCalibur (BD Biosciences, Heidelberg, Germany) instrument, with gating on granulocytes identified by forward-scatter/side-scatter profiling and Gr1 positivity as depicted for region 1 in Fig. 5.


Figure 5
View larger version (167K):
[in this window]
[in a new window]
  		FIG. 5. Immunohistological detection of RB6-8C5-positive cells in the lungs of different mouse strains infected with M. tuberculosis. Resistant C57BL/6 (A) or BALB/c (B) or susceptible DBA/2 (C) or CBA/J (D) mice were aerogenically infected with 1,000 CFU M. tuberculosis H37Rv. Cryosections (2 to 3 µm) were prepared from frozen lungs removed at 28 days postinfection. Immunohistological staining was performed with the monoclonal antibody RB6-8C5. Shown are representative results of four mice per group (magnification, x100; insert: magnification, x400).

DNA microarray hybridization and analysis. At 0, 14, and 28 days after infection, total RNA was obtained from infected lungs homogenized in 2 ml of peqGOLD TriFastFL (PeqLab Biotechnologie GmbH, Erlangen, Germany) according to the manufacturer's protocols. Experiments were performed twice for each mouse strain. Equal amounts of total RNA derived from three mice of each strain were pooled before analysis.

For biotin-labeled target synthesis starting from 5 µg of total RNA, reactions were performed using standard protocols supplied by the manufacturer (Affymetrix; Santa Clara, CA). Briefly, 5 µg total RNA was converted to double-stranded DNA using 100 pmol of a T7T23V primer (Eurogentec; Seraing, Belgium) containing a T7 promoter. The cDNA was then used directly in an in vitro transcription reaction in the presence of biotinylated nucleotides. A 12.5-µg amount of the cleaned and biotinylated cRNA preparation was fragmented and placed in a hybridization cocktail. Samples were then hybridized once to an identical lot of Affymetrix MG-U74Av2 (representing about 6,000 murine genes) for 16 h.

After hybridization the GeneChips were washed, stained with streptavidin-phycoerythrin (Vector Lab; Peterborough, England), and read using an Affymetrix GeneChip fluidic station and scanner. Fluorescence intensities were normalized to median array intensities for all conditions tested, and severalfold change was calculated relative to baseline controls (cDNA derived from uninfected lungs at each time point). Analysis was done with gene expression software (GeneChip, MicroDB, and Data Mining Tool; Affymetrix) with a filter for regulated genes that employed the following stringent criteria to define genes as significantly regulated. (i) A signal log2 ratio above 1 or below 1, signifying the change in expression level for a transcript between baseline and experimental array; a signal log2 ratio of 1 therefore represents a "fold change" of 2; (ii) a change in P values below 0.001 or above 0.999, providing for each transcript the likelihood of change and direction; P values below 0.001 or above 0.999 indicate the level of significance of the difference between baseline and experimental chip, based on the Wilcoxon signed rank test; (iii) signal differences of at least 100, describing a measure of the relative abundance of a transcript, as defined by the Affymetrix algorithm. Sequences used in the design of the array were selected from GenBank, dbEST, and RefSeq. Only genes that were differentially regulated compared to the uninfected control with a change in the expression level of at least twofold (induced or repressed) in both experiments were considered to be specifically regulated by infection. In order to eliminate genes that are exclusive for any individual mouse strain, only genes regulated in common in both susceptible or both resistant mouse strains or regulated in common in all four mouse strains are shown as regulated genes in the respective tables.

RT-PCR. For validation of gene expression, equal amounts of RNA were reverse transcribed (Superscript II RNase H– reverse transcriptase; Invitrogen, Karlsruhe, Germany) and used for quantitative reverse transcription-PCR (RT-PCR) (LightCycler technology; Roche, Mannheim, Germany) using the following gene-specific primer pairs: for hypoxanthine-guanine phosphoribosyltransferase (HPRT), forward primer, 5' GCCAGTAAAATTAGCAGGTGTTCT 3', and reverse primer, 5' AGGCTCATAGTGCAAATCAAAAGTC 3'; for LIX, forward primer, 5' GGTCCACAGTGCCCTACG 3', and reverse primer, 5' GCGAGTGCATTCCGCTTA 3'; for Grn, forward primer, 5' ACCCCGACGCAGGCAGACCAT 3', and reverse primer 5' CAACATCCCCACGAACCATCAACC 3'; for Pik3cd, forward primer, 5' GGGCCGGCTTATTGCGTGTCAG 3', and reverse primer, 5' CGGCCCTCGATCAGCTCAATGGA 3'; for IL17R, forward primer, 5' TGGGATCTGTCATCGTGCT 3', and reverse primer, 5' ATCACCATGTTTCTCTTGATCG 3'; for tumor necrosis factor (TNF), forward primer, 5' TCTCATCAGTTCTATGGCCC 3', and reverse primer, 5' GGGAGTAGACAAGGTACAAC 3; for IP10, forward primer, 5' GTGCTGCCGTCATTTTCTGC 3', and reverse primer, 5' CTTAGATTCCGGATTCAGAC 3'; for MIG, forward primer, 5' TTTCCTTTTGGGCATCATCTTCC 3', and reverse primer, 5' TTGGGGTGTTTTGGGTTTTCTGT 3'. Gene expression was expressed as the relative expression normalized to HPRT expression.

Statistical analysis. The data in the graphs are presented as means ± standard deviations (SD). Data were analyzed using an unpaired t test, one-sided or two-sided as indicated. The method of Benjamini and Hochberg was used (10) to control the false discovery rate, i.e., the expected proportion of false discoveries among the rejected hypotheses, and is a less-stringent condition than the family-wise error rate, making this method more powerful (16). A P value of <0.05 was considered significant.


arrow
RESULTS
 
Bacterial burden is much higher in susceptible than in resistant mouse strains. Following infection with 1,000 CFU M. tuberculosis, the bacterial burden was significantly higher in susceptible mice (CBA/J and DBA/2) than in resistant mice (C57BL/6 and BALB/c) at day 28 after infection (Fig. 2). The appearance of the lungs of the susceptible strains on day 28 showed a pulpy consistency with malorganized bloody infiltrations, whereas lungs of resistant strains exhibited well-formed granulomas (data not shown). These data confirm previous reports with lower inocula (25, 43, 44) and show the reproducibility of this model system.


