This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duffy, M. F.
Right arrow Articles by Rogerson, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duffy, M. F.
Right arrow Articles by Rogerson, S. J.

 Previous Article  |  Next Article 

Infection and Immunity, August 2006, p. 4875-4883, Vol. 74, No. 8
0019-9567/06/$08.00+0     doi:10.1128/IAI.01978-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Transcribed var Genes Associated with Placental Malaria in Malawian Women{dagger}

Michael F. Duffy,1,{ddagger}* Aphrodite Caragounis,1,{ddagger} Rintis Noviyanti,2 Helen M. Kyriacou,3 Ee Ken Choong,1 Katja Boysen,1 Julie Healer,1,§ J. Alexandra Rowe,3 Malcolm E. Molyneux,4,5 Graham V. Brown,1 and Stephen J. Rogerson1

Department of Medicine (RMH), University of Melbourne, Melbourne, Australia,1 The Eijkman Institute for Molecular Biology, Eijkman Building, Jl. Diponegoro 69, Jakarta, Indonesia 10430,2 Institute of Immunology and Infection Research, School of Biological Sciences, University of Edinburgh, King's Buildings, West Mains Rd., Edinburgh, United Kingdom,3 Malawi-Liverpool-Wellcome Trust Clinical Research Programme, College of Medicine, University of Malawi, Blantyre, Malawi,4 School of Tropical Medicine, University of Liverpool, Liverpool, United Kingdom5

Received 6 December 2005/ Returned for modification 24 January 2006/ Accepted 13 May 2006


arrow
ABSTRACT
 
Determining the diversity of PfEMP1 sequences expressed by Plasmodium falciparum-infected erythrocytes isolated from placentas is important for attempts to develop a pregnancy-specific malaria vaccine. The DBL{gamma} and var2csa DBL3x domains of PfEMP1 molecules are believed to mediate placental sequestration of infected erythrocytes, so the sequences encoding these domains were amplified from the cDNAs of placental parasites by using degenerate oligonucleotides. The levels of specific var cDNAs were then determined by quantitative reverse transcription-PCR. Homologues of var2csa DBL3x were the predominant sequences amplified from the cDNAs of most placental but not most children's parasites. There was 56% identity between all placental var2csa sequences. Many different DBL{gamma} domains were amplified from the cDNAs of placental and children's isolates. var2csa transcripts were the most abundant var transcripts of those tested in 11 of 12 placental isolates and 1 of 6 children's isolates. Gravidity did not affect the levels of var2csa transcripts. We concluded that placental malaria is frequently associated with transcription of var2csa but that other var genes are also expressed, and parasites expressing high levels of var2csa are not restricted to pregnant women. The diversity of var2csa sequences may be important for understanding immunity and for the development of vaccines for malaria during pregnancy.


arrow
INTRODUCTION
 
Malaria is more common in pregnant than nonpregnant women and predisposes those infected to maternal and infant death (37). The placenta provides a unique site for infected erythrocytes (IE) to be sequestered through adhesion to receptors, including chondroitin sulfate A (CSA) and hyaluronic acid (3, 14). IE from nonpregnant individuals rarely adhere to CSA and hyaluronic acid (3). The restricted adhesion phenotype of parasites isolated from placentas is associated with the expression of a restricted repertoire of parasite variant surface antigens (VSAs). Consequently, with increasing parity, women acquire antibodies that bind to parasites isolated from their own and other placentas (1, 16). These antibodies are associated with protection (11, 16, 36), and some are capable of blocking IE adhesion to CSA (2, 16, 39). It has therefore been postulated that parasite sequestration in the placenta is caused by a conserved, placenta-specific subset of VSAs.

Adhesion of IE is mediated predominantly by the diverse Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) molecules encoded by the var multigene family. Each parasite possesses approximately 60 var genes (20), and allogeneic parasites possess different repertoires of var genes. Previous studies linked adhesion to CSA to several var genes, including var-CS2 (29) and FCR3.varCSA (6). In both cases, adhesion was attributed to the DBL{gamma} domain of PfEMP1. However, subsequent studies have not corroborated these findings and suggest that transcription of at least FCR3.varCSA is not associated with adhesion to CSA (9, 10, 25, 35, 40, 41). A more promising candidate CSA binding parasite ligand is the VAR2CSA PfEMP1 identified by Salanti et al. (36). The most abundant var transcript in multiple allogeneic CSA-adherent parasites is var2csa (9, 12, 35), these parasites are antigenically cross-reactive (12), and evidence of parity-dependent antibody binding to defined, CSA-adherent laboratory isolates is currently restricted to parasites that express var2csa (2, 35). However, the identity of the conserved, CSA-binding parasite antigen remains unresolved because parity-dependent antibodies bind multiple recombinant proteins derived from both domains of VAR2CSA (33) and the DBL{gamma} domain of at least one other PfEMP1 (5, 7). Furthermore, DBL{gamma} domains present in multiple PfEMP1 molecules and multiple domains of VAR2CSA all bind to CSA (6, 18, 30).

Previous nonquantitative studies of the var genes expressed by placental isolates have either used degenerate primers designed to amplify multiple DBL{gamma} domains or specific primers to amplify DBL domains from some of the three var genes identified as candidate CSA adhesion ligands (15, 22, 23, 32). The amplification of multiple sequences and lack of quantitative data prevented the detection of a clear association between a specific var gene and placental sequestration. These studies also did not detect var2csa because it lacks the DBL{alpha} and DBL{gamma} domains for which the degenerate primers were designed. Quantitative analyses of var transcription in placental isolates have been restricted to comparisons of var2csa and FCR3.varCSA (35, 40). These studies were suggestive of a major role for var2csa in malaria during pregnancy and excluded a similar role for FCR3.varCSA but did not address the potential roles of other var genes possessing DBL{gamma} domains that may also have been transcribed at high levels in placental isolates. We used degenerate primers capable of amplifying both DBL{gamma} domains and var2csa DBL3x domains to amplify a range of transcribed var genes from parasites isolated from placentas and from the peripheral blood of children. We then used quantitative reverse transcription (Q-RT-PCR) on cDNAs from the parasite isolates to determine the levels of multiple var gene transcripts, including DBL{gamma} sequences, that had been amplified from the cognate cDNAs.


arrow
MATERIALS AND METHODS
 
Parasites. Informed consent was obtained from all patients or (for children) their parents or guardians for participation in the study. The study was approved by the College of Medicine Research and Ethics Committee, University of Malawi, and the Royal Melbourne Hospital Clinical Research Ethics Committee. P. falciparum-infected blood was obtained from placental biopsies from 19 women, as previously described (3), and from peripheral veins of six children admitted with severe malaria at the Queen Elizabeth Central Hospital in Blantyre,Malawi (31). Placental and peripheral blood samples were washed, and the pellets were solubilized at a 1-in-10 dilution in Trizol (Invitrogen, Carlsbad, CA) and stored frozen in liquid nitrogen. The Rplc series of placental isolates was collected from 1997 to 1999 (32), while the Mplc placental samples and the Mch children's samples were collected from 1999 to 2001 (31).

