IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harris, T. H.
Right arrow Articles by Paulnock, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harris, T. H.
Right arrow Articles by Paulnock, D. M.

 Previous Article  |  Next Article 

Infection and Immunity, August 2006, p. 4530-4537, Vol. 74, No. 8
0019-9567/06/$08.00+0     doi:10.1128/IAI.01938-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Signal Transduction, Gene Transcription, and Cytokine Production Triggered in Macrophages by Exposure to Trypanosome DNA

Tajie H. Harris,1 Nicole M. Cooney,1 John M. Mansfield,2 and Donna M. Paulnock1*

Department of Medical Microbiology and Immunology, University of Wisconsin Medical School of Medicine and Public Health,1 the Bacteriology Department, University of Wisconsin—Madison, Madison, Wisconsin 537062

Received 28 November 2005/ Returned for modification 20 January 2006/ Accepted 15 May 2006


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activation of a type I cytokine response is important for early resistance to infection with Trypanosoma brucei rhodesiense, the extracellular protozoan parasite that causes African sleeping sickness. The work presented here demonstrates that trypanosome DNA activates macrophages to produce factors that may contribute to this response. Initial results demonstrated that T. brucei rhodesiense DNA was present in the plasma of C57BL/6 and C57BL/6-scid mice following infection. Subsequently, the effect of trypanosome DNA on macrophages was investigated; parasite DNA was found to be less stimulatory than Escherichia coli DNA but more stimulatory than murine DNA, as predicted by the CG dinucleotide content. Trypanosome DNA stimulated the induction of a signal transduction cascade associated with Toll-like receptor signaling in RAW 264.7 macrophage cells. The signaling cascade led to expression of mRNAs, including interleukin-12 (IL-12) p40, IL-6, IL-10, cyclooxygenase-2, and beta interferon. The treatment of RAW 264.7 cells and bone marrow-derived macrophages with trypanosome DNA induced the production of NO, prostaglandin E2, and the cytokines IL-6, IL-10, IL-12, and tumor necrosis factor alpha. In all cases, DNase I treatment of T. brucei rhodesisense DNA abolished the activation. These results suggest that T. brucei rhodesiense DNA serves as a ligand for innate immune cells and may play an important contributory role in early stimulation of the host immune response during trypanosomiasis.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Detection of pathogens by the innate immune system is essential for early protection against microbes and for establishment of an effective adaptive immune response. Innate immune cells, such as macrophages, are able to sense the presence of microbial invaders through germ line-encoded pattern recognition receptors (PRRs), such as the Toll-like receptors (TLRs). Interaction between microbial ligands, known as pathogen-associated molecular patterns (PAMPs), and the PRRs leads to the activation of innate immune cells, which globally influences the immune response (23). Macrophage activation leads to the production of reactive oxygen and nitrogen species that effectively limit pathogen survival (12). Further, the activation of macrophages and dendritic cells also serves to enhance the adaptive immune response through the production of polarizing cytokines, such as interleukin-12 (IL-12), as well as by the presentation of antigenic peptides to T cells (22, 46). To date, many PAMPs have been identified, including molecules such as lipopolysaccharide, bacterial lipoproteins, flagellin, and CpG DNA; the majority of these ligands are derived from bacterial and viral pathogens. However, the PAMPs responsible for innate immune activation in response to pathogenic, protozoan parasites remain largely uncharacterized and are currently the subject of considerable interest (1).

The extracellular protozoan parasite Trypanosoma brucei rhodesiense is a causative agent of African sleeping sickness in humans. Relative long-term resistance to this disease is mediated by host B-cell responses to the trypanosome variant surface glycoprotein (VSG) and a polarized T helper 1 (TH1) cell response that leads to the production of high levels of gamma interferon (IFN-{gamma}) (17, 30, 39). Mice lacking the ability to make IFN-{gamma} are highly susceptible to infection, suggesting that IFN-{gamma}-dependent immune responses, such as macrophage activation, are required for resistance to disease (17). While the ability of infected hosts to mount a polarized TH1 cell response appears to be a significant component of host resistance, the trypanosome molecules influencing this polarization are not yet clear. Recent evidence suggests that the TH1 polarization is myeloid differentiation factor 88 dependent and that induction of this cytokine environment in infected animals is partially TLR9 dependent (8).

Several parasite molecules may be important in inducing early macrophage activation events and in shaping the host immune response. One such molecule is the glycosylphosphatidylinositol (GPI) membrane anchor of the trypanosome VSG molecules (29, 38). During infection, a membrane-associated GPI-phospholipase C enzymatically cleaves the GPI anchor of VSG molecules in the surface coat, resulting in release of soluble VSG (sVSG) with its glycosylinositolphosphate residues into the serum (5, 7). Previously, sVSG has been demonstrated to induce the expression of several proinflammatory cytokines as well as to inhibit IFN-{gamma}-induced activation events in RAW 264.7 cells (5, 34).

Attention primarily has been focused on the ability of sVSG GPI elements to activate macrophages in trypanosomiasis; however, the role of other parasite molecules in macrophage activation and type I polarization remains unclear. One PAMP identified in viral and bacterial pathogens is unmethylated CpG DNA, which is recognized by TLR9 (16, 28). CpG DNA has been shown to activate innate immune cells and stimulate a TH1 polarization of an immune response to these pathogens (25). The involvement of TLR9 in the TH1 response suggests a potential role for trypanosome DNA in activating the innate immune system during trypanosome infections (8). An earlier study showed that Trypanosoma brucei brucei DNA stimulates bovine macrophages to produce tumor necrosis factor alpha (TNF-{alpha}), IL-12, and NO and was the first to describe a potential PRR-mediated stimulatory activity for protozoan parasite DNA (3). Trypanosomes have two organelles containing DNA, the nucleus and kinetoplast. Trypanosome DNA has been reported to have very low levels of cytosine methylation, and initial characterization of the frequency of the CG dinucleotide suggests it is only slightly underrepresented in comparison with bacterial genomes (11, 42, 44).