Figure 2
View larger version (7K):
[in this window]
[in a new window]
  		FIG. 2. Growth of M. tuberculosis in the lungs of different mouse strains. Resistant (C57BL/6, filled circles; BALB/c, filled triangles) and susceptible (DBA/2, unfilled circles; CBA/J, unfilled triangles) mouse strains were infected with ~1,000 CFU M. tuberculosis (H37Rv) per aerosol. Lungs were removed 14 and 28 days after infection, and numbers of CFU were determined. Means of six mice of each strain (±SD) are shown. ***, P ≤ 0.001; error bars are included but are too small to be seen.

Resistant and susceptible mouse strains differ in gene expression profiles of infected lungs. To investigate differences in gene expression in M. tuberculosis-infected susceptible and resistant mouse strains ex vivo, we used the Affymetrix murine gene chip MG_U74Av2. Because of using stringent data analysis of microarray results, no genes were found to be regulated more than twofold either in all four strains or privately in both resistant or both susceptible strains at day 14 (data not shown). At 28 days postinfection, 92 genes were found to be regulated in common (Table 1). Among these, genes involved in inflammatory cell recruitment and activation predominated, such as chemokines (CCL2, CXCL1, CXCL9, and CCL5 genes), cytokines (IL-1ß gene), interferon-induced or interferon-regulating genes (IGTP, Ifi205, Ifi47, Isg15, GTPI, IRF1, ICSBP, and IRF7 genes), or members of the complement cascade (C1q gene).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Common set of genes regulated in lungs of susceptible and resistant mouse strains after aerogenic infection with M. tuberculosis

Several genes were regulated exclusively in the lungs of susceptible (102 genes) or of resistant (43 genes) mouse strains at 28 days postinfection (Tables 2 and 3). Data analysis showed that a number of genes involved in myelomonocytic cell differentiation, activation, and recruitment were predominantly regulated in susceptible mouse strains (numbers in parentheses will indicate n-fold regulation in DBA/2 and CBA/J mice, respectively). These genes included those for TNF (13/15.5-fold), CXCL10 (8/52-fold), CCL7 (10.7/44-fold), CCR2 (4.1/4.5-fold), CSF3 receptor (5.3/7.9-fold), and C-type lectin, superfamily member 8 (20.4/20.5-fold). Of particular interest, genes regulating granulocyte function were almost exclusively upregulated in susceptible mouse strains, including those for phosphoinositide-kinase 3 delta (10.3/4.7-fold), neutrophil cytosolic factor 4 (6.0/7.3-fold), sfpi1 (a transcription factor involved in granulopoiesis, 4.8/3.5-fold), or the IL-17 receptor (2.2/2.4-fold). CXCL5, the granulocyte chemoattractant which we had previously identified in an in vitro screen to be highly induced only in M. tuberculosis-infected macrophages from susceptible mouse strains (35), was upregulated about fivefold in DBA/2 and CBA/J mice but not in C57BL/6 and BALB/c mice. Differential expression of some of these genes in susceptible and resistant mice was confirmed using semiquantitative RT-PCR (Fig. 3) of lung tissue removed at day 28 postinfection.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Private set of genes regulated in lungs of susceptible mouse strains after aerogenic infection with M. tuberculosis


View this table:
[in this window]
[in a new window]
  		TABLE 3. Private set of genes regulated in lungs of resistant mouse strains after aerogenic infection with M. tuberculosis


Figure 3
View larger version (21K):
[in this window]
[in a new window]
  		FIG. 3. mRNA expression of molecules involved in granulocyte function in the lungs of different mouse strains infected with M. tuberculosis. DBA/2 (black bars), CBA/J (dark-gray bars), BALB/c (light-gray bars), or C57BL/6 (white bars) mice were infected with ~1,000 CFU M.tuberculosis (H37Rv) per aerosol. Lungs were removed 28 days after infection and processed for quantitative RT-PCR of LIX, PI3-kinase delta, IP-10, IL-17 receptor, TNF, and MIG. Means for three mice per group (± SD) normalized for HPRT expression are shown. n.s., not significant; *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001.

Granulocyte and macrophage influx following M. tuberculosis infection occurs much earlier in susceptible than in resistant mouse strains. In order to directly determine whether granulocyte influx into the alveolar space was more prominent in susceptible than in resistant mice, prototype strains DBA/2 and C57BL/6 mice were infected with ~1,000 CFU Mtb. At several closely consecutive early time points after infection, bronchoalveolar lavage was performed. Flow-cytometric analyses using the antibody RB6-8C5, a marker commonly used to identify granulocytes (21, 28), showed a significantly higher percentage of granulocytes present in the airways of DBA/2 than of C57BL/6 mice at days 5 through 14 following infection (Fig. 4). In order to compare histologically the influx of granulocytes in different mouse strains at the level of the entire lung, lung cryosections from mice, infected with M. tuberculosis, were stained with the antigranulocyte antibody RB6-8C5. Many more cells reactive with this antibody were apparent within pocket-like agglomerations in the lungs of DBA/2 and CBA/J than in those of C57BL/6 and BALB/c mice after 28 days of infection (Fig. 5), confirming a substantial difference in the composition of cellular infiltrations between the strains (44). Of note, the morphology of cells reactive with RB6-8C5 was clearly granulocytic in C57BL/6, BALB/c, and CBA/J mice, while a large proportion of cells staining positive with this antibody in DBA/2 mice appeared in aggregated clusters and had a larger cytoplasm-to-nucleus ratio, indicating either aberrant differentiation or accelerated degeneration of RB6-8C5-positive cells in this mouse strain.


Figure 4
View larger version (31K):
[in this window]
[in a new window]
  		FIG. 4. Early enhanced recruitment of granulocytes into the bronchoalveolar space in susceptible mouse strains infected with M. tuberculosis. C57BL/6 and DBA/2 mice were infected aerogenically with ~1,000 CFU/mouse M. tuberculosis (H37Rv). Lungs were washed five times each at indicated time points, and lavage cells were analyzed flow cytometrically using the FITC-labeled anti-Ly6G antibody RB6-8C5 (Gr1). Granulocytes were determined as Gr1-positive cells in region 1 (R1, A). The number of recovered cells was between 3 x 105 and 6 x 105 depending on the time of infection. Mean percentages of granulocytes from C57BL/6 (white bars) and DBA/2 (black bars) as defined by Gr1-positive cells in R1 are shown (B). Means of two to four independent determinations (±SD) are shown. *, P ≤ 0.05; **, P ≤ 0.01.