DNA and total RNA preparation. Genomic DNA was isolated from 100 µl of packed erythrocytes by using a QIAmp DNA mini blood kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions. For RT-PCR, RNAs were extracted from infected erythrocyte pellets solubilized in Trizol as described previously (9). RNAs were treated for 2 h at 37°C with DNase I (4 U; Ambion, Austin, TX) in the presence of total RNA carrier (Sigma, Sydney, Australia) and with 40 U of RNasin RNase inhibitor (Promega, Madison, WI).

PCR and RT-PCR assays. Reverse transcription was performed as previously described (9). Reverse transcriptase negative controls were used for each sample. DBL{gamma} and var2csa DBL3x sequences of approximately 600 bp were amplified from cDNAs and genomic DNAs (gDNAs) from children's and Mplc series placental samples by PCRs using the degenerate oligonucleotides D3F (CCTCCWAGRAGAMAAAAATTAT) and D3R1 (RCAAAAITSITCICKCCATTC) (I stands for inosine). PCR was performed under the following conditions: 94°C for 5 min, 40 cycles of 94°C for 30 s, 48°C for 30 s, and 65°C for 30 s, and a final extension at 65°C for 6 min. PCR mixtures included 25 pmol of each primer, a 500 nM concentration of each deoxynucleoside triphosphate, and 2.5 mM MgCl2. The Rplc series of samples was analyzed some time after the Mplc samples, allowing an improved degenerate reverse primer (D3R1.2 [ACAAWANTSNTCDBMCCATTC]) to be designed for amplification of the Rplc samples. D3R1.2 differed slightly in degeneracy from D3R1 but bound the same sequence.

To obtain additional DBL{gamma} sequences from some samples, it was necessary to use a seminested PCR that could only amplify DBL{gamma} sequences. The seminested PCR was performed in 50 µl under the conditions described above, and the mixture contained 0.5 µl of the first-round PCR product as the template and the primers D3F and D3R2 (CCATCKIARAAATTGIGGTYT). The use of a seminested PCR increased the bias of amplification of particular sequences, but this was controlled for by subsequent quantitative analyses.

cDNAs from the children's isolates Mch1478 and Mch 1488 and from the placental isolates from which var2csa cDNA could not be amplified using the degenerate primers were subjected to PCR using a var2csa DBL3x-specific forward primer (ACGATAAAGGTACAGCAATTATAT) and the same reverse primer as that used for Q-RT-PCR (TGGTACCCAAAATCATATTCTTATAATCA).

All PCR products were cloned and sequenced using standard methods.

Q-RT-PCR. Absolute quantitation of var gene cDNAs by Q-RT-PCR was performed as previously described, using standard curves of purified plasmids containing var gene sequences (9). Briefly, each PCR used 5 µl SYBR green PCR master mix (PE Biosystems) in a 10-µl reaction mix that was amplified using the ABI Prism 7900HT sequence detection system. PCR mixtures were incubated at 95°C for 10 min and then subjected to 40 cycles of 95°C for 15 s and 60°C for 1 min. A final incubation of 95°C for 2 min was followed by a dissociation step at 60°C for 2 min, with a 2% ramp rate to 95°C for 2 min. The specificity of each primer pair was determined by dissociation curve analysis per the manufacturer's instructions. The primers used to amplify var2csa DBL3x (forward, TGTCATGCTGTTCAAAGAAGTTTTATT; and reverse, TGGTACCCAAAATCATATTCTTATAATCA) were designed using an alignment of the 3D7 and ItG var2csa sequences and the 24 var2csa sequences amplified in this study. Nucleotide 16 of the DBL3x reverse primer had a C-for-T mismatch with Mplc22.5, and nucleotide 2 had a T-for-G mismatch with Rplc132c, Rplc132l, Rplc143d, and Rplc143e. However, var2csa DBL3x sequences with 100% identity to the var2csa DBL3x forward and reverse primers were also amplified from the same isolates. Nucleotide 11 of the DBL3x forward primer had a C-for-T mismatch with the only var2csa sequence amplified from Mplc78. Consequently, for quantitation of var2csa in Mplc78 cDNA, the DBL3x forward primer was replaced with TGTCATGCTGCTCAAAGAAGTTTTATT, and the cloned Mplc78 var2csa sequence was used to construct the standard curve. The primers used to amplify var-CS2 (forward, AGGAGATCAAGCAACCAC; and reverse, TTATTATCATCAATGTGTGTATCTCCTTTT) were identical to the var-CS2 sequence and the two sequences amplified in this study from Mplc78. The primers used to amplify FCR3var.CSA had the following sequences: TTGGAGGAATTTGCCAAACG(forward) and CCATTCGGTTAGCCATCGTAAA (reverse). The quantities in each cDNA of the skeleton binding protein 1 gene (SBP) (PFE_0065w) (forward, TTAGCCGACGAACCAACACA; and reverse, TTCGGTTGTCTCTGGTACTGCA) and a hypothetical protein gene (PF11_0505) (forward, TTTCAAGGGTCCAAGTTATGATGA; and reverse, AGGGCTTTGCCAAAAACTTTC) were determined by Q-RT-PCR, using standard curves of diluted 3D7 isolate gDNA. SBP and PF11_0505 levels were used to normalize the quantitative var cDNA data. Other primers used are shown in Table 1.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Data for placental and children's isolates examined in this studya

Sequence analysis. Sequence analysis was performed using BioEdit (21). Clustal W multiple sequence alignments with 100 bootstrap replicates were used to create protein distance matrices and phylogenetic trees by the neighbor-joining method (13) available at http://evolution.genetics.washington.edu/phylip.html and by using TreeView (28), available at http://taxonomy.zoology.gla.ac.uk/rod/treeview.html.