In the present study, we have extended these preliminary observations to include a thorough examination of the immunomodulatory potential of T. brucei rhodesiense DNA using an experimental murine model system. Cell-free trypanosome DNA was detected in the plasma of both wild-type and scid mice during infection. Our mathematical analysis showed that the CG frequency of T. brucei rhodesiense DNA was higher than previously reported. As predicted, T. brucei rhodesiense DNA was more stimulatory than host DNA and less stimulatory than Escherichia coli DNA based on the CG frequency of the trypanosome genome. Trypanosome DNA also induced a signal transduction cascade, activated gene expression, and induced production of immunomodulatory molecules. Overall, our data demonstrate that T. brucei rhodesiense DNA is a stimulatory ligand for macrophages. We speculate that the innate immune response of macrophages to trypanosome DNA during infection may help play a role in early resistance and in shaping the adaptive immune response to parasite antigens.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Trypanosomes and DNA preparations. Frozen stabilates of the T. brucei rhodesiense clone LouTat 1 were thawed and expanded in cyclophosphamide (300 mg/kg) immunosuppressed Swiss Webster mice (Jackson Laboratory, Bar Harbor, ME), as previously described (34). Wild-type C57BL/6 and C57BL/6-scid mice (Jackson Laboratory) were injected intraperitoneally with 1 x 105 trypanosomes to establish infections for purposes of monitoring trypanosome DNA in plasma during infection. All mice used in this study were housed in University-approved facilities and were handled strictly according to National Institutes of Health and University of Wisconsin—Madison Research Animal Resource Center guidelines.

For trypanosome DNA preparations, parasites were isolated from the blood and enumerated using a hemacytometer, as previously described (5). Trypanosomes were resuspended at 1 x 109 cells/ml in TES (50 mM Tris, 20 mM EDTA, 50 mM NaCl). The parasites were lysed with SDS (sodium dodecyl sulfate; final concentration, 1%), treated with 20 µg/ml RNase A (all from Sigma-Aldrich, St. Louis, MO) to remove RNA, and digested with 1 mg/ml pronase (Roche, Indianapolis, IN) to remove proteins. Following a 1-h incubation at 37°C, the DNA was subjected to phenol-chloroform extraction, ethanol precipitation, and 75% ethanol washes (42). The resulting DNA was resuspended in serum-free media (RPMI 1640, see below), filter sterilized, and frozen at –20°C. Murine DNA was isolated from total spleen cells using a similar procedure. The DNA concentration was measured by spectrophotometry. To assess purity, each DNA preparation was subjected to SDS-PAGE (polyacrylamide gel electrophoresis) followed by silver staining. For DNase treatment, the DNA was digested with 2,000 U/ml DNase I (Invitrogen, Carlsbad, CA) at 37°C for 24 h (3). Following digestion of the DNA, agarose gel electrophoresis was performed to assess the completeness of the digestion. The digested sample ran as a smear at or less than 50 bp in size (results not shown). Endotoxin-free E. coli DNA was purchased from Invivogen (San Diego, CA).

CG content of T. brucei brucei DNA. Nuclear DNA sequences were downloaded from The Institute for Genomic Research Trypanosoma brucei Genome Project databases (21), and kinetoplast DNA sequences were obtained through the GenBank database. The composition of DNA sequences was analyzed using Sequence Analysis for Mac OS X (Informagen, Newington, NH), in which the frequency of CG dinucleotides was calculated by dividing the number of CG dinucleotides by the total number of dinucleotides. The kinetoplast CG frequency was calculated from 43 kb of maxicircle sequence (accession numbers V01390, M14820, Z15118, M18978, and M94286) and 10 kb of minicircle sequence (AY770510, AY770509, AY770508, AY698074, V01388, V01389, M15324, M14323, M14322, and M15321).

Measurement of DNA in plasma. Cell-free trypanosome DNA as well as parasitemia levels were monitored daily in the blood of infected mice. A 12-µl sample of tail blood was diluted in 108 µl of phosphate-buffered saline with 10 U/ml heparin and 1% glucose. To assess parasitemia, 1 µl of this diluted sample was used to enumerate the parasite number using a hemacytometer. The remainder of the sample was spun at 4,000 rpm for 4 min to remove cells. The supernatant was passed through a 0.54-µm centrifugal filter (Millipore, Billerica, MA) to remove any residual parasites. The sample collection procedure was optimized and rigorously controlled to eliminate the possibility of parasite lysis during the harvesting or centrifugation steps.

DNA from the plasma samples was purified using QIAamp DNA blood mini kit (QIAGEN Inc., Valencia, CA). Real-time PCR specific for the T. brucei rhodesiense bip gene was performed on the samples. Primers and probes were designed to amplify a region of the bip gene using IDT's SciTools Primer Quest: forward, 5'-ACGTTGCTAAACATTGACGGTGGC-3'; reverse, 5'-GGTGCTTGCTGAACTGGAAAGTGT-3; probe, 5'-fluorescein AGACTTTGACAGCCGCCTTGTGGATT tetramethyl rhodamine-3' (IDT, Coralville, IA).

Each 50-µl real-time PCR mixture contained 11 mM MgCl2 (Promega, Madison, WI), 1x Taq buffer (Promega), 50 nM forward and reverse primers, 1 nM probe, 4.5 nM SuperROX (Biosearch Technologies, Novato, CA), 10 nM deoxynucleoside triphosphates (Invitrogen), and Taq polymerase. Real-time PCR was performed using the ABI Prism 7700 sequence detection system and analyzed with SDS version 1.9.1 software (ABI, Foster City, CA). Five microliters of each sample was used as a template, and known amounts of parasite DNA were used to generate a standard curve.

Macrophage cell cultures. RAW 264.7 cells from the American Type Tissue Culture Collection (ATCC, Manassas, VA) were used in most experiments to assess macrophage activation, as we have shown previously (5, 33). Cells were grown in RPMI 1640 medium (Life Technologies, Grand Island, NY) supplemented with 2 mM glutamine, 1 mM pyruvate, 50 U/ml penicillin, 50 µg/ml streptomycin, and 2 g/liter sodium bicarbonate (Sigma-Aldrich) plus 10% fetal bovine serum (Invitrogen). The cells were grown at 37°C with 7% CO2. The cells were assessed to be Mycoplasma-free by the PCR Mycoplasma detection set (Takara Bio Inc., Otsu, Shiga, Japan).

Primary bone marrow macrophages (BMMP) were derived from total bone marrow cells from C57BL/6, BALB/c, and C.C3-Tlr4lps-d (TLR4–/– congenic BALB/c) mice (Jackson Laboratory), as previously described (35). Briefly, bone marrow cells were cultured for 7 days in RPMI supplemented with 20% fetal bovine serum (Invitrogen) and 20% L929 cell culture supernatant fluid as a source of macrophage colony-stimulating factor.