To investigate whether RB6-8C5-positive cells of susceptible mouse strains are generally more disposed to extravasate in response to inflammatory stimuli, we inoculated M. tuberculosis into the peritoneal cavity of the different mouse strains. After 1, 2, 3, and 4 h, the peritoneal cavity was rinsed and cells analyzed by flow cytometry. In susceptible strains, significantly more granulocytes were recruited after infection than in resistant strains over this time period (Fig. 6A). This response was specific for the stimulus (viable M. tuberculosis), since instillation of thioglycolate or even single chemoattractive agents did not reveal any differences between resistant and susceptible strains 3 h after application of the stimuli (Fig. 6B).


Figure 6
View larger version (22K):
[in this window]
[in a new window]
  		FIG. 6. Early and enhanced recruitment of granulocytes in peritoneal exudates of susceptible mice. (A) DBA/2 (black bars), CBA/J (dark-gray bars), BALB/c (light-gray bars), or C57BL/6 (white bars) mice were infected intraperitoneally with 2.5 x 107 CFU M. tuberculosis (H37Rv). After 1, 2, 3, and 4 h, peritoneal cavities were washed with prewarmed PBS. (B) DBA/2 (black bars) or C57BL/6 (white bars) mice were injected with neutrophil chemoattractants NAP 2, LIX, and thioglycolate. After 3 h, peritoneal cavities were washed with prewarmed PBS. Granulocyte detection was performed flow cytometrically using the FITC-labeled anti-Ly6G antibody RB6-8C5. The total number of recovered cells was between 2 x 106 and 7 x 106 cells/ml depending on the time after infection. Means of triplicate determinations (±SD) are shown. n.s., not significant; ***, P ≤ 0.001.

Depletion of granulocytes significantly prolongs survival of M. tuberculosis-infected susceptible mouse strains. In order to evaluate whether the enhanced influx of granulocytes into the lungs of M. tuberculosis-infected susceptible mice was functionally relevant for the accelerated death of these mice, granulocytes were depleted by two different regimens in vivo and infection outcome was monitored in DBA/2 and C57BL/6 mice. Using a low dose of aerosol infection with M. tuberculosis (100 CFU), results were inconsistent: in one experiment the susceptible DBA/2 mice lived significantly longer following granulocyte depletion than their untreated, infected littermates; in another experiment, the difference between the two groups did not reach statistical significance (data not shown). When a larger inoculum was used, similar to the one employed during our microarray studies (1,000 CFU), the life span of M. tuberculosis-infected granulocyte-depleted DBA/2 mice was significantly prolonged (mean survival following RB6-8C5 treatment: 100 days) in comparison to IgG control-treated infected DBA/2 mice (mean survival: 30 days; P ≤ 0.01) (Fig. 7). In contrast, no difference in survival was observed between granulocyte-depleted and nondepleted mice when the resistant strain C57BL/6 was examined during M. tuberculosis infection (Fig. 7). Similar results were obtained when anti-GCSF infusion was used to deplete granulocytes. Thus, the presence of granulocytes is associated with accelerated death in a prototype susceptible, but not in a resistant, mouse strain infected with M. tuberculosis.


Figure 7
View larger version (19K):
[in this window]
[in a new window]
  		FIG. 7. Depletion of granulocytes during M. tuberculosis infection prolongs survival only in susceptible mice. DBA/2 (A, C) and C57BL/6 (B, D) mice were depleted of granulocytes by intraperitoneal injection of either RB6-8C5 (A, B) antibody or a sheep anti-GCSF antiserum (C, D) (unfilled circles). As control, mice were injected with the appropriate IgG (filled circles). Subsequently, DBA/2 mice were aerogenically infected with 1,009 CFU (RB6-8C5) or 880 CFU (aGCSF) and C57BL/6 mice with 541 CFU (RB6-8C5) or 1,093 CFU (aGCSF) M. tuberculosis (H37Rv) (5 to 10 mice per group) and observed daily for weight loss. Moribund mice were sacrificed. n.s., not significant; d, day; *, P ≤ 0.05; **, P ≤ 0.01.


arrow
DISCUSSION
 
In an earlier microarray study with M. tuberculosis-infected bone marrow-derived macrophages from resistant and susceptible mouse strains, we had found a number of genes highly regulated only in susceptible mice that were involved in granulocyte function and tissue destruction (35). The present study shows that the differential susceptibilities to tuberculosis of different mouse strains can indeed be correlated with the differential expression of several genes involved in granulocyte recruitment, activation, and function. Consequently, depletion of granulocytes resulted in significantly enhanced survival only in a susceptible, but not in a resistant, mouse strain infected with M. tuberculosis. We conclude that susceptibility to tuberculosis is determined to a significant extent by the early influx of granulocytes.

Other investigators using a strategy similar to ours have previously reported on gene expression in infected organs with similarly large (1,000 CFU) or even larger (up to 105 CFU) inocula of M. tuberculosis (5, 52, 57). We also performed experiments with lower doses of infection (100 CFU) but failed to detect significant changes in gene expression during early time points of infection (data not shown). This is likely due to the relatively low sensitivity of microarray-based analyses of entire organs and to the stringent criteria of microarray data interpretation employed here: only genes which were regulated more than twofold in both susceptible, or both resistant, or in all four mouse strains were scored as "significantly regulated", thereby excluding genetic idiosyncrasies of any individual mouse strain.

Some of the genes regulated differentially in the mouse strains examined merit further discussion. LIX is chemotactic for neutrophils in vitro (69) and was shown to contribute to neutrophil accumulation in the myocardium in a rat model of ischemia-reperfusion injury (14). LIX mRNA is expressed in various tissues, including the lungs (54). In humans there are two homologues of LIX, epithelial cell-derived neutrophil-activating peptide 78 and granulocyte chemotactic protein 2 (61). Two other chemokines, CXCL10 and CCL7, are mostly known for their activity in attracting monocytes and T cells (70, 71). However, these chemokines were previously shown to also orchestrate oxidative stress-induced neutrophilic lung inflammation in a murine ozone exposure model (45).

IL-17 is a 32-kDa dimeric cytokine with proinflammatory properties that is mostly produced by activated T cells (31) and which signals through a type 1 transmembrane receptor. IL-17 supports hematopoiesis, which results in maturation of cells along the granulocyte pathway (36). Under several conditions, including airway inflammation, rheumatoid arthritis, and intraperitoneal abscesses (39, 41), IL-17 levels are increased. Interestingly, IL-17 also induces LIX (granulocyte chemotactic protein 2) in granulocytes, suggesting a potential feedback loop (51). In IL17R–/– mice, recruitment of neutrophils into tissues and into the peritoneal cavity is inhibited after infection with Toxoplasma gondii (36). Furthermore, Laan et al. showed that human IL-17 can specifically and selectively recruit neutrophils into the airways via the release of CXC chemokines from bronchial epithelial cells (39).