Nucleotide sequence accession numbers. The GenBank accession numbers for all of the sequences reported in this study are AY461586 to AY461594, AY464699, AY464700, AY466363 to AY466367, AY466369 to AY466372AY488868 to AY488880, AY534318, AY534319, DQ286586 to DQ286636, and DQ306266 to DQ306307.


arrow
RESULTS
 
The ability of the degenerate oligonucleotides D3F and D3R1 (Fig. 1a) to amplify both DBL{gamma} and var2csa DBL3x sequences was tested by cloning products amplified from 3D7 genomic DNA. Forty clones were sequenced, yielding 9 of the 14 published 3D7 DBL{gamma} sequences (26) and the var2csa DBL3x sequence. After 40 cycles of amplification, the most frequently amplified sequence (PFD0005w) was detected at 1.5 times the expected frequency using a binomial distribution, as previously described (38) (Fig. 1b). Using the analysis of Taylor et al. (39), these degenerate primers showed a low bias towards amplification of the most frequently detected sequence of <2% (since 1.0240 is >1.5), which is consistent with those of other "universal" DBL domain degenerate primers (8, 24, 38). Nevertheless, the bias may prevent the amplification of some DBL{gamma} sequences. The var2csa DBL3x sequence was amplified at a moderate frequency (Fig. 1b).


Figure 1
View larger version (20K):
[in this window]
[in a new window]
  		FIG. 1. (a) Alignment of degenerate oligonucleotides D3F, D3R1, and D3R2 with four DBL{gamma} sequences that all bind CSA as recombinant proteins (18) and with the DBL3x domain of the ItG var2csa homologue (It4var4). Asterisks under the sequences indicate that the nucleotides at those positions of the oligonucleotides had homology with both DBL{gamma} and DBL3X sequences. W, A or T; R, A or G; M, A or C; Y, C or T; S, G or C; I, inosine. (b) Observed and expected frequencies of detection of var2csa and different DBL{gamma} sequences in cloned PCR products amplified from 3D7 genomic DNA using the oligonucleotides D3F and D3R1. Excel BINOMDIST was used to calculate the expected binomial distribution for 40 sequenced clones with 15 DBL{gamma} or DBL3x possible identities if each identity was equally likely (38).

The oligonucleotides D3F and D3R1/D3R1.2 were then used to amplify DBL{gamma} and var2csa DBL3x sequences from the cDNAs of 10 placental isolates and 4 isolates from the peripheral blood of children and from the gDNAs of 4 placental isolates and 1 child's isolate (Table 1, sample group A). No products could be amplified from the cDNAs of a further nine placental and two children's isolates (Table 1, sample group B). The PCR products were cloned and sequenced (Table 1, sample group A). A range of sequences were amplified from the cDNAs of most isolates, but there was an obvious pattern in the amplification of var2csa DBL3x sequences from the cDNAs of all 10 placental isolates but not from the four children's isolate cDNAs (Table 1, sample group A) or the four placental gDNAs amplified with D3R1 (Table 1, sample group A).

We wished to extend this analysis beyond previous studies by first determining the endogenously transcribed DBL{gamma} var sequence(s) in each isolate and then quantitating the level of such a sequence in the cDNA of its cognate isolate to compare with the levels of several var sequences that have been implicated in adhesion to CSA in laboratory studies, including var2csa DBL3x. To do this, we needed to clone DBL{gamma} sequences from the isolates. Therefore, we used the degenerate reverse primer D3R2, which could amplify only DBL{gamma} sequences (Fig. 1), in a second round of RT-PCR amplification. The second-round RT-PCR was performed on the two children's isolates and nine placental isolates from which no detectable first-round product had been amplified using D3R1 (Table 1, sample group B) and on the placental isolates Mplc21 and Mplc22, from which only var2csa sequences had been amplified using D3R1. The second-round primer D3R2 amplified DBL{gamma} sequences from the cDNAs of both children's isolates and six of the nine placental isolates (Table 1, sample group B) but not from the cDNAs of Mplc21 and Mplc22. Combining the results from all degenerate primer PCRs, DBL{gamma} sequences were amplified from the cDNAs of 14 of the 19 placental isolates and all six of the children's isolates (Table 1). There was a wide diversity in the DBL{gamma} sequences amplified from the cDNAs of all samples. Sequences were also amplified by either D3R1 or D3R2 from the gDNAs of a randomly selected group of 10 isolates (Table 1, sample group C) to test whether the sequences amplified from cDNAs simply reflected primer bias. However, the sequences amplified from gDNAs were different from those amplified from the cDNAs of the same isolates, suggesting that the sequences amplified from the cDNAs were detected because of their abundance.

An obvious association between placental isolate cDNA and var2csa was revealed by a phylogenetic analysis that included all of the amplified sequences and all of the PfEMP1 domains previously implicated in pregnancy-associated malaria (6, 17, 23, 29, 32, 35) (Fig. 2). There was >76% identity between 3D7 var2csa and any of the 24 sequences homologous to var2csa DBL3x identified in this study. However, only 56% of all 194 predicted amino acids were identical between all of the 22 full-length var2csa DBL3x sequences (excluding two sequences that had large deletions) (see Fig. S1 in the supplemental material). Four other DBL{gamma} domains associated with malaria in pregnancy formed small, well-supported clusters: FCR3var.CSA DBL5{gamma} had at least 70% identity to four sequences from different placental cDNAs; FCR3var.CSA DBL3{gamma} had >96% identity with two sequences from different placental isolate cDNAs and one sequence from a child's isolate cDNA; 3D7chr5var DBL3{gamma} (32), homologous to 720 (23) and varCOMMON (42), had >79% identity with three sequences from different placental cDNAs; and var-CS2 had >97% identity with the only two sequences amplified from a single placental cDNA.


Figure 2
View larger version (32K):
[in this window]
[in a new window]
  		FIG. 2. Phylogenetic tree of sequences amplified from cDNAs and gDNAs of parasites isolated from placentas and from peripheral blood of children. The candidate CSA-binding PfEMP1s encoded by var2csa (35), FCR3.varCSA (6), var-CS2 (29), MAL6P14 (17), 3D7chr5var (32), 482, 498, 485, 720, and 732 (7, 23) are included, and those shown in bold are in the clusters described in the text. Bootstrap values of >50 are indicated at tree branches leading to clusters of sequences. The sequences used as endogenous DBL{gamma} controls for Q-RT-PCR are indicated with stars. The sequences were named for the samples from which they were amplified, followed by a space and then a different number for each different sequence from a single Mplc or Mch sample or a different letter for each different sequence from an Rplc sample. The suffix "-g" following an Mplc or Mch sequence indicates that it was amplified from gDNA.