Macrophage stimulation. To assess stimulation with microbial ligands, synthetic CpG-containing oligodeoxynucleotides (ODNs) and non-CpG ODNs (Cell Sciences, Canton, MA) were used as positive and negative controls, respectively, at 10 µg/ml. Synthetic ODNs that do not contain CG motifs have previously been shown to inhibit CG-containing DNAs from activating cells. As a control, these non-CpG ODNs were also used in some experiments at 20 µg/ml to inhibit CpG DNA-dependent activation events (49). Lipopolysaccharide (LPS; Sigma) was purified and used at 100 ng/ml as a control in studies using TLR4-deficient macrophages (19). Samples of T. brucei rhodesiense DNA and DNase I-treated T. brucei rhodesiense DNA were used for experimental studies of macrophage activation. In preliminary experiments, different concentrations of trypanosome DNA were tested for the ability to induce specific cell activation events; a concentration of 100 µg/ml reproducibly activated signal transduction components in treated cells (see Fig. 2) and was therefore used in subsequent experiments analyzing macrophage activation. All treatments were performed in the presence of 10 µg/ml polymyxin B sulfate (Sigma), except for experiments performed with TLR4-deficient macrophages. In selected experiments, cells were primed with 20 U/ml IFN-{gamma} (Schering, Bloomfield, NJ) (specific activity, 1.7 x 106 U/mg [provided by the American Cancer Society]).


Figure 2
View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2. T. brucei rhodesiense DNA stimulates NO production in RAW 264.7 cells in a dose-dependent manner. RAW 264.7 cells were primed with 20 U/ml IFN-{gamma} for 24 h followed by treatment with IFN-{gamma} alone, CpG ODN, E. coli DNA, T. brucei rhodesiense DNA, and murine DNA at a range of concentrations for 24 h. Cell-free supernatant fluid was collected, and the production of NO was measured using the Griess reaction. Results are presented as the means ± standard errors of the means of triplicate cultures.

 
For dose-response experiments, RAW 264.7 cells were plated at 5 x 104 cells per 96-well plate well. The cells were primed with IFN-{gamma} for 24 h followed by a 24-h treatment with T. brucei rhodesiense DNA, E. coli DNA, murine DNA, and CpG ODN at a range of concentrations. The range of concentrations chosen were based on several previous studies (15, 20, 37, 42). For these experiments, the stimulatory response was assessed by monitoring NO production. Cell-free supernatant fluid was collected, and nitrite was measured using the Griess reaction, as previously described (5).

Signal transduction. Western blot analysis was utilized to monitor intracellular phosphorylation and inhibitor degradation events following macrophage activation by DNA. For these experiments, RAW 264.7 cells (7.6 x 105) were plated in each well of a 12-well plate and incubated overnight. The following day, the cells were treated with trypanosome DNA or control reagents for 20, 30, 40, 60, or 120 min. Then the cells were lysed as described previously (5), and protein was quantified using the Pierce BCA protein assays (Pierce, Rockford, IL). Proteins (25 µg/lane) were separated in 10% acrylamide gels by SDS-PAGE and transferred to Immobilon polyvinyl difluoride membranes (Millipore). The membranes were probed with the following antibodies: anti-actin (Sigma), inhibitor of NF-{kappa}B (I{kappa}B-{alpha}), p-38 (Santa Cruz Biotechnology, Santa Cruz, CA), extracellular signal-regulated kinase 1/2 (ERK 1/2), anti-active mitogen-activated protein kinase, p38, and Jun N-terminal kinase (JNK; Promega). A horseradish peroxidase-conjugated secondary antibody (Bio-Rad, Hercules, CA) was used for detection of bound antibody, and the signal was detected by chemiluminescence (Pierce). For densitometry, the blots were scanned and analyzed using NIH Image 1.63, which is available in the public domain (http://rsb.info.nih.gov/nih-image).

Gene expression. Changes in gene expression were monitored at the mRNA level using reverse transcriptase PCR (RT-PCR). Briefly, approximately 3.8 x 105 RAW 264.7 cells were plated in each well of a 12-well plate and grown overnight in complete medium. The cells were primed with IFN-{gamma} for 24 h and treated with DNA for 6 h. RNA was isolated with RNA STAT-60 (Tel-Test B, Friendswood, TX), as previously described (34). Reverse transcriptase (Invitrogen) and oligo(dT) primers (26) were used to generate cDNA. PCR amplification of specific genes was performed with a thermocyler (MJ Research, Waltham, MA). Primers for IL-6, IL-10, IL-12 p40 (34), and IFN-ß (32) have been described previously. Cyclooxygenase-2 primers were designed using Oligo 6.2 (Molecular Biology Insights, Inc., Cascade, CO): forward, 5'-TCAAAAGAAGTGCTGGAAAAGGTT-3'; reverse, 5'-TCTACCTGAGTGTCTTTGACTGTG-3'. A glyceraldehyde-3-phosphate dehydrogenase (G3PDH)-specific PCR was performed to control for equal amounts of cDNA in each sample, as we have described previously (34). PCR products were visualized by ethidium bromide staining following separation in 1% agarose gels. The presence or absence of message was determined by visual inspection of the stained gels.

Cytokine-specific ELISAs and NO detection. RAW 264.7 cells were plated as in the gene expression studies described above. BMMP were plated at 1.5 x 106 per 12-well plate well. All cell types were primed with IFN-{gamma} followed by a 24-h incubation with DNA. Cell-free supernatant fluid was then collected following centrifugation at 1,200 rpm for 10 min. The amount of cellular protein in each well was quantified using the Pierce BCA protein assay. The cell supernatant fluid was used in enzyme-linked immunosorbent assays (ELISAs) specific for the cytokines IL-6, IL-10, IL-12 p40, IL-12 p70, TNF-{alpha} (BD Pharmingen, San Jose, CA), and prostaglandin E2 (PGE2; R&D Systems, Minneapolis, MN). NO was measured using the Griess reaction as previously described (5).

Statistics. The statistical significance of the differences measured was determined using Student's t test. P values less than 0.05 were considered significant.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Detection of cell-free trypanosome DNA during infection. To assess the availability of trypanosome DNA to the innate immune system during infection, cell-free trypanosome DNA was measured daily in the plasma of infected mice. Wild-type C57BL/6 and C57BL/6-scid mice were used, respectively, to examine DNA release in the presence of an intact immune system or in the presence of the innate immune system only. The plasma was purified by centrifugation and filtration to remove intact parasites. Following purification, the amount of trypanosome DNA was quantified using real-time PCR specific for the bip gene. In both wild-type C57BL/6 and C57BL/6-scid mice, trypanosome DNA was first detectable in plasma during the initial outgrowth of parasites during infection, peaking at 3.75 and 3.00 ng/ml, respectively (Fig. 1). Trypanosome DNA remained detectable in C57BL/6-scid mice through day 18 of infection, with the levels of DNA appearing to be variable in individual mice (Fig. 1). These data indicate that cell-free trypanosome DNA is present during infection in mice with an intact immune system as well as in mice genetically lacking an acquired immune system. Also, the detectable levels of DNA are associated with the presence of parasitemia.