One major role of phosphoinositide kinase 3 (PI3K) isoforms is to support chemoattractant-directed migration of neutrophils into sites of inflammation (27, 56). For example, the isoform Pik3{delta} plays an essential role in neutrophil directional movement and migration but not in random movement (55). for p110{gamma}-null mice, recruitment of neutrophils into inflamed tissues was reduced by more than 60% compared to results with wild-type controls (40). It bears mentioning that PI3K may also play a role in tuberculosis infection, because it is essential for the production of PI3-phosphate on phagosomes in vivo that assists phagosome maturation (66). Neutrophil cytosolic factor 4 (Ncf4 or p40phox) is a cytosolic regulatory component of the superoxide-producing phagocyte NADPH-oxidase (38), a multicomponent enzyme system important for host defenses in microbial infections. Accurate regulation of this enzyme is very important, because its reactive oxygen species can cause massive toxic tissue injury (67). Taken together, the coordinate regulation of a number of genes predominantly in susceptible mouse strains suggests that the latter have a preprogrammed signature response to M. tuberculosis infection that is biased toward granulocyte hyperreactivity. This is also borne out by our observation that granulocyte accumulation occurred much faster not only in the bronchioalveolar space but also in the peritoneum of susceptible mouse strains following M. tuberculosis challenge.

CCL8, regulated exclusively in resistant mice, displays chemotactic activity mostly for monocytes, lymphocytes, and eosinophils (65). Similarly, the production, differentiation, and function of macrophages are controlled to a large extent by colony-stimulating factor 1 (63), the receptor for which was highly induced in resistant mouse strains in response to M. tuberculosis infection. In addition, lymphotoxin ß—regulated only in resistant mice—is a component of the heterotrimeric lymphotoxin {alpha}/ß complex whose binding to the lymphotoxin ß receptor is critical for the full activation of macrophages for mycobacteriocidal activity (19). Two factors preventing the release of oxidants and proteases from lysosomes in activated myelomonocytic cells, namely granulin and cystatin B, were also exclusively regulated in resistant mice (50, 72). Taken together, the predominant regulation of genes involved in monocyte differentiation, activation, and function, as well as in the partial inhibition of granulocyte activity, suggests that resistant mice have a signature response to M. tuberculosis infection that is geared toward granulomatous inflammation.

In mycobacterial infections, an early accumulation of neutrophils at the site of infection has been well documented (3, 4, 60). A number of previous reports have addressed the possible function of granulocytes in the pathogenesis of mycobacterial disease. In an intravenous infection model with M. tuberculosis, BALB/c mice depleted of granulocytes by intraperitoneal injection of 200 µg RB6-8C5 during the first week of infection showed enhanced bacterial growth, particularly in the liver (49). In an intratracheal infection model with Mycobacterium bovis BCG, C57BL/6 mice depleted of granulocytes by intraperitoneal injection of 500 µg RB6-8C5 during the third week of infection had significantly higher CFU counts of mycobacteria in their lungs than control infected mice injected with rat IgG (22). Along similar lines, LPS-induced neutrophilia in the lungs of rats significantly reduced the growth of M. tuberculosis introduced intratracheally, particularly at 1 to 3 days after LPS treatment (62). Taken together, these studies indicated a protective role of neutrophils in host defense against tuberculosis. In contrast, Seiler et al. used intraperitoneal injection of 100 µg RB6-8C5 to deplete granulocytes in C57BL/6 mice infected aerogenically with M. tuberculosis and found no adverse effect on local control of bacterial replication in the lung nor dissemination into other organs but noted that granulocyte-depleted mice had delayed granuloma formation (58, 59). It is noteworthy that all of the earlier studies with mice, while using different routes of infection, different doses of antibody, and different schedules for granulocyte depletion, focused on the function of granulocytes exclusively in resistant strains.

Recently, a comparative study of resistant A/Sn and susceptible I/St mouse strains revealed an association between a high and prolonged neutrophil accumulation in the lung after intratracheal infection and higher bacterial counts in the lung and accelerated death (20). This is reminiscent of earlier investigations conducted by Medina and North, who documented that neutrophil accumulation in the lungs was associated with susceptibility to tuberculosis in DBA/2 mice (43, 44).

Our study is the first to demonstrate that the early and enhanced influx of RB6-8C5-positive cells is causally involved in the accelerated death of M. tuberculosis-susceptible mice. Having targeted two different mechanisms in order to deplete granulocytes in vivo, we feel confident that the enhanced survival of susceptible mice infected with TB is indeed due to the decreased presence and activity of granulocytes at the site of pulmonary infection. The profound prolongation of survival in granulocyte-depleted DBA/2 mice was reproducible only following a high dose of infection with M. tuberculosis. However, we and other investigators have previously noted that the significance of a single factor, cell, or mechanism for the overall outcome of M. tuberculosis infection can often be demonstrated only in a high-dose model of infection. For example, the roles of TLR2, TLR9, and CCR2 in experimental tuberculosis have become fully evident only when high inocula were employed (5, 52, 57). In addition, because the hypothesis that granulocytes are involved in susceptibility to tuberculosis was generated with a high-dose infection model, we feel justified in validating this hypothesis using a relatively high inoculum of M. tuberculosis.

It is curious that DBA/2 mice, which are known to be deficient in complement component 5, displayed an increase in granulocyte recruitment, rather than a decrease. Other mouse strains deficient in complement component 5, such as the A/J strain, the I/St strain. or a B10.D2 Hco/oSnJ congenic strain, are also known not to develop well-organized mononuclear cell accumulations; granulocytic infiltrations predominating instead (1, 11, 20). In these strains, however, an early reduction in chemokines, such as KC, MIP-2, CXCL10, CCL2, or CCL3, was noted. In our own study, we found no differential gene induction between resistant and susceptible mouse strains with regard to MIP-2, CCL2, or CCL3. In contrast, DBA/2 and CBA/J mice had higher mRNA levels of CXCL5, CXCL10, and KC at day 28 postinfection. These differences may be explained by the complex differences in the genetic background (altogether four different mouse strains), the route of infection (intravenous, intratracheal, or aerosol), the time point of examination (12 days, 3 weeks, or 28 days postinfection), and the different methods used to determine mRNA expression (RT-PCR or microarray) in these studies.