We performed absolute quantitation by Q-RT-PCR to determine quantitative relationships between selected pregnancy-associated var sequences within those isolates for which sufficient cDNA was available (Table 1, sample group D). This group comprised all 6 children's isolates and 13 of the placental isolates, including all 9 of the placental samples from which no var2csa sequences were amplified with the degenerate primers (Table 1, sample group B). For each cDNA, we quantitated the levels of var2csa DBL3x, var-CS2 DBL2{gamma}, and FCR3.varCSA DBL3{gamma}. For all six children's isolates and eight of the placental isolates, we also quantitated the level of an endogenous control DBL{gamma} sequence that had been amplified from the cDNA of the isolate being examined (Table 1 and Fig. 2). This controlled for the possibility that differences between isolates in the levels of transcripts of any of the pregnancy-associated var sequences merely reflected differences between isolates in the levels of general var gene transcription. The selected pregnancy-associated var sequences could not be used to control for this possibility because the presence of these sequences had not actually been established for all isolates. For five placental samples, no endogenous control was used because no sequences could be amplified using the DBL{gamma} degenerate primers. For sample Mplc78, the var-CS2 DBL{gamma} sequence that was cloned from its cDNA was used as the endogenous control.

Q-RT-PCR revealed that var2csa was the most abundant of the transcripts examined for 12 of the 13 placental isolates (sample group D) but that var-CS2 was a more abundant transcript than var2csa in the remaining placental isolate, Mplc78 (Fig. 3). FCR3var.CSA was present at a similar level to that of var2csa in the cDNA from the placental isolate Mplc328. The endogenous control DBL{gamma} sequence was the most abundant of the transcripts tested in four of the six children's isolate cDNAs, and var2csa was the most abundant of the transcripts tested in the other two children's isolate cDNAs (Mch1478 and Mch1488) (Fig. 3). To confirm the presence of var2csa sequences in samples analyzed by Q-RT-PCR, we cloned and sequenced var2csa PCR products that were amplified with specific primers from the cDNAs of Mch1478, Mch1488, and eight of the nine placental isolates from which var2csa could not be amplified using the degenerate primers (Table 1, sample group B). All but one of the cloned var2csa sequences were identical to the var2csa sequence of the 3D7 isolate within the region that was used as a template for Q-RT-PCR. The var2csa sequence cloned from Mplc78 had a single mismatch of C versus T at nucleotide 11 of the var2csa DBL3x Q-RT-PCR forward primer. Consequently, var2csa cDNA was quantitated in the placental isolate Mplc78 by using both a modified var2csa DBL3x forward primer that had a cytidine residue at nucleotide 11 and a standard curve constructed from the cloned Mplc78 var2csa sequence.


Figure 3
View larger version (25K):
[in this window]
[in a new window]
  		FIG. 3. Percentage that each var gene constituted of the total var cDNA for the three or four var genes examined in each isolate by Q-RT-PCR absolute quantitation. Three var genes were quantitated for Mplc78 and for the five placental isolates with the prefix "(ne)-," from which no endogenous control DBL{gamma} sequence could be amplified; four var genes were quantitated for the other 13 isolates. Endogenous refers to the endogenous DBL{gamma} sequence that was amplified from the sample being analyzed.

The absolute quantitation data were normalized to compare the cDNA levels of specific var sequences between isolates and to indicate the abundances of specific var sequences within an isolate. The quantitative data should ideally be normalized to the total level of var mRNA to control for fluctuations between isolates in the levels of var gene transcripts caused by either differences in the temporal stages of the parasites sampled or differences in the peak levels of var mRNA transcribed by allogeneic isolates. This was an issue in the current study because the peripheral blood samples from children contained predominantly ring-stage parasites at the peak of var transcription while the placental isolates were composed mainly of mature trophozoites, in which var transcription is reduced. However, the concentration of total, functional var cDNA cannot be determined by Q-RT-PCR because the only sequences that are sufficiently conserved between all var genes to be used for this purpose are the second-exon sequences, which are also present at high levels in mature parasites as sterile, truncated transcripts. Consequently, to normalize the var Q-RT-PCR data, we used two genes, namely, the skeleton binding protein 1 gene (SBP) (PFE_0065w) and a hypothetical protein gene (PF11_0505), because their temporal transcriptional profile closely approximated that of the var multigene family in allogeneic parasite strains 3D7, HB3, and Dd2 (4, 27). Therefore, the normalized data presented in Fig. 4b represent the levels of cDNAs for specific var genes in equivalent amounts of total var cDNA from each isolate, as approximated by two control genes.


Figure 4
View larger version (33K):
[in this window]
[in a new window]
  		FIG. 4. (a) cDNA levels in CS2 parasites of var2csa, 18S rRNA, and the two genes, PF11_0505 and the SBP gene (PFE-0065w), that were used to normalize the Q-RT-PCR data. (b) Absolute quantities of var cDNA levels in placental (Mplc) and children's (Mch) isolates were determined by Q-RT-PCR, using standard curves, and the data were then normalized using the levels of SBP and PF11_0505 cDNAs. Consequently, the data shown represent the cDNA levels of specific var genes in equivalent amounts of total var cDNA from each isolate, as estimated using two control genes that approximate the transcriptional profile of var genes. The gravidity of the patient from whom each placental isolate was obtained is indicated in parentheses after the title of the isolate.Endogenous refers to the endogenous DBL{gamma} sequence that was amplified from the sample being analyzed. The prefix "(ne)-" indicates that no endogenous DBL{gamma} sequence control was available for that sample.