Figure 1
View larger version (32K):
[in this window]
[in a new window]
 
FIG. 1. Cell-free T. brucei rhodesiense DNA is detectable in the plasma of C57BL/6 and scid mice. Wild-type C57BL/6 (A) and C57BL/6-scid (B) mice were injected intraperitoneally with 1 x 105 trypanosomes. Tail blood (12 µl) was collected over the course of infection. Parasitemia was measured using a hemacytometer. Plasma was prepared by centrifugation and filtration. DNA was isolated from the plasma, and trypanosome DNA was measured using real-time PCR specific for the trypanosome bip gene (see Materials and Methods). Data are represented as the means and standard errors of the results from three independent experiments consisting of six mice per experiment.

 
CG dinucleotide content of trypanosome DNA. Since the frequency of the CG dinucleotide affects the stimulatory nature of DNA, the CG frequency in trypanosome DNA was assessed. Most of the T. brucei brucei nuclear genome is available for analysis through the TIGR Trypanosoma brucei Genome Project, and this database was used to determine the CG dinucleotide frequency. The released sequences were downloaded from the TIGR website (21), and the composition was analyzed using Sequence Analysis for Mac OS X. Based on the 9.36 mb of nuclear DNA analyzed, the CG dinucleotide content was calculated to be 5.28%, slightly less than the random expected frequency of 6.25% and greater than the previously reported frequency of 3.9% (42). In contrast, analysis of 53 kb of kinetoplast DNA sequence obtained from GenBank revealed that the frequency of the CG dinucleotide was only 0.083%, which is consistent with mitochondrial genomes (4). In comparison, the CG dinucleotide content of trypanosome nuclear DNA is lower than that of E. coli (7.47%) and much higher than that of murine DNA (0.93%) (44). The CG dinucleotide content of trypanosome kinetoplast DNA is lower than that of host DNA and composes approximately 15% of the total trypanosome DNA (10). Methylation of the CG dinucleotide also contributes to the immunostimulatory nature of DNA. Trypanosome DNA has been reported to be composed of only 0.03% methyl cytosine (11). Cytosine methylation of kinetoplast DNA has not been determined. Based on this analysis, the overall frequency of the CG dinucleotide in trypanosome DNA is approximately 4.5%, which is less than that of bacterial DNA and much greater than that of host DNA.

T. brucei rhodesiense DNA stimulates macrophages. To compare the stimulatory capacity of T. brucei rhodesiense DNA with other DNAs, RAW 264.7 cells were treated with T. brucei rhodesiense DNA, murine DNA, E. coli DNA, or CpG ODN over a wide range of concentrations (Fig. 2). Following a 24-h treatment period with the various DNAs, NO production was assessed as a monitor of the activation response. As expected based on mathematical assessments, T. brucei rhodesiense DNA was less stimulatory than E. coli DNA but far more stimulatory than murine DNA. Concentrations of T. brucei rhodesiense DNA between 10 and 100 µg/ml induced NO production. The range of T. brucei rhodesiense DNA concentrations that induced NO above background levels was approximately 10 times higher than the levels required with E. coli DNA. At higher DNA concentrations, NO production began to decline in response to both E. coli and T. brucei rhodesiense DNA, as has been observed previously with CpG ODN (41). Murine DNA did not stimulate NO production above background levels. These results indicate that T. brucei rhodesiense DNA activates macrophages with potency less than that of E. coli DNA.

Trypanosome DNA activation of macrophages is not due to endotoxin contamination. To determine whether any endotoxin contamination was responsible for the macrophage activation induced by trypanosome DNA treatment, macrophages from TLR4-deficient mice were used. BMMP were isolated from C.C3-Tlr4lps-d mice (TLR4–/– congenic BALB/c) and BALB/c mice. The macrophages were primed with IFN-{gamma} and subsequently treated with purified LPS, CpG ODN, or 100 µg/ml T. brucei rhodesiense DNA. NO levels were measured and compared between the wild-type and TLR4-deficient macrophages. The purified LPS only stimulated cells containing functional TLR4, and the CpG ODN stimulated both cell types. Trypanosome DNA induced equivalent levels of NO in both cell types, indicating that endotoxin contamination is not responsible for the observed macrophage activation (Fig. 3).


Figure 3
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 3. Trypanosome DNA activation of macrophages is not due to endotoxin contamination. BMMP from BALB/c and C.C3-Tlr4lps-d (TLR4–/– congenic BALB/c) mice were primed with 20 U/ml IFN-{gamma} for 24 h, followed by 24 h of treatment with medium alone (untreated), IFN-{gamma} alone (IFN-{gamma}), 100 ng/ml purified LPS (pLPS), 10 µg/ml CpG-containing ODN (CpG ODN), or 100 µg/ml trypanosome DNA (tryp DNA). Cell-free supernatant fluid was collected, and the production of NO was measured using the Griess reaction. Results are presented as the means ± standard errors of the means of triplicate cultures.

 
T. brucei rhodesiense DNA activates a signal transduction cascade. To more fully assess the ability of T. brucei rhodesiense DNA to activate macrophages, multiple components of a signal transduction pathway activated in response to CpG ODN were analyzed. Specifically, the phosphorylation of several mitogen-activated protein kinases, ERK 1/2, p38, and JNK 1/2 and the degradation of I{kappa}B-{alpha} were measured (15, 43, 52). For these studies, RAW 264.7 cells were stimulated with 100 µg/ml T. brucei rhodesiense DNA for 30 min and lysed, and the cytoplasmic proteins extracted and subjected to SDS-PAGE and Western blot analysis.

Degradation of I{kappa}B-{alpha} and phosphorylation of p38 and ERK were detected following RAW 264.7 cell exposure to T. brucei rhodesiense DNA (Fig. 4A). Densitometric analysis revealed that the level of phosphorylation observed was lower and less sustained than that following stimulation of the cells with CpG ODN (Fig. 4B). This is noted most dramatically by the undetectable level of JNK activation in response to T. brucei rhodesiense DNA (Fig. 4A and 4B). Signaling component activation was not seen in response to DNase I-treated T. brucei rhodesiense DNA in any experiment. These results demonstrate that T. brucei rhodesiense DNA is capable of activating components of the signal transduction cascade induced by CpG DNA but that differences are detectable in the profile and level of the two responses.