Two modes of action can be envisioned to explain the detrimental role of granulocytes in tuberculosis disease progression. I/St neutrophils were shown to have an increased phagocytic capacity for mycobacteria (20). Since neutrophils are incapable of killing M. tuberculosis, this would provide a "safe haven" for prolonged bacterial multiplication until T-cell-mediated responses are initiated to control further bacterial growth. Alternatively, granulocytes have been implicated in the pathology of many chronic inflammatory conditions (24), and hydrolytic enzymes of neutrophils and inactivated protease inhibitors can be detected in fluids recovered from inflammatory sites (64). Activated granulocytes generate reactive oxygen intermediates and release lytic enzymes (12), which can result in massive toxic and proteolytic tissue damage, precipitating premature death when vital organs, such as the lung in tuberculosis, are affected. Our report does not address which mode of granulocyte action is responsible for the accelerated death of M. tuberculosis-infected susceptible mice, nor need they be mutually exclusive.

In the future, it may be possible to monitor neutrophil activity during early stages of tuberculosis and evaluate whether the magnitude or kinetics of neutrophil responses provide a reliable indicator of disease progression. Indeed, chemokine production by M. tuberculosis-infected human neutrophils has been reported before (53), but no studies have yet been published that indicate the usefulness of this approach in predicting disease severity in patients. Furthermore, some of the genes identified here in the mouse as correlates of susceptibility could be investigated also in humans, and single nucleotide polymorphisms in these genes can now be analyzed in large DNA collections of patient cohorts to determine whether they are associated with susceptibility to tuberculosis (7). Reliable genetic indicators of disease susceptibility may prove particularly useful in reducing the number of vaccinees in future trials required to validate the protective efficacy of novel vaccine strategies.


arrow
ACKNOWLEDGMENTS
 
This work was supported in part by a grant from the Federal Ministry of Education and Research to S.E. (NIE-S05T22) and was performed within the framework of the National Genome Research Network (NGFN-2), Workpackage Tuberculosis.

We thank Stefanie Pfau for expert technical assistance, Gabriele Bentien for purification of RB6-8C5, and Ernst Brandt for fruitful discussions. We are also indebted to Stefan Uhlig for very helpful statistical advice.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Molecular Infection Biology, Research Center Borstel, Parkallee 22, D-23845 Borstel, Germany. Phone: 49-4537-188489. Fax: 49-4537-188686. E-mail: ckeller{at}fz-borstel.de. Back