We used a time course of CS2 parasites, in which var2csa is the dominant var transcript (9), to validate our choice of genes for normalization (Fig. 4a). The levels of the normalizing genes were compared to the levels of var2csa in the 8-h postinvasion ring-stage CS2 parasites and the 36-h postinvasion mature trophozoite-stage CS2 parasites, using the following ratio: ring-stage var2csa cDNA/ring-stage control gene cDNA:mature trophozoite-stage var2csa cDNA/mature trophozoite-stage control gene cDNA. This gave ratios of 2.5:1 for SBP and 1.3:1 for PF11_0505. Thus, we assumed that the mature trophozoites in the placental isolates would contain 2.5-fold more var transcripts than were calculated by using SBP for normalization and 1.3-fold more var transcripts than were calculated by using PF11_0505 for normalization, and we adjusted the normalized data accordingly. The levels of 18S rRNA were also quantitated in the CS2 parasites to show that the similar transcriptional profiles of var2csa, PF11_0505, and SBP did not merely reflect the use of decreased parasite cDNA in the mature trophozoite Q-RT-PCR (Fig. 4a). The levels of SBP in the 12 placental and 6 children's isolates analyzed (Table 1, sample group D) correlated with the levels of PF11_0505 (R2 = 0.8812), corroborating the evidence of their similar temporal transcriptional profiles in 3D7, HB3, Dd2, and CS2 parasites. The placental sample Mplc345 was omitted from the normalized data analysis because it contained insufficient levels of cDNA from either normalizing gene.

In data normalized with either control gene (Fig. 4b), there was significantly more var2csa cDNA in the placental isolates than in the children's isolates (Table 2) (Mann-Whitney test; P = 0.0043 [SBP] or 0.017 [PF11_0505]) but no significant difference in the levels of var2csa associated with gravidity. There was significantly more var2csa cDNA than endogenous control DBL{gamma} cDNA in the placental isolates (Table 2) (Mann-Whitney test; P = 0.0009 [SBP] or 0.0023 [PF11_0505]) but not in the children's isolates (Table 2) (Mann-Whitney test). The median levels of endogenous control DBL{gamma} sequences were higher for cDNAs from the children's isolates than for those from the placental isolates, but the difference was not significant (Table 2)(Mann-Whitney test). The most abundant var transcript in CS2 parasites is var2csa (9), so the level of var2csa in CS2 cDNA indicates the abundance of specific var sequences in the cDNAs of the other samples (Fig. 4b). The abundance of var2csa cDNA in the child's isolate Mch1478 was apparent in the normalized data, but only a low level of var2csa was present in cDNA from the other child's isolate (Mch1488) in which var2csa was the most abundant of the analyzed var transcripts (Fig. 4b).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Absolute quantitation of var gene sequences by Q-RT-PCR

The abundance of var-CS2 in the placental isolate Mplc78 was apparent in the normalized data (Fig. 4b). The placental isolate Mplc328 contained similar but low normalized levels of var2csa DBL3x and FCR3var.CSA DBL3{gamma} cDNAs (Fig. 4b). The median values for FCR3var.CSA DBL3{gamma} sequences were higher for placental cDNAs than for children's cDNAs, but the difference was not significant (Table 2) (Mann-Whitney test).


arrow
DISCUSSION
 
Our degenerate primer RT-PCR analysis revealed a similar diversity of transcribed DBL{gamma} domains in placental isolates to that reported in previous studies (15, 22, 23, 32) but also revealed that var2csa was transcribed in all 10 placental isolates from which D3F and D3R1/D3R1.2 could amplify a product (Table 1, sample group A). This apparent dominance of var2csa DBL3x domains over DBL{gamma} domains in the mRNAs of placental isolates was corroborated by the evidence of a low bias of primers D3F and D3R1 towards amplification of var2csa from 3D7 gDNA and by their ability to amplify var2csa from the cDNAs but not the gDNAs of the four placental isolates tested (Table 1, sample group A).

Further quantitative analysis revealed that var2csa was the most abundant of the analyzed var transcripts in 12 of the 13 placental isolates examined (Table 1, sample group D), supporting the association between var2csa transcripts and parasites sequestered in the placenta (35, 40). The significantly higher levels of var2csa than of endogenous DBL{gamma} sequences in the placental cDNAs suggested that the high levels of var2csa cDNA in these placental isolates did not simply reflect high levels of total var gene cDNA. This conclusion was supported by the lower levels of endogenous DBL{gamma} sequences in the placental than in the children's isolate cDNAs. Although this difference was not significant, it suggested that, if anything, there was less transcription of var genes (other than var2csa) in the placental than in the children's isolates. It is quite possible that the two children's isolates in which var2csa was the most abundant of the analyzed var transcripts expressed other var genes lacking DBL{gamma} domains at higher levels than var2csa. We did not look specifically for these, but the level of var2csa remained high in the normalized data for one of these children (Mch1478), indicating that var2csa can be an abundant transcript in nonpregnant individuals. Only low levels of var2csa transcripts have been described previously for nonpregnant individuals (35, 40).

The var-CS2 DBL2{gamma} domain was the only var transcript tested that was present at higher levels than var2csa in a placental isolate, suggesting that it may play a role in placental sequestration. Interestingly, parasites with disrupted var2csa that bind bovine trachea CSA in vitro also transcribe var-CS2 at high levels (10), strengthening previous associations between transcription of this gene and adhesion to CSA (29, 30). The similar but low levels of FCR3var.CSA DBL3{gamma} and var2csa sequences in the cDNA of the placental isolate Mplc328 suggest the existence of an abundant, unidentified var gene transcript in this isolate rather than indicating a role for FCR3var.CSA DBL3{gamma} in placental sequestration of this isolate. Although there were higher normalized levels of the FCR3var.CSA DBL3{gamma} sequence in cDNAs from mature placental parasites than in those from ring-stage parasites infecting children, the difference was not significant, and this probably simply reflects the atypically late peak of FCR3var.CSA transcription (25).

A role in placental sequestration cannot be excluded for PfEMP1s carrying domains homologous to the 3D7chr5var DBL3{gamma}/720 and FCR3var.CSA DBL5{gamma} domains that were transcribed by the Rplc series of placental cDNAs (Fig. 2). Like all other domains implicated in pregnancy-associated malaria, the FCR3var.CSA DBL5{gamma} domain, which is homologous to 3D7chr5var DBL5{gamma}, was previously amplified from placental isolate cDNA (15, 32). However, this domain is part of an unusually conserved subset of var genes (34) that are frequently transcribed by parasites infecting nonpregnant individuals (42), and unlike all other domains implicated in pregnancy-associated malaria, recombinant proteins derived from FCR3var.CSA DBL5{gamma} do not bind CSA (6, 18, 19). These sequences were amplified from the Rplc placental cDNAs that had also previously been used to survey DBL{alpha} domain transcription (32). Unfortunately, there was insufficient material available from the Rplc samples to quantitate these sequences by Q-RT-PCR.