Figure 4
View larger version (48K):
[in this window]
[in a new window]
 
FIG. 4. T. brucei rhodesiense DNA activates selected signal transduction components associated with TLR9 receptor signaling in macrophages. RAW 264.7 cells were stimulated with medium alone (untreated), 10 µg/ml CpG-containing ODN (CpG ODN), 10 µg/ml non-CpG-containing ODN (non-CpG ODN), 100 µg/ml trypanosome DNA (tryp DNA), and 100 µg/ml DNase I-treated trypanosome DNA (DNase) for 30 min (A) and for 20, 40, 60, and 120 min (B). Cell lysates (25 µg/lane) were subjected to Western blot analysis using antibodies specific for the active form of ERK 1/2, p38, and JNK 1/2. An antibody specific for I{kappa}B-{alpha} was used to detect degradation of cellular I{kappa}B-{alpha}. Blots were reprobed with antibodies specific for the inactive form of p38, ERK 1/2, pan-JNK, or actin.

 
T. brucei rhodesiense DNA activates macrophage gene expression. To further dissect the activation potential of T. brucei rhodesiense DNA, changes in gene expression were measured in stimulated RAW 264.7 cells using RT-PCR. Since responses to CpG DNA are enhanced by IFN-{gamma} priming, in these studies, RAW 264.7 cells were primed with 20 U/ml IFN-{gamma} for 24 h followed by a 6-h treatment with DNA (51). Changes in expression of a panel of genes known to be induced by CpG ODN and also associated with T. brucei rhodesiense infection were monitored as a means to assess macrophage activation by T. brucei rhodesiense DNA (25). The combined treatment of IFN-{gamma} plus T. brucei rhodesiense DNA resulted in increased transcripts for cyclooxygenase-2, IL-6, IL-10, IL-12 p40, and IFN-ß in RAW 264.7 cells, a pattern similar to that observed following CpG ODN stimulation (Fig. 5). Again, although the profile of the activation response was similar, by visual inspection, T. brucei rhodesiense DNA induced a comparatively less robust response. Activation of gene expression was not observed in cells treated with DNase I-treated DNA (Fig. 5).


Figure 5
View larger version (68K):
[in this window]
[in a new window]
 
FIG. 5. Stimulation of RAW 264.7 cells with T. brucei rhodesiense DNA results in the induction of pro- and anti-inflammatory gene expression. RAW 264.7 cells were primed with 20 U/ml IFN-{gamma} for 24 h, followed by treatment with medium alone, CpG ODN, non-CpG ODN, trypanosome (tryp) DNA, or DNase (as described in the legend to Fig. 4) for 6 h. Total cellular RNA was then collected as described in Materials and Methods, and mRNA expression was analyzed for selected genes using RT-PCR. Amplified products were separated by gel electrophoresis and detected by ethidium bromide staining. G3PDH was used as a control for equal cDNA loading.

 
T. brucei rhodesiense DNA triggers cytokine, NO, and PGE2 production. As a functional assessment of macrophage activation, the immunomodulatory products produced by RAW 264.7 cells and BMMP following treatment with T. brucei rhodesiense DNA were measured. The cells were primed with IFN-{gamma}, as described above, and treated with DNA for 24 h. As an additional control for the specificity of this response, some BMMP were concurrently treated with non-CpG ODNs (20 µg/ml) and T. brucei rhodesiense DNA to inhibit T. brucei rhodesiense DNA-dependent activation (49). ELISA and the Griess reaction were used to measured products in the cell-free supernatant fluid, as described above. T. brucei rhodesiense DNA induced production of NO, PGE2, TNF-{alpha}, IL-6, IL-10, and IL-12 in RAW 264.7 cells (Fig. 6A) and BMMP (Fig. 6B). In all cases, the product levels induced by T. brucei rhodesiense DNA were lower than those induced by CpG ODN. Induction was abolished or significantly reduced after DNase I treatment of the T. brucei rhodesiense DNA (Fig. 6A and 6B). Cotreatment of BMMP with non-CpG ODN and T. brucei rhodesiense DNA inhibited T. brucei rhodesiense DNA-induced activation (Fig. 6B). Similar results were obtained following the treatment of primary elicited peritoneal macrophages from BALB/c mice (results not shown). Thus, the macrophage response to T. brucei rhodesiense DNA results in the production of molecules with trypanocidal and immunoregulatory function.


Figure 6
View larger version (32K):
[in this window]
[in a new window]
 
FIG. 6. Stimulation with T. brucei rhodesiense DNA results in the production of immunomodulatory molecules. RAW 264.7 cells (A) and BMMP (B) were primed with IFN-{gamma} for 24 h. Then the cells were treated for 24 h with CpG ODN, non-CpG ODN, trypanosome (tryp) DNA, and DNase, as described in the legends to Fig. 4 and 5. Where indicated, BMMP were also cotreated with 20 µg/ml non-CpG ODNs (iODNs) and trypanosome DNA (iODN tryp) as a control. Following stimulation, cell-free supernatant fluids were collected, and cytokines and PGE2 were measured by sandwich ELISA. NO production was measured using the Griess reaction. All results were normalized to cellular protein levels. Levels of detectable products are presented as the means ± standard errors of the means of results from triplicate cultures. Significant differences (P < 0.05) were found between the product levels induced by trypanosome DNA and all negative controls.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The initial interface between host and parasite in African trypanosomiasis likely regulates both early innate resistance to the infection as well as downstream elements of the acquired immune response to parasite antigens (2, 13, 14, 17, 27, 30, 40). Thus, the identification and characterization of trypanosome molecules recognized by cells of the innate immune system will provide insights into the mechanism by which the immune system attempts to control this pathogen. Previous results have demonstrated that the GPI anchor substituents of the VSG molecule affect macrophage activation, and the release of detectable levels of sVSG into the tissues of infected animals has been predicted to influence multiple elements of host immunity (5, 7, 29, 34, 38, 48). In light of recent findings that myeloid differentiation factor 88 and TLR9 impact the induction of a type 1 immune response during T. brucei brucei infection, we tested the hypothesis that T. brucei rhodesiense DNA activates macrophages and potentially impacts the early polarization of the immune response (8).