Editor: J. L. Flynn


arrow
REFERENCES
 
    1
  1. Actor, J. K., E. Breij, R. A. Wetsel, H. Hoffmann, R. L. Hunter, Jr., and C. Jagannath. 2001. A role for complement C5 in organism containment and granulomatous response during murine tuberculosis. Scand. J. Immunol. 53:464-474.[CrossRef][Medline]
    2. 2
  2. Appelberg, R., A. G. Castro, S. Gomes, J. Pedrosa, and M. T. Silva. 1995. Susceptibility of beige mice to Mycobacterium avium: role of neutrophils. Infect. Immun. 63:3381-3387.[Abstract]
    3. 3
  3. Appelberg, R., J. M. Pedrosa, and M. T. Silva. 1991. Host and bacterial factors control the Mycobacterium avium-induced chronic peritoneal granulocytosis in mice. Clin. Exp. Immunol. 83:231-236.[Medline]
    4. 4
  4. Appelberg, R., and M. T. Silva. 1989. T cell-dependent chronic neutrophilia during mycobacterial infections. Clin. Exp. Immunol. 78:478-483.[Medline]
    5. 5
  5. Bafica, A., C. A. Scanga, C. G. Feng, C. Leifer, A. Cheever, and A. Sher. 2005. TLR9 regulates Th1 responses and cooperates with TLR2 in mediating optimal resistance to Mycobacterium tuberculosis. J. Exp. Med. 202:1715-1724.[Abstract/Free Full Text]
    6. 6
  6. Barsig, J., D. S. Bundschuh, T. Hartung, A. Bauhofer, A. Sauer, and A. Wendel. 1996. Control of fecal peritoneal infection in mice by colony-stimulating factors. J. Infect. Dis. 174:790-799.[Medline]
    7. 7
  7. Bellamy, R. 2003. Susceptibility to mycobacterial infections: the importance of host genetics. Genes Immun. 4:4-11.[CrossRef][Medline]
    8. 8
  8. Bellamy, R., N. Beyers, K. P. McAdam, C. Ruwende, R. Gie, P. Samaai, D. Bester, M. Meyer, T. Corrah, M. Collin, D. R. Camidge, D. Wilkinson, E. Hoal-Van Helden, H. C. Whittle, W. Amos, P. van Helden, and A. V. Hill. 2000. Genetic susceptibility to tuberculosis in Africans: a genome-wide scan. Proc. Natl. Acad. Sci. USA 97:8005-8009.[Abstract/Free Full Text]
    9. 9
  9. Bellamy, R., C. Ruwende, T. Corrah, K. P. McAdam, M. Thursz, H. C. Whittle, and A. V. Hill. 1999. Tuberculosis and chronic hepatitis B virus infection in Africans and variation in the vitamin D receptor gene. J. Infect. Dis. 179:721-724.[CrossRef][Medline]
    10. 10
  10. Benjamini, Y., D. Drai, G. Elmer, N. Kafkafi, and I. Golani. 2001. Controlling the false discovery rate in behavior genetics research. Behav. Brain Res. 125:279-284.[CrossRef][Medline]
    11. 11
  11. Borders, C. W., A. Courtney, K. Ronen, M. Pilar Laborde-Lahoz, T. V. Guidry, S. A. Hwang, M. Olsen, R. L. Hunter, Jr., T. J. Hollmann, R. A. Wetsel, and J. K. Actor. 2005. Requisite role for complement C5 and the C5a receptor in granulomatous response to mycobacterial glycolipid trehalose 6,6'-dimycolate. Scand. J. Immunol. 62:123-130.[CrossRef][Medline]
    12. 12
  12. Cassatella, M. A. 1995. The production of cytokines by polymorphonuclear neutrophils. Immunol. Today 16:21-26.[CrossRef][Medline]
    13. 13
  13. Chackerian, A. A., J. M. Alt, T. V. Perera, C. C. Dascher, and S. M. Behar. 2002. Dissemination of Mycobacterium tuberculosis is influenced by host factors and precedes the initiation of T-cell immunity. Infect. Immun. 70:4501-4509.[Abstract/Free Full Text]
    14. 14
  14. Chandrasekar, B., J. B. Smith, and G. L. Freeman. 2001. Ischemia-reperfusion of rat myocardium activates nuclear factor-KappaB and induces neutrophil infiltration via lipopolysaccharide-induced CXC chemokine. Circulation 103:2296-2302.[Abstract/Free Full Text]
    15. 15
  15. Cooper, A. M., A. Kipnis, J. Turner, J. Magram, J. Ferrante, and I. M. Orme. 2002. Mice lacking bioactive IL-12 can generate protective, antigen-specific cellular responses to mycobacterial infection only if the IL-12 p40 subunit is present. J. Immunol. 168:1322-1327.[Abstract/Free Full Text]
    16. 16
  16. Curran-Everett, D. 2000. Multiple comparisons: philosophies and illustrations. Am. J. Physiol. Regul. Integr. Comp. Physiol. 279:R1-R8.[Abstract/Free Full Text]
    17. 17
  17. de Jong, R., F. Altare, I. A. Haagen, D. G. Elferink, T. Boer, P. J. Breda Vriesman, P. J. Kabel, J. M. Draaisma, J. T. van Dissel, F. P. Kroon, J. L. Casanova, and T. H. Ottenhoff. 1998. Severe mycobacterial and Salmonella infections in interleukin-12 receptor-deficient patients. Science 280:1435-1438.[Abstract/Free Full Text]
    18. 18
  18. Dye, C., S. Scheele, P. Dolin, V. Pathania, and M. C. Raviglione. 1999. Consensus statement. Global burden of tuberculosis: estimated incidence, prevalence, and mortality by country. WHO Global Surveillance and Monitoring Project. JAMA 282:677-686.[Abstract/Free Full Text]
    19. 19
  19. Ehlers, S., C. Holscher, S. Scheu, C. Tertilt, T. Hehlgans, J. Suwinski, R. Endres, and K. Pfeffer. 2003. The lymphotoxin beta receptor is critically involved in controlling infections with the intracellular pathogens Mycobacterium tuberculosis and Listeria monocytogenes. J. Immunol. 170:5210-5218.[Abstract/Free Full Text]
    20. 20
  20. Eruslanov, E. B., I. V. Lyadova, T. K. Kondratieva, K. B. Majorov, I. V. Scheglov, M. O. Orlova, and A. S. Apt. 2005. Neutrophil responses to Mycobacterium tuberculosis infection in genetically susceptible and resistant mice. Infect. Immun. 73:1744-1753.[Abstract/Free Full Text]
    21. 21
  21. Fleming, T. J., M. L. Fleming, and T. R. Malek. 1993. Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow. RB6-8C5 mAb to granulocyte-differentiation antigen (Gr-1) detects members of the Ly-6 family. J. Immunol. 151:2399-2408.[Abstract]
    22. 22
  22. Fulton, S. A., S. M. Reba, T. D. Martin, and W. H. Boom. 2002. Neutrophil-mediated mycobacteriocidal immunity in the lung during Mycobacterium bovis BCG infection in C57BL/6 mice. Infect. Immun. 70:5322-5327.[Abstract/Free Full Text]
    23. 23
  23. Garred, P., M. Harboe, T. Oettinger, C. Koch, and A. Svejgaard. 1994. Dual role of mannan-binding protein in infections: another case of heterosis? Eur. J. Immunogenet. 21:125-131.[Medline]
    24. 24
  24. Geerts, L., P. G. Jorens, J. Willems, M. De Ley, and H. Slegers. 2001. Natural inhibitors of neutrophil function in acute respiratory distress syndrome. Crit. Care Med. 29:1920-1924.[CrossRef][Medline]
    25. 25
  25. Gruppo, V., O. C. Turner, I. M. Orme, and J. Turner. 2002. Reduced up-regulation of memory and adhesion/integrin molecules in susceptible mice and poor expression of immunity to pulmonary tuberculosis. Microbiology 148:2959-2966.[Abstract/Free Full Text]
    26. 26
  26. Gupta, R., M. A. Espinal, and M. C. Raviglione. 2004. Tuberculosis as a major global health problem in the 21st century: a WHO perspective. Semin. Respir. Crit. Care Med. 25:245-253.[CrossRef][Medline]
    27. 27
  27. Hannigan, M. O., C. K. Huang, and D. Q. Wu. 2004. Roles of PI3K in neutrophil function. Curr. Top. Microbiol. Immunol. 282:165-175.[Medline]
    28. 28
  28. Hestdal, K., F. W. Ruscetti, J. N. Ihle, S. E. Jacobsen, C. M. Dubois, W. C. Kopp, D. L. Longo, and J. R. Keller. 1991. Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells. J. Immunol. 147:22-28.[Abstract]
    29. 29
  29. Hill, A. V. 1998. The immunogenetics of human infectious diseases. Annu. Rev. Immunol. 16:593-617.[CrossRef][Medline]
    30. 30
  30. Holscher, C., R. A. Atkinson, B. Arendse, N. Brown, E. Myburgh, G. Alber, and F. Brombacher. 2001. A protective and agonistic function of IL-12p40 in mycobacterial infection. J. Immunol. 167:6957-6966.[Abstract/Free Full Text]
    31. 31
  31. Infante-Duarte, C., H. F. Horton, M. C. Byrne, and T. Kamradt. 2000. Microbial lipopeptides induce the production of IL-17 in Th cells. J. Immunol. 165:6107-6115.[Abstract/Free Full Text]
    32. 32
  32. Jepson, A., A. Fowler, W. Banya, M. Singh, S. Bennett, H. Whittle, and A. V. Hill. 2001. Genetic regulation of acquired immune responses to antigens of Mycobacterium tuberculosis: a study of twins in West Africa. Infect. Immun. 69:3989-3994.[Abstract/Free Full Text]
    33. 33
  33. Kasahara, K., I. Sato, K. Ogura, H. Takeuchi, K. Kobayashi, and M. Adachi. 1998. Expression of chemokines and induction of rapid cell death in human blood neutrophils by Mycobacterium tuberculosis. J. Infect. Dis. 178:127-137.[Medline]
    34. 34
  34. Kaufmann, S. H. 2005. Recent findings in immunology give tuberculosis vaccines a new boost. Trends Immunol. 26:660-667.[CrossRef][Medline]
    35. 35
  35. Keller, C., J. Lauber, A. Blumenthal, J. Buer, and S. Ehlers. 2004. Resistance and susceptibility to tuberculosis analysed at the transcriptome level: lessons from mouse macrophages. Tuberculosis (Edinbourgh) 84:144-158.
    36. 36
  36. Kelly, M. N., J. K. Kolls, K. Happel, J. D. Schwartzman, P. Schwarzenberger, C. Combe, M. Moretto, and I. A. Khan. 2005. Interleukin-17/interleukin-17 receptor-mediated signaling is important for generation of an optimal polymorphonuclear response against Toxoplasma gondii infection. Infect. Immun. 73:617-621.[Abstract/Free Full Text]
    37. 37
  37. Kramnik, I., W. F. Dietrich, P. Demant, and B. R. Bloom. 2000. Genetic control of resistance to experimental infection with virulent Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 97:8560-8565.[Abstract/Free Full Text]