We concluded that var2csa was probably the principal var gene transcribed by parasites sequestered in the placentas of most of the participants in this study. However, the abundance of var-CS2 in one placental isolate suggests that parasites transcribing var genes other than var2csa can be sequestered in the placenta. Larger studies must determine whether var2csa is the dominant var transcript in placental isolates from around the globe if var2csa is to be explored as a possible candidate for vaccination against malaria during pregnancy. Also, note the diversity within the small sample of var2csa DBL3x sequences isolated from one locale and examined in this study. This indicates that it may be difficult to develop a vaccine from a single var2csa DBL3x sequence, and thus it is essential to identify the most conserved regions of var2csa that elicit functional immunity.


arrow
ACKNOWLEDGMENTS
 
We thank the Malawian patients who participated in this study and Sue Kyes for helpful discussions.

S.J.R. is a Senior Overseas Fellow of the Wellcome Trust (063215). Additional funding for this work came from the National Health and Medical Research Council of Australia and the Australian Indonesian Medical Research Initiative, Australian Agency for International Development. J.A.R. is a Wellcome Senior Research Fellow (067431). H.K. is funded by the Wellcome Trust four-year Ph.D. program.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Medicine (RMH), University of Melbourne, Post Office, Royal Melbourne Hospital, Victoria 3050, Australia. Phone: 61 3 8344 3267. Fax: 61 3 9347 1863. E-mail: mduffy{at}unimelb.edu.au. Back

Editor: W. A. Petri, Jr.

{dagger} Supplemental material for this article may be found at http://iai.asm.org/. Back

{ddagger} M.F.D. and A.C. contributed equally to this work. Back

§ Present address: The Walter and Eliza Hall Institute of Medical Research, 19 Royal Parade, Parkville, Victoria, Australia 3050. Back