The results presented here clearly demonstrate that T. brucei rhodesiense DNA is released during infection and is capable of modulating macrophage activity in vitro. The outcome of macrophage stimulation with trypanosome DNA includes the induction of a signal transduction cascade, gene expression, and the production of cytokines and products that play an integral role in the immune response to this parasite. The presence of cell-free T. brucei rhodesiense DNA in the blood of infected wild-type C57BL/6 and C57BL/6-scid mice suggests that the innate immune system is likely to encounter this PAMP during disease and that macrophages specifically may be activated by this ligand. The pattern of DNA appearance in the blood and, by inference, in the tissues of infected mice suggests that T. brucei rhodesiense DNA may play a critical role in the response of macrophages to the parasite within the first several days following infection; this early response may be a critical component of relative resistance in trypanosomiasis. Additionally, innate immune cells may be exposed to T. brucei rhodesiense DNA following the phagocytosis of intact parasites. During the first wave of infection, approximately 3 x 108 parasites are cleared from the blood by Kupffer cells of the liver (6). Potentially, therefore, Kupffer cells are exposed to greater than 25 µg of T. brucei rhodesiense DNA during the antibody-mediated clearance of parasites. Although not directly addressed in these studies, this could increase the trypanosome DNA available to interface with tissue macrophages during infection. In addition, DNA has been found to be cleared from the blood very rapidly with a half-life of less than 30 min. Following clearance from the blood, DNA has been found to accumulate in the liver, spleen, and kidneys (47). This suggests that there may be constant clearance of trypanosome DNA from the blood, leading to continual exposure of cells to this parasite molecule.

It is of interest that studies by Drennan et al., using TLR9–/– mice, observed that T. brucei brucei parasitemia levels were reduced in the second wave and not the first wave of parasitemia (8).This suggests that exposure to trypanosome DNA during the first wave of parasitemia induces the immune system to control parasite levels during the second outgrowth of parasites during infection. This, along with other studies, also suggests that the timing of host exposure to various microbial factors may be critical in the immune response to trypanosomes (5).

The immunomodulatory molecules produced in response to T. brucei rhodesiense DNA may also play a critical role in the early polarization of the acquired immune response. For example, the central importance of both TH1 cell polarization and the production of IFN-{gamma} in relative resistance to T. brucei rhodesiense infection is clear (17, 40) and the induction of IL-12 by T. brucei rhodesiense DNA may be a key contributory factor in enhancing TH1 cell polarization (31, 46). Attention can be focused on several additional induced molecules, including the host proinflammatory cytokines TNF-{alpha} and IL-6. TNF-{alpha} has been linked to a reduction in parasite number during T. brucei brucei infection (29). Although a role for IL-6 in the immune response to T. brucei rhodesiense has not been directly addressed, it clearly is likely to play a significant role in the activation and differentiation of B cells during trypanosome infection (9, 30, 36). For example, the rapid expansion of T-independent B-cell responses to the trypanosome surface coat that occurs may be driven by early IL-6 production, and the potential for IL-6 to enhance the polyclonal B-cell activation responses that accompany infection is also clear. Likewise, the production of IL-10 in response to T. brucei rhodesiense DNA may control the extent of immunopathology during infection, as IL-10 has been shown to play a critical role in limiting immunopathology (33, 45). Finally, macrophage production of PGE2 and NO has been implicated in regulation of T-cell responses during trypanosomiasis and NO also has been shown to be trypanolytic (13, 18, 40). Thus, the multifaceted response of macrophages following exposure to T. brucei rhodesiense DNA suggests that this molecule may play a contributory role in innate immune system activation during infection.

It is tempting to speculate that T. brucei rhodesiense DNA content has evolved to evade a robust host immune response. Several aspects of the response to trypanosome DNA described here support this idea. First, it can be noted that T. brucei rhodesiense DNA, while inducing a signal transduction cascade and several important cytokines, generated a less marked activation response. Although T. brucei rhodesiense DNA activated similar molecules involved in signal transduction as CpG ODN, the strength and duration of the activation was far lower with T. brucei rhodesiense DNA, which has also been observed with other phosphodiester DNAs (37). In addition, JNK activation by T. brucei rhodesiense DNA stimulation was not detected. Since cytokine mRNA is stabilized by the activation of p38 and stress-activated protein kinases, including JNK, it may be that the lower levels of p38 and stress-activated protein kinase activation induced by T. brucei rhodesiense DNA negatively affect the stability of the mRNA (24, 50). We speculate that the relative difference in the stability of the mRNA induced by T. brucei rhodesiense DNA versus CpG ODN may also explain why the immunomodulatory product levels were far lower than those induced by the synthetic CpG ODN.

There are several reasons why T. brucei rhodesiense DNA may not be a strong stimulator of macrophages. First, both the CpG frequency and the degree of methylation affect the immunostimulatory nature of DNA (44). The data presented here show that the CpG frequency of nuclear trypanosome DNA is less than that of E. coli DNA but still over five times greater than that found in mouse or human DNA. Thus, from a purely structural standpoint, the 2% decrease in CG frequency between T. brucei rhodesiense DNA and E. coli DNA may explain the difference in the activating capabilities of these two DNAs. It is also of interest that the second organelle containing DNA, the kinetoplast, exhibits CG suppression common to mitochondrial genomes (4). Thus, the presence of kinetoplast DNA may modulate the stimulatory effects of T. brucei rhodesiense nuclear DNA, resulting in a ligand with reduced stimulatory capacity. Hence, T. brucei rhodesiense DNA may have reduced activating potential due to an underrepresentation of the CG dinucleotide and the presence of kinetoplast DNA.

Taken in sum, these results provide the first full assessment of the effects of trypanosome DNA on macrophage activation. Our results suggest that this ligand is released during infection and has stimulatory activity. Although the parameters of activation assessed here suggest that the host response to parasite DNA is less robust than that to bacterial DNA, T. brucei rhodesiense DNA does induce the production of trypanolytic molecules and cytokines responsible for type 1 polarization, which is necessary for relative resistance to infection. This evidence strongly implies that T. brucei rhodesiense DNA plays a role in shaping the immune response to this protozoan parasite.


    ACKNOWLEDGMENTS
 
These studies were supported by USPHS grants AI048242, AI051421 (D.M.P.), and AI22441 (J.M.M.). T.H.H. is supported by NIH Cellular and Molecular Parasitology Training Program grant USPHS AI007414. N.M.C. is supported by the Herman H. and Gwendolyn H. Shapiro Medical Scholarship.