    38. 38
  38. Kuribayashi, F., H. Nunoi, K. Wakamatsu, S. Tsunawaki, K. Sato, T. Ito, and H. Sumimoto. 2002. The adaptor protein p40(phox) as a positive regulator of the superoxide-producing phagocyte oxidase. EMBO J. 21:6312-6320.[CrossRef][Medline]
    39. 39
  39. Laan, M., Z. H. Cui, H. Hoshino, J. Lotvall, M. Sjostrand, D. C. Gruenert, B. E. Skoogh, and A. Linden. 1999. Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J. Immunol. 162:2347-2352.[Abstract/Free Full Text]
    40. 40
  40. Li, Z., H. Jiang, W. Xie, Z. Zhang, A. V. Smrcka, and D. Wu. 2000. Roles of PLC-beta2 and -beta3 and PI3Kgamma in chemoattractant-mediated signal transduction. Science 287:1046-1049.[Abstract/Free Full Text]
    41. 41
  41. Linden, A. 2003. Rationale for targeting interleukin-17 in the lungs. Curr. Opin. Investig. Drugs 4:1304-1312.[Medline]
    42. 42
  42. Lio, D., V. Marino, A. Serauto, V. Gioia, L. Scola, A. Crivello, G. I. Forte, G. Colonna-Romano, G. Candore, and C. Caruso. 2002. Genotype frequencies of the +874T->A single nucleotide polymorphism in the first intron of the interferon-gamma gene in a sample of Sicilian patients affected by tuberculosis. Eur. J. Immunogenet. 29:371-374.[CrossRef][Medline]
    43. 43
  43. Medina, E., and R. J. North. 1998. Resistance ranking of some common inbred mouse strains to Mycobacterium tuberculosis and relationship to major histocompatibility complex haplotype and Nramp1 genotype. Immunology 93:270-274.[CrossRef][Medline]
    44. 44
  44. Medina, E., and R. J. North. 1999. Genetically susceptible mice remain proportionally more susceptible to tuberculosis after vaccination. Immunology 96:16-21.[CrossRef][Medline]
    45. 45
  45. Michalec, L., B. K. Choudhury, E. Postlethwait, J. S. Wild, R. Alam, M. Lett-Brown, and S. Sur. 2002. CCL7 and CXCL10 orchestrate oxidative stress-induced neutrophilic lung inflammation. J. Immunol. 168:846-852.[Abstract/Free Full Text]
    46. 46
  46. Mitsos, L. M., L. R. Cardon, L. Ryan, R. LaCourse, R. J. North, and P. Gros. 2003. Susceptibility to tuberculosis: a locus on mouse chromosome 19 (Trl-4) regulates Mycobacterium tuberculosis replication in the lungs. Proc. Natl. Acad. Sci. USA 100:6610-6615.[Abstract/Free Full Text]
    47. 47
  47. Mombo, L. E., C. Y. Lu, S. Ossari, I. Bedjabaga, L. Sica, R. Krishnamoorthy, and C. Lapoumeroulie. 2003. Mannose-binding lectin alleles in sub-Saharan Africans and relation with susceptibility to infections. Genes Immun. 4:362-367.[CrossRef][Medline]
    48. 48
  48. Pan, H., B. S. Yan, M. Rojas, Y. V. Shebzukhov, H. Zhou, L. Kobzik, D. E. Higgins, M. J. Daly, B. R. Bloom, and I. Kramnik. 2005. Ipr1 gene mediates innate immunity to tuberculosis. Nature 434:767-772.[CrossRef][Medline]
    49. 49
  49. Pedrosa, J., B. M. Saunders, R. Appelberg, I. M. Orme, M. T. Silva, and A. M. Cooper. 2000. Neutrophils play a protective nonphagocytic role in systemic Mycobacterium tuberculosis infection of mice. Infect. Immun. 68:577-583.[Abstract/Free Full Text]
    50. 50
  50. Pol, E., and I. Bjork. 2003. Contributions of individual residues in the N-terminal region of cystatin B (stefin B) to inhibition of cysteine proteinases. Biochim. Biophys. Acta 1645:105-112.[Medline]
    51. 51
  51. Prause, O., M. Laan, J. Lotvall, and A. Linden. 2003. Pharmacological modulation of interleukin-17-induced GCP-2-, GRO-alpha- and interleukin-8 release in human bronchial epithelial cells. Eur. J. Pharmacol. 462:193-198.[CrossRef][Medline]
    52. 52
  52. Reiling, N., C. Holscher, A. Fehrenbach, S. Kroger, C. J. Kirschning, S. Goyert, and S. Ehlers. 2002. Cutting edge: Toll-like receptor (TLR)2- and TLR4-mediated pathogen recognition in resistance to airborne infection with Mycobacterium tuberculosis. J. Immunol. 169:3480-3484.[Abstract/Free Full Text]
    53. 53
  53. Riedel, D. D., and S. H. Kaufmann. 1997. Chemokine secretion by human polymorphonuclear granulocytes after stimulation with Mycobacterium tuberculosis and lipoarabinomannan. Infect. Immun. 65:4620-4623.[Abstract]
    54. 54
  54. Rovai, L. E., H. R. Herschman, and J. B. Smith. 1998. The murine neutrophil-chemoattractant chemokines LIX, KC, and MIP-2 have distinct induction kinetics, tissue distributions, and tissue-specific sensitivities to glucocorticoid regulation in endotoxemia. J. Leukoc. Biol. 64:494-502.[Abstract]
    55. 55
  55. Sadhu, C., B. Masinovsky, K. Dick, C. G. Sowell, and D. E. Staunton. 2003. Essential role of phosphoinositide 3-kinase delta in neutrophil directional movement. J. Immunol. 170:2647-2654.[Abstract/Free Full Text]
    56. 56
  56. Sasaki, T., J. Irie-Sasaki, R. G. Jones, A. J. Oliveira-dos-Santos, W. L. Stanford, B. Bolon, A. Wakeham, A. Itie, D. Bouchard, I. Kozieradzki, N. Joza, T. W. Mak, P. S. Ohashi, A. Suzuki, and J. M. Penninger. 2000. Function of PI3Kgamma in thymocyte development, T cell activation, and neutrophil migration. Science 287:1040-1046.[Abstract/Free Full Text]
    57. 57
  57. Scott, H. M., and J. L. Flynn. 2002. Mycobacterium tuberculosis in chemokine receptor 2-deficient mice: influence of dose on disease progression. Infect. Immun. 70:5946-5954.[Abstract/Free Full Text]
    58. 58
  58. Seiler, P., P. Aichele, S. Bandermann, A. E. Hauser, B. Lu, N. P. Gerard, C. Gerard, S. Ehlers, H. J. Mollenkopf, and S. H. Kaufmann. 2003. Early granuloma formation after aerosol Mycobacterium tuberculosis infection is regulated by neutrophils via CXCR3-signaling chemokines. Eur. J. Immunol. 33:2676-2686.[CrossRef][Medline]
    59. 59
  59. Seiler, P., P. Aichele, B. Raupach, B. Odermatt, U. Steinhoff, and S. H. Kaufmann. 2000. Rapid neutrophil response controls fast-replicating intracellular bacteria but not slow-replicating Mycobacterium tuberculosis. J. Infect. Dis. 181:671-680.[CrossRef][Medline]
    60. 60
  60. Silva, M. T., M. N. Silva, and R. Appelberg. 1989. Neutrophil-macrophage cooperation in the host defence against mycobacterial infections. Microb. Pathog. 6:369-380.[CrossRef][Medline]
    61. 61
  61. Smith, J. B., D. J. Wadleigh, Y. R. Xia, R. A. Mar, H. R. Herschman, and A. J. Lusis. 2002. Cloning and genomic localization of the murine LPS-induced CXC chemokine (LIX) gene, Scyb5. Immunogenetics 54:599-603.[CrossRef][Medline]
    62. 62
  62. Sugawara, I., T. Udagawa, and H. Yamada. 2004. Rat neutrophils prevent the development of tuberculosis. Infect. Immun. 72:1804-1806.[Abstract/Free Full Text]
    63. 63
  63. Sweet, M. J., and D. A. Hume. 2003. CSF-1 as a regulator of macrophage activation and immune responses. Arch. Immunol. Ther. Exp. (Warsaw) 51:169-177.
    64. 64
  64. Tonnel, A. B., P. Gosset, and I. Tillie-Leblond. 2001. Characteristics of the inflammatory response in bronchial lavage fluids from patients with status asthmaticus. Int. Arch. Allergy Immunol. 124:267-271.[CrossRef][Medline]
    65. 65
  65. Uguccioni, M., M. D'Apuzzo, M. Loetscher, B. Dewald, and M. Baggiolini. 1995. Actions of the chemotactic cytokines MCP-1, MCP-2, MCP-3, RANTES, MIP-1 alpha and MIP-1 beta on human monocytes. Eur. J. Immunol. 25:64-68.[Medline]
    66. 66
  66. Vergne, I., J. Chua, and V. Deretic. 2003. Tuberculosis toxin blocking phagosome maturation inhibits a novel Ca2+/calmodulin-PI3K hVPS34 cascade. J. Exp. Med. 198:653-659.[Abstract/Free Full Text]
    67. 67
  67. Weiss, S. J. 1989. Tissue destruction by neutrophils. N. Engl. J. Med. 320:365-376.[Medline]
    68. 68
  68. Wilkinson, R. J., M. Llewelyn, Z. Toossi, P. Patel, G. Pasvol, A. Lalvani, D. Wright, M. Latif, and R. N. Davidson. 2000. Influence of vitamin D deficiency and vitamin D receptor polymorphisms on tuberculosis among Gujarati Asians in west London: a case-control study. Lancet 355:618-621.[CrossRef][Medline]
    69. 69
  69. Wuyts, A., A. Haelens, P. Proost, J. P. Lenaerts, R. Conings, G. Opdenakker, and J. Van Damme. 1996. Identification of mouse granulocyte chemotactic protein-2 from fibroblasts and epithelial cells. Functional comparison with natural KC and macrophage inflammatory protein-2. J. Immunol. 157:1736-1743.[Abstract]
    70. 70
  70. Xu, L. L., D. W. McVicar, A. Ben Baruch, D. B. Kuhns, J. Johnston, J. J. Oppenheim, and J. M. Wang. 1995. Monocyte chemotactic protein-3 (MCP3) interacts with multiple leukocyte receptors: binding and signaling of MCP3 through shared as well as unique receptors on monocytes and neutrophils. Eur. J. Immunol. 25:2612-2617.[Medline]
    71. 71
  71. Zeng, X., T. A. Moore, M. W. Newstead, J. C. Deng, N. W. Lukacs, and T. J. Standiford. 2005. IP-10 mediates selective mononuclear cell accumulation and activation in response to intrapulmonary transgenic expression and during adenovirus-induced pulmonary inflammation. J. Interferon Cytokine Res. 25:103-112.[CrossRef][Medline]
    72. 72
  72. Zhu, J., C. Nathan, W. Jin, D. Sim, G. S. Ashcroft, S. M. Wahl, L. Lacomis, H. Erdjument-Bromage, P. Tempst, C. D. Wright, and A. Ding. 2002. Conversion of proepithelin to epithelins: roles of SLPI and elastase in host defense and wound repair. Cell 111:867-878.[CrossRef][Medline]