arrow
REFERENCES
 
    1
  1. Beeson, J. G., G. V. Brown, M. E. Molyneux, C. Mhango, F. Dzinjalamala, and S. J. Rogerson.1999 . Plasmodium falciparum isolates from infected pregnant women and children are associated with distinct adhesive and antigenic properties. J. Infect. Dis. 180:464-472.[CrossRef][Medline]
    2. 2
  2. Beeson, J. G., E. J. Mann, S. R. Elliott, V. M. Lema, E. Tadesse, M. E. Molyneux, G. V. Brown, and S. J. Rogerson.2004 . Antibodies to variant surface antigens of Plasmodium falciparum-infected erythrocytes and adhesion inhibitory antibodies are associated with placental malaria and have overlapping and distinct targets. J. Infect. Dis. 189:540-551.[CrossRef][Medline]
    3. 3
  3. Beeson, J. G., S. J. Rogerson, B. M. Cooke, J. C. Reeder, W. Chai, A. M. Lawson, M. E. Molyneux, and G. V. Brown. 2000. Adhesion of Plasmodium falciparum-infected erythrocytes to hyaluronic acid in placental malaria. Nat. Med. 6:86-90.[CrossRef][Medline]
    4. 4
  4. Bozdech, Z., M. Llinas, B. L. Pulliam, E. D. Wong, J. Zhu, and J. L. DeRisi. 2003. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS Biol. 1:85-100.
    5. 5
  5. Brustoski, K., M. Kramer, U. Moller, P. G. Kremsner, and A. J. Luty. 2005. Neonatal and maternal immunological responses to conserved epitopes within the DBL-{gamma}3 chondroitin sulfate A-binding domain of Plasmodium falciparum erythrocyte membrane protein 1. Infect. Immun. 73:7988-7995.[Abstract/Free Full Text]
    6. 6
  6. Buffet, P. A., B. Gamain, C. Scheidig, D. Baruch, J. D. Smith, R. Hernandez-Rivas, B. Pouvelle, S. Oishi, N. Fujii, T. Fusai, D. Parzy, L. H. Miller, J. Gysin, and A. Scherf.1999 . Plasmodium falciparum domain mediating adhesion to chondroitin sulfate A: a receptor for human placental infection. Proc. Natl. Acad. Sci. USA 96:12743-12748.[Abstract/Free Full Text]
    7. 7
  7. Chia, Y. S., C. Badaut, N. G. Tuikue Ndam, A. Khattab, S. Igonet, N. Fievet, G. A. Bentley, P. Deloron, and M. Q. Klinkert. 2005. Functional and immunological characterization of a Duffy binding-like-gamma domain from Plasmodium falciparum erythrocyte membrane protein-1 expressed by a placental isolate. J. Infect. Dis. 192:1284-1293.[CrossRef][Medline]
    8. 8
  8. Duffy, M. F., G. V. Brown, W. Basuki, E. O. Krejany, R. Noviyanti, A. F. Cowman, and J. C. Reeder. 2002. Transcription of multiple var genes by individual, trophozoite-stage Plasmodium falciparum cells expressing a chondroitin sulphate A binding phenotype.Mol. Microbiol. 43:1285-1293.[CrossRef][Medline]
    9. 9
  9. Duffy, M. F., T. J. Byrne, S. R. Elliott, D. Wilson, S. J. Rogerson, J. G. Beeson, R. Noviyanti, and G. V. Brown. 2005. Broad analysis reveals a consistent pattern of var gene transcription in Plasmodium falciparum repeatedly selected for a defined adhesion phenotype. Mol. Microbiol. 56:774-788.[CrossRef][Medline]
    10. 10
  10. Duffy, M. F., A. G. Maier, T. J. Byrne, S. R. Elliott, A. J. Marty, M. T. O'Neill, P. D. Payne, S. J. Rogerson, A. F. Cowman, B. S. Crabb, and G. V. Brown. 3 June2006 , posting data. VAR2CSA is the principal ligand for chondroitin sulfate A in two allogeneic isolates of Plasmodium falciparum.Mol. Biochem. Parasitol. , [Online.] doi:10.1016/j.molbiopara.2006.03.006.
    11. 11
  11. Duffy, P. E., and M. Fried. 2003. Antibodies that inhibit Plasmodium falciparum adhesion to chondroitin sulfate A are associated with increased birth weight and the gestational age of newborns. Infect. Immun. 71:6620-6623.[Abstract/Free Full Text]
    12. 12
  12. Elliott, S. R., M. F. Duffy, T. J. Byrne, J. G. Beeson, E. J. Mann, D. W. Wilson, S. J. Rogerson, and G. Brown, V. 2005. Cross-reactive surface epitopes on chondroitin sulfate A-adherent Plasmodium falciparum-infected erythrocytes are associated with transcription of var2csa. Infect. Immun. 73:2848-2856.[Abstract/Free Full Text]
    13. 13
  13. Felsenstein, J. 1989. PHYLIP—Phylogeny Inference Package (version 3.2). Cladistics 5:164-166.
    14. 14
  14. Fried, M., and P. E. Duffy. 1996. Adherence of Plasmodium falciparum to chondroitin sulfate A in the human placenta. Science 272:1502-1504.[Abstract]
    15. 15
  15. Fried, M., and P. E. Duffy. 2002. Two DBLgamma subtypes are commonly expressed by placental isolates of Plasmodium falciparum. Mol. Biochem. Parasitol. 122:201-210.[CrossRef][Medline]
    16. 16
  16. Fried, M., F. Nosten, A. Brockman, B. J. Brabin, and P. E. Duffy. 1998. Maternal antibodies block malaria.Nature 395:851-852.[CrossRef][Medline]
    17. 17
  17. Fried, M., J. P. Wendler, T. K. Mutabingwa, and P. E. Duffy. 2004. Mass spectrometric analysis of Plasmodium falciparum erythrocyte membrane protein-1 variants expressed by placental malaria parasites.Proteomics 4:1086-1093.[CrossRef][Medline]
    18. 18
  18. Gamain, B., S. Gratepanche, L. H. Miller, and D. I. Baruch. 2002. Molecular basis for the dichotomy in Plasmodium falciparum adhesion to CD36 and chondroitin sulfate A. Proc. Natl. Acad. Sci. USA 99:10020-10024.[Abstract/Free Full Text]
    19. 19
  19. Gamain, B., J. D. Smith, M. Avril, D. I. Baruch, A. Scherf, J. Gysin, and L. H. Miller. 2004. Identification of a 67-amino-acid region of the Plasmodium falciparum variant surface antigen that binds chondroitin sulphate A and elicits antibodies reactive with the surface of placental isolates. Mol. Microbiol. 53:445-455.[CrossRef][Medline]
    20. 20
  20. Gardner, M. J., N. Hall, E. Fung, O. White, M. Berriman, R. W. Hyman, J. M. Carlton, A. Pain, K. E. Nelson, S. Bowman, I. T. Paulsen, K. James, J. A. Elsen, K. Rutherford, S. L. Saizberg, A. Craig, S. Kyes, M.-S. Chan, V. Nene, S. J. Shallom, B. Suh, J. Peterson, S. Angluoll, M. Pertea, J. Allen, J. Selengut, D. Haft, M. W. Mather, A. B. Valdya, D. M. A. Martin, A. H. Fairlamb, M. J. Fraunholz, D. S. Roos, S. A. Ralph, G. I. McFadden, L. D. Cummings, G. M. Subramanlan, C. Mungall, J. C. Venter, D. J. Carucci, S. L. Hoffman, C. Newbold, R. W. Davis, C. M. Fraser, and B. Barrell.2002 . Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419:498-511.[CrossRef][Medline]
    21. 21
  21. Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41:95-98.
    22. 22
  22. Khattab, A., P. G. Kremsner, and M. Q. Klinkert.2003 . Common surface-antigen var genes of limited diversity expressed by Plasmodium falciparum placental isolates separated by time and space. J. Infect. Dis. 187:477-483.[CrossRef][Medline]
    23. 23
  23. Khattab, A., J. Kun, P. Deloron, P. G. Kremsner, and M. Q. Klinkert. 2001. Variants of Plasmodium falciparum erythrocyte membrane protein 1 expressed by different placental parasites are closely related and adhere to chondroitin sulfate A. J. Infect. Dis. 183:1165-1169.[CrossRef][Medline]
    24. 24
  24. Kraemer, S. M., L. Gupta, and J. D. Smith.2003 . New tools to identify var sequence tags and clone full-length genes using type-specific primers to Duffy binding-like domains. Mol. Biochem. Parasitol. 129:91-102.[CrossRef][Medline]
    25. 25
  25. Kyes, S. A., Z. Christodoulou, A. Raza, P. Horrocks, R. Pinches, J. A. Rowe, and C. I. Newbold.2003 . A well-conserved Plasmodium falciparum var gene shows an unusual stage-specific transcript pattern. Mol. Microbiol. 48:1339-1348.[CrossRef][Medline]
    26. 26
  26. Lavstsen, T., A. Salanti, A. T. Jensen, D. E. Arnot, and T. G. Theander. 2003. Sub-grouping of Plasmodium falciparum 3D7 var genes based on sequence analysis of coding and non-coding regions. Malar. J. 2:27.[CrossRef][Medline]
    27. 27
  27. Le Roch, K. G., Y. Zhou, P. L. Blair, M. Grainger, J. K. Moch, J. D. Haynes, P. De La Vega, A. A. Holder, S. Batalov, D. J. Carucci, and E. A. Winzeler. 2003. Discovery of gene function by expression profiling of the malaria parasite life cycle.Science 301:1503-1508.[Abstract/Free Full Text]
    28. 28
  28. Page, R. D. M. 1996. TREEVIEW: an application to display phylogenetic trees on personal computers.Comput. Appl. Biosci. 12:357-358.[Free Full Text]
    29. 29
  29. Reeder, J. C., A. F. Cowman, K. M. Davern, J. G. Beeson, J. K. Thompson, S. J. Rogerson, and G. V. Brown. 1999. The adhesion of Plasmodium falciparum-infected erythrocytes to chondroitin sulfate A is mediated by PfEMP1.Proc. Natl. Acad. Sci. USA 96:5198-5202.[Abstract/Free Full Text]
    30. 30
  30. Reeder, J. C., A. N. Hodder, J. G. Beeson, and G. V. Brown. 2000. Identification of glycosaminoglycan binding domains in Plasmodium falciparum erythrocyte membrane protein 1 of a chondroitin sulfate A-adherent parasite. Infect. Immun. 68:3923-3926.[Abstract/Free Full Text]
    31. 31
  31. Rogerson, S. J., E. Pollina, A. Getachew, E. Tadesse, V. M. Lema, and M. E. Molyneux. 2003. Placental monocyte infiltrates in response to Plasmodium falciparum infection and their association with adverse pregnancy outcomes.Am. J. Trop. Med. Hyg. 68:115-119.[Abstract/Free Full Text]
    32. 32
  32. Rowe, J. A., S. A. Kyes, S. J. Rogerson, H. A. Babiker, and A. Raza. 2002. Identification of a conserved Plasmodium falciparum var gene implicated in malaria in pregnancy. J. Infect. Dis. 185:1207-1211.[CrossRef][Medline]
    33. 33
  33. Salanti, A., M. Dahlback, L. Turner, M. A. Nielsen, L. Barfod, P. Magistrado, A. T. Jensen, T. Lavstsen, M. F. Ofori, K. Marsh, L. Hviid, and T. G. Theander.2004. Evidence for the involvement of VAR2CSA in pregnancy-associated malaria. J. Exp. Med. 200:1197-1203.[Abstract/Free Full Text]
    34. 34
  34. Salanti, A., A. T. Jensen, H. D. Zornig, T. Staalsoe, L. Joergensen, M. A. Nielsen, A. Khattab, D. E. Arnot, M. Q. Klinkert, L. Hviid, and T. G. Theander.2002 . A sub-family of common and highly conserved Plasmodium falciparum var genes. Mol. Biochem. Parasitol. 122:111-115.[CrossRef][Medline]
    35. 35
  35. Salanti, A., T. Staalsoe, T. Lavstsen, A. T. Jensen, M. P. Sowa, D. E. Arnot, L. Hviid, and T. G. Theander. 2003. Selective upregulation of a single distinctly structured var gene in chondroitin sulphate A-adhering Plasmodium falciparum involved in pregnancy-associated malaria. Mol. Microbiol. 49:179-191.[CrossRef][Medline]
    36. 36
  36. Staalsoe, T., C. E. Shulman, J. N. Bulmer, K. Kawuondo, K. Marsh, and L. Hviid. 2004. Variant surface antigen-specific IgG and protection against clinical consequences of pregnancy-associated Plasmodium falciparum malaria.Lancet 363:283-289.[CrossRef][Medline]
    37. 37
  37. Steketee, R. W., B. L. Nahlen, M. E. Parise, and C. Menendez. 2001. The burden of malaria in pregnancy in malaria-endemic areas. Am. J. Trop. Med. Hyg. 64:28-35.[Abstract]
    38. 38
  38. Taylor, H. M., S. A. Kyes, D. Harris, N. Kriek, and C. I. Newbold. 2000. A study of var gene transcription in vitro using universal var gene primers.Mol. Biochem. Parasitol. 105:13-23.[CrossRef][Medline]
    39. 39
  39. Tuikue Ndam, N. G., N. Fievet, G. Bertin, G. Cottrell, A. Gaye, and P. Deloron. 2004. Variable adhesion abilities and overlapping antigenic properties in placental Plasmodium falciparum isolates. J. Infect. Dis. 190:2001-2009.[CrossRef][Medline]
    40. 40
  40. Tuikue Ndam, N. G., A. Salanti, G. Bertin, M. Dahlback, N. Fievet, L. Turner, A. Gaye, T. Theander, and P. Deloron. 2005. High level of var2csa transcription by Plasmodium falciparum isolated from the placenta. J. Infect. Dis. 192:331-335.[CrossRef][Medline]
    41. 41
  41. Viebig, N. K., B. Gamain, C. Scheidig, C. Lepolard, J. Przyborski, M. Lanzer, J. Gysin, and A. Scherf. 2005. A single member of the Plasmodium falciparum var multigene family determines cytoadhesion to the placental receptor chondroitin sulphate A. EMBO Rep. 6:775-781.[CrossRef][Medline]
    42. 42
  42. Winter, G., Q. Chen, K. Flick, P. Kremsner, V. Fernandez, and M. Wahlgren. 2003. The 3D7var5.2 (var COMMON) type var gene family is commonly expressed in non-placental Plasmodium falciparum malaria.Mol. Biochem. Parasitol. 127:179-191.[CrossRef][Medline]