We thank Vicki Leatherberry and Jim Schrader for assistance with animal infections. We also acknowledge our laboratory members Rebecca Lopez, Brian Leppert, and Bailey Freeman for helpful discussions during the completion of this work.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Medical Microbiology and Immunology, University of Wisconsin Medical School, 1300 University Avenue, Madison, WI 53706-1532. Phone: (608) 265-5857. Fax: (608) 265-8596. E-mail: paulnock{at}wisc.edu. Back

Editor: J. F. Urban, Jr.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Akira, S., and K. Takeda. 2004. Toll-like receptor signalling. Nat. Rev. Immunol. 4:499-511.[CrossRef][Medline]
2. Baetselier, P. D., B. Namangala, W. Noel, L. Brys, E. Pays, and A. Beschin. 2001. Alternative versus classical macrophage activation during experimental African trypanosomosis. Int. J. Parasitol. 31:575-587.[Medline]
3. Brown, W. C., D. M. Estes, S. E. Chantler, K. A. Kegerreis, and C. E. Suarez. 1998. DNA and a CpG oligonucleotide derived from Babesia bovis are mitogenic for bovine B cells. Infect. Immun. 66:5423-5432.[Abstract/Free Full Text]
4. Cardon, L. R., C. Burge, D. A. Clayton, and S. Karlin. 1994. Pervasive CpG suppression in animal mitochondrial genomes. Proc. Natl. Acad. Sci. USA 91:3799-3803.[Abstract/Free Full Text]
5. Coller, S. P., J. M. Mansfield, and D. M. Paulnock. 2003. Glycosylinositolphosphate soluble variant surface glycoprotein inhibits IFN-gamma-induced nitric oxide production via reduction in STAT1 phosphorylation in African trypanosomiasis. J. Immunol. 171:1466-1472.[Abstract/Free Full Text]
6. Dempsey, W. L., and J. M. Mansfield. 1983. Lymphocyte function in experimental African trypanosomiasis. V. Role of antibody and the mononuclear phagocyte system in variant-specific immunity. J. Immunol. 130:405-411.[Abstract]
7. Diffley, P., and A. N. Jayawardena. 1982. Surface coat variant antigen of Trypanosoma brucei brucei: its clearance from blood and concentration in organs of normal, infected, and immune mice. Infect. Immun. 35:173-178.[Abstract/Free Full Text]
8. Drennan, M. B., B. Stijlemans, J. Van den Abbeele, V. J. Quesniaux, M. Barkhuizen, F. Brombacher, P. De Baetselier, B. Ryffel, and S. Magez. 2005. The induction of a type 1 immune response following a Trypanosoma brucei infection is MyD88 dependent. J. Immunol. 175:2501-2509.[Abstract/Free Full Text]
9. Dubois, M. E., K. P. Demick, and J. M. Mansfield. 2005. Trypanosomes expressing a mosaic variant surface glycoprotein coat escape early detection by the immune system. Infect. Immun. 73:2690-2697.[Abstract/Free Full Text]
10. El-Sayed, N. M., P. Hegde, J. Quackenbush, S. E. Melville, and J. E. Donelson. 2000. The African trypanosome genome. Int. J. Parasitol. 30:329-345.[CrossRef][Medline]
11. Gommers-Ampt, J., J. Lutgerink, and P. Borst. 1991. A novel DNA nucleotide in Trypanosoma brucei only present in the mammalian phase of the life-cycle. Nucleic Acids Res. 19:1745-1751.[Abstract/Free Full Text]
12. Gordon, S. 2003. Alternative activation of macrophages. Nat. Rev. Immunol. 3:23-35.[CrossRef][Medline]
13. Grosskinsky, C. M., and B. A. Askonas. 1981. Macrophages as primary target cells and mediators of immune dysfunction in African trypanosomiasis. Infect. Immun. 33:149-155.[Abstract/Free Full Text]
14. Grosskinsky, C. M., R. A. Ezekowitz, G. Berton, S. Gordon, and B. A. Askonas. 1983. Macrophage activation in murine African trypanosomiasis. Infect. Immun. 39:1080-1086.[Abstract/Free Full Text]
15. Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser, K. Heeg, G. B. Lipford, and H. Wagner. 1998. CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. EMBO J. 17:6230-6240.[CrossRef][Medline]
16. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, and S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740-745.[CrossRef][Medline]
17. Hertz, C. J., H. Filutowicz, and J. M. Mansfield. 1998. Resistance to the African trypanosomes is IFN-gamma dependent. J. Immunol. 161:6775-6783.[Abstract/Free Full Text]
18. Hertz, C. J., and J. M. Mansfield. 1999. IFN-gamma-dependent nitric oxide production is not linked to resistance in experimental African trypanosomiasis. Cell. Immunol. 192:24-32.[CrossRef][Medline]
19. Hirschfeld, M., Y. Ma, J. H. Weis, S. N. Vogel, and J. J. Weis. 2000. Cutting edge: repurification of lipopolysaccharide eliminates signaling through both human and murine toll-like receptor 2. J. Immunol. 165:618-622.[Abstract/Free Full Text]
20. Huang, L. Y., K. J. Ishii, S. Akira, J. Aliberti, and B. Golding. 2005. Th1-like cytokine induction by heat-killed Brucella abortus is dependent on triggering of TLR9. J. Immunol. 175:3964-3970.[Abstract/Free Full Text]
21. Institute for Genomic Research. 23 July 2004, last date modified. The TIGR Index Databases. The Institute for Genomic Research. [Online.] ftp://ftp.tigr.org/pub/data/tgi/Trypanosoma_brucei/.
22. Iwasaki, A., and R. Medzhitov. 2004.Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 5:987-995.[CrossRef][Medline]
23. Janeway, C. A., Jr., and R. Medzhitov. 2002. Innate immune recognition. Annu. Rev. Immunol. 20:197-216.[CrossRef][Medline]
24. Khabar, K. S. 2005. The AU-rich transcriptome: more than interferons and cytokines, and its role in disease. J. Interferon Cytokine Res. 25:1-10.[CrossRef][Medline]
25. Krieg, A. M. 2002 CpG motifs in bacterial DNA and their immune effects. Annu. Rev. Immunol. 20:709-760.[CrossRef][Medline]
26. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, and D. M. Klinman. 1995 CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546-549.[CrossRef][Medline]
27. Levine, R. F., and J. M. Mansfield. 1984. Genetics of resistance to the African trypanosomes. III. Variant-specific antibody responses of H-2-compatible resistant and susceptible mice. J. Immunol. 133:1564-1569.[Abstract]