Infection and Immunity, July 2006, p. 4295-4309, Vol. 74, No. 7
0019-9567/06/$08.00+0     doi:10.1128/IAI.00057-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Pichugin, A. V., Yan, B.-S., Sloutsky, A., Kobzik, L., Kramnik, I. (2009). Dominant Role of the sst1 Locus in Pathogenesis of Necrotizing Lung Granulomas during Chronic Tuberculosis Infection and Reactivation in Genetically Resistant Hosts. Am. J. Pathol. 174: 2190-2201 [Abstract] [Full Text]  
  • Marquis, J.-F., LaCourse, R., Ryan, L., North, R. J., Gros, P. (2009). Genetic and Functional Characterization of the Mouse Trl3 Locus in Defense against Tuberculosis. J. Immunol. 182: 3757-3767 [Abstract] [Full Text]  
  • Hogan, L. H., Heninger, E., Elsner, R. A., Vonderheid, H. A., Hulseberg, P., Co, D., Sandor, M. (2007). Requirements for CD4+ T cell levels in acute Mycobacterium bovis strain bacille Calmette Guerin (BCG)-induced granulomas differ for optimal mycobacterial control versus granuloma formation. Int Immunol 19: 627-633 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Keller, C.
Right arrow Articles by Ehlers, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Keller, C.
Right arrow Articles by Ehlers, S.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»