Infection and Immunity, August 2006, p. 4875-4883, Vol. 74, No. 8
0019-9567/06/$08.00+0     doi:10.1128/IAI.01978-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Avril, M., Kulasekara, B. R., Gose, S. O., Rowe, C., Dahlback, M., Duffy, P. E., Fried, M., Salanti, A., Misher, L., Narum, D. L., Smith, J. D. (2008). Evidence for Globally Shared, Cross-Reacting Polymorphic Epitopes in the Pregnancy-Associated Malaria Vaccine Candidate VAR2CSA. Infect. Immun. 76: 1791-1800 [Abstract] [Full Text]  
  • Rogerson, S. J., Mwapasa, V., Meshnick, S. R. (2007). Malaria in Pregnancy: Linking Immunity and Pathogenesis to Prevention. Am J Trop Med Hyg 77: 14-22 [Abstract] [Full Text]  
  • Francis, S. E., Malkov, V. A., Oleinikov, A. V., Rossnagle, E., Wendler, J. P., Mutabingwa, T. K., Fried, M., Duffy, P. E. (2007). Six Genes Are Preferentially Transcribed by the Circulating and Sequestered Forms of Plasmodium falciparum Parasites That Infect Pregnant Women. Infect. Immun. 75: 4838-4850 [Abstract] [Full Text]  
  • Kyes, S. A., Kraemer, S. M., Smith, J. D. (2007). Antigenic Variation in Plasmodium falciparum: Gene Organization and Regulation of the var Multigene Family. Eukaryot Cell 6: 1511-1520 [Full Text]  
  • Beeson, J. G., Andrews, K. T., Boyle, M., Duffy, M. F., Choong, E. K., Byrne, T. J., Chesson, J. M., Lawson, A. M., Chai, W. (2007). Structural Basis for Binding of Plasmodium falciparum Erythrocyte Membrane Protein 1 to Chondroitin Sulfate and Placental Tissue and the Influence of Protein Polymorphisms on Binding Specificity. J. Biol. Chem. 282: 22426-22436 [Abstract] [Full Text]  
  • Beeson, J. G., Ndungu, F., Persson, K. E. M., Chesson, J. M., Kelly, G. L., Uyoga, S., Hallamore, S. L., Williams, T. N., Reeder, J. C., Brown, G. V., Marsh, K. (2007). Antibodies among Men and Children to Placental-Binding Plasmodium falciparum-Infected Erythrocytes that Express var2csa. Am J Trop Med Hyg 77: 22-28 [Abstract] [Full Text]  
  • Conway, D. J. (2007). Molecular Epidemiology of Malaria. Clin. Microbiol. Rev. 20: 188-204 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duffy, M. F.
Right arrow Articles by Rogerson, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duffy, M. F.
Right arrow Articles by Rogerson, S. J.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»