28. Lund, J., A. Sato, S. Akira, R. Medzhitov, and A. Iwasaki. 2003. Toll-like receptor 9-mediated recognition of herpes simplex virus-2 by plasmacytoid dendritic cells. J. Exp. Med. 198:513-520.[Abstract/Free Full Text]
29. Magez, S., M. Radwanska, A. Beschin, K. Sekikawa, and P. De Baetselier. 1999. Tumor necrosis factor alpha is a key mediator in the regulation of experimental Trypanosoma brucei infections. Infect. Immun. 67:3128-3132.[Abstract/Free Full Text]
30. Mansfield, J. M. 1995. Immunobiology of trypanosomiasis: a revisionist view, p. 477-496. In J. C. Boothroyd (ed.), Molecular approaches to parasitology. Wiley-Liss, Inc., New York, N.Y.
31. Mansfield, J. M., C. J. Hertz, A. Thompson, K. P. Demick, L. R. Schopf, J. Sypeck, and D. M. Paulnock. Submitted for publication.
32. Montoya, M., G. Schiavoni, F. Mattei, I. Gresser, F. Belardelli, P. Borrow, and D. F. Tough. 2002. Type I interferons produced by dendritic cells promote their phenotypic and functional activation. Blood 99:3263-3271.[Abstract/Free Full Text]
33. Namangala, B., W. Noel, P. De Baetselier, L. Brys, and A. Beschin. 2001. Relative contribution of interferon-gamma and interleukin-10 to resistance to murine African trypanosomosis. J. Infect. Dis. 183:1794-1800.[CrossRef][Medline]
34. Paulnock, D. M., and S. P. Coller. 2001. Analysis of macrophage activation in African trypanosomiasis. J. Leukoc. Biol. 69:685-690.[Abstract/Free Full Text]
35. Pullen, J. K., E. Eustis-Turf, M. J. Myers, and L. B. Schook. 1989. Regulation of MHC gene expression during the differentiation of bone marrow-derived macrophages. Cell. Immunol. 121:398-413.[CrossRef][Medline]
36. Reinitz, D. M., and J. M. Mansfield. 1990. T-cell-independent and T-cell-dependent B-cell responses to exposed variant surface glycoprotein epitopes in trypanosome-infected mice. Infect. Immun. 58:2337-2342.[Abstract/Free Full Text]
37. Roberts, T. L., J. A. Dunn, T. D. Terry, M. P. Jennings, D. A. Hume, M. J. Sweet, and K. J. Stacey. 2005. Differences in macrophage activation by bacterial DNA and CpG-containing oligonucleotides. J. Immunol. 175:3569-3576.[Abstract/Free Full Text]
38. Ropert, C., and R. T. Gazzinelli. 2000. Signaling of immune system cells by glycosylphosphatidylinositol (GPI) anchor and related structures derived from parasitic protozoa. Curr. Opin. Microbiol. 3:395-403.[CrossRef][Medline]
39. Schleifer, K. W., H. Filutowicz, L. R. Schopf, and J. M. Mansfield. 1993. Characterization of T helper cell responses to the trypanosome variant surface glycoprotein. J. Immunol. 150:2910-2919.[Abstract]
40. Schleifer, K. W., and J. M. Mansfield. 1993. Suppressor macrophages in African trypanosomiasis inhibit T cell proliferative responses by nitric oxide and prostaglandins. J. Immunol. 151:5492-5503.[Abstract]
41. Sester, D. P., S. Naik, S. J. Beasley, D. A. Hume, and K. J. Stacey. 2000. Phosphorothioate backbone modification modulates macrophage activation by CpG DNA. J. Immunol. 165:4165-4173.[Abstract/Free Full Text]
42. Shoda, L. K., K. A. Kegerreis, C. E. Suarez, I. Roditi, R. S. Corral, G. M. Bertot, J. Norimine, and W. C. Brown. 2001. DNA from protozoan parasites Babesia bovis, Trypanosoma cruzi, and T. brucei is mitogenic for B lymphocytes and stimulates macrophage expression of interleukin-12, tumor necrosis factor alpha, and nitric oxide. Infect. Immun. 69:2162-2171.[Abstract/Free Full Text]
43. Stacey, K. J., M. J. Sweet, and D. A. Hume. 1996. Macrophages ingest and are activated by bacterial DNA. J. Immunol. 157:2116-2122.[Abstract]
44. Stacey, K. J., G. R. Young, F. Clark, D. P. Sester, T. L. Roberts, S. Naik, M. J. Sweet, and D. A. Hume. 2003. The molecular basis for the lack of immunostimulatory activity of vertebrate DNA. J. Immunol. 170:3614-3620.[Abstract/Free Full Text]
45. Sternberg, J. M., J. Rodgers, B. Bradley, L. Maclean, M. Murray, and P. G. Kennedy. 2005. Meningoencephalitic African trypanosomiasis: Brain IL-10 and IL-6 are associated with protection from neuro-inflammatory pathology. J. Neuroimmunol. 167:81-89.[CrossRef][Medline]
46. Trinchieri, G. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. Immunol. 3:133-146.[CrossRef][Medline]
47. Tsumita, T., and M. Iwanaga. 1963. Fate of injected deoxyribonucleic acid in mice. Nature 198:1088-1089.[CrossRef][Medline]
48. Webb, H., N. Carnall, L. Vanhamme, S. Rolin, J. Van Den Abbeele, S. Welburn, E. Pays, and M. Carrington. 1997. The GPI-phospholipase C of Trypanosoma brucei is nonessential but influences parasitemia in mice. J. Cell Biol. 139:103-114.[Abstract/Free Full Text]
49. Yamada, H., I. Gursel, F. Takeshita, J. Conover, K. J. Ishii, M. Gursel, S. Takeshita, and D. M. Klinman. 2002. Effect of suppressive DNA on CpG-induced immune activation. J. Immunol. 169:5590-5594.[Abstract/Free Full Text]
50. Yeo, S. J., J. G. Yoon, and A. K. Yi. 2003. Myeloid differentiation factor 88-dependent posttranscriptional regulation of cyclooxygenase-2 expression by CpG DNA: tumor necrosis factor-alpha receptor-associated factor 6, a diverging point in the Toll-like receptor 9-signaling. J. Biol. Chem. 278:40590-40600.[Abstract/Free Full Text]
51. Yi, A. K., J. H. Chace, J. S. Cowdery, and A. M. Krieg. 1996. IFN-gamma promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J. Immunol. 156:558-564.[Abstract]
52. Yi, A. K., and A. M. Krieg. 1998. Rapid induction of mitogen-activated protein kinases by immune stimulatory CpG DNA. J. Immunol. 161:4493-4497.[Abstract/Free Full Text]


Infection and Immunity, August 2006, p. 4530-4537, Vol. 74, No. 8
0019-9567/06/$08.00+0     doi:10.1128/IAI.01938-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harris, T. H.
Right arrow Articles by Paulnock, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harris, T. H.
Right arrow Articles by Paulnock, D. M.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals