Previous Article | Next Article 
Infection and Immunity, August 2006, p. 4884-4891, Vol. 74, No. 8
0019-9567/06/$08.00+0 doi:10.1128/IAI.00500-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Reduction of the Ganglioside Binding Activity of the Tetanus Toxin HC Fragment Destroys Immunogenicity: Implications for Development of Novel Tetanus Vaccines
Omar Qazi,1
Dorothea Sesardic,2
Robert Tierney,2
Zahra Söderbäck,2
Dennis Crane,2
Barbara Bolgiano,2 and
Neil Fairweather1*
Centre for Molecular Microbiology and Infection, Imperial College London, London SW7 2AZ, United Kingdom,1
Division of Bacteriology, National Institute for Biological Standards and Control, South Mimms, Potters Bar, Hertfordshire EN6 3QG, United Kingdom2
Received 28 March 2006/
Returned for modification 5 May 2006/
Accepted 2 June 2006
 |
ABSTRACT
|
|---|
In this study, the immunogenicities of the nontoxic HC fragment of tetanus toxin and derivatives lacking ganglioside binding activity were compared with that of tetanus toxoid after subcutaneous immunization of mice. Wild-type HC (HCWT) protein and tetanus toxoid both elicited strong antibody responses against toxoid and HC antigens and provided complete protection against toxin challenge. Mutants of HC containing deletions essential for ganglioside binding elicited lower responses than HCWT. HCM115, containing two amino acid substitutions within the ganglioside binding site, provided reduced protection against tetanus toxin challenge compared with HCWT, consistent with lower anti-HC and anti-toxoid antibody titers. Circular-dichroism spectroscopy and intrinsic fluorescence spectroscopy showed minimal structural perturbation in HCM115. We conclude that the presence of the ganglioside binding site within HC may be essential for induction of a fully protective anti-tetanus response comparable to that induced by tetanus toxoid by subcutaneous injection.
 |
INTRODUCTION
|
|---|
Current tetanus vaccines are based on inactivated tetanus toxin and are extremely effective in generating serum anti-toxin antibodies which protect against the highly potent neurotoxin released upon infection by Clostridium tetani (10). However, three doses of an injectable vaccine are necessary, which is far from ideal in many developing countries where the logistics of storage, delivery, and compliance are complex. Consequently, there are an estimated 250,000 cases of tetanus per year, the majority of which are neonatal tetanus (4). A novel vaccine that could be given by the oral, intranasal, or transdermal route could potentially reduce the burden of neonatal tetanus as well as provide a convenient booster for the adult population.
Tetanus toxin is a 150-kDa protein composed of three domains, each of approximately 50 kDa (21); the N-terminal L chain contains zinc endopeptidase activity (24), the HN chain is involved in escape of the toxin from endocytotic vesicles, and the HC chain is involved in binding to cellular receptors (17, 25). Tetanus toxin binds cell surface gangliosides and possibly a protein receptor, a process mediated solely through the HC chain (17, 25). Structural analysis of HC, also termed fragment C, complexed with synthetic ganglioside reveals two distinct ganglioside binding sites on HC (8, 12), termed the "Gal4-GalNAc3'" and "sialic acid" binding sites. Mutation of residues within or around these sites in HC results in decreased binding to gangliosides and to neuronal cells (23, 25). The role of this cell binding in the interaction with immune cells, specifically antigen-processing cells, is unknown.
HC can induce protective antibodies in animals when given by a variety of delivery systems and routes, e.g., parenterally (19), orally using an attenuated Salmonella delivery system (9), as a plant vaccine (30), or as a DNA vaccine (1). Both tetanus toxoid and HC also elicit protective responses after mucosal (6) and transcutaneous delivery using suitable adjuvants (29). In one clinical study, attenuated strains of Salmonella enterica serovar Typhi expressing HC (2) given orally to human volunteers as a typhoid vaccine raised levels of serum antibody to tetanus toxoid in individuals who had low anti-tetanus titers at the start of the trial (28). To this end, HC has been proposed as a possible replacement for the existing tetanus toxoid vaccine.
It has been recently argued that new vaccines against diphtheria and pertussis should be composed of recombinant, genetically inactivated toxin components (22). A logical extension of this argument is to include a recombinant tetanus antigen, for example, HC, which would be expected to have clear advantages over toxoid in ease of production, characterization, and homogeneity. However, HC is known to bind to neuronal cells and is trafficked to higher centers in the central nervous system via retrograde axonal transport (3, 11). While this does not appear to give rise to any obvious pathology, it would be highly preferable to use an antigen that lacked this activity and thus reduce any potential side effects if the protein were to be used as a human vaccine.
In this report, we compare the properties of tetanus toxoid with those of wild-type HC (HCWT) and mutant HC molecules containing deletions or single-site substitutions in the two ganglioside binding sites that are essential for retrograde transport to the central nervous system and assess their immunogenicities and protective capacities against tetanus toxin challenge in mice.
 |
MATERIALS AND METHODS
|
|---|
Bacterial strains, plasmids, and molecular biology techniques.
Escherichia coli BL21 was used as the host for all plasmids. Plasmid pKS1, encoding wild-type HC, and its derivatives encoding mutant proteins, HCM28 (
Gln1274-Pro1279), HCM37 (
His1271-Asp1282), and HCM58 (
Asp1214-Asn1219), were described previously (25). HCM115 (Arg1226Ala, Trp1289Ala) was constructed by site-directed mutagenesis of pKS1 using a QuikChange kit (Stratagene, Cambridge, United Kingdom) and the primers 5' CTGGACAGAATTCTGGCTGTTGGTTACAACGCT 3', 5' AGCGTTGTAACCAACAGCCAGAATTCTGTCCAG 3', 5' CTGATCGCTTCTAACGCTTACTTCAACCACCTG 3', and 5' CAGGTGGTTGAAGTAAGCGTTAGAAGCGATCAG 3'.
Protein expression, purification, and characterization.
Bacterial strains were grown in Luria-Bertani medium containing kanamycin (50 µg/ml) where appropriate. Expression of proteins was induced by the addition of isopropyl-ß-D-thiogalactopyranoside (IPTG) to a final concentration of 1 mM. Cells were pelleted by centrifugation (5,500 x g, 15 min) and lysed by sonication, and the His-tagged proteins were purified by nickel affinity chromatography as described previously (25). Further purification was achieved by size exclusion chromatography using a Pharmacia Hiload 16/60 Superdex 200 preparatory-grade column. Endotoxin content was measured using the Limulus amoebocyte lysate microtest gelating assay (European Pharmacopoeia, 2005) using E. coli endotoxin as a reference (NIBSC 84/691). Protein concentrations were determined using the bicinchoninic acid assay (Pierce).
For optical spectroscopy, HC protein samples were dialyzed at 4°C into 10 mM sodium phosphate, pH 7.9. Absorbance maxima of the samples were determined at 279 nm (A279 to A350). Protein concentrations were calculated using theoretically determined extinction coefficients using the Mach equation (18). For HCWT, the coefficient A279 (absorbance at 0.1% [wt/vol]) of 1.695 liters g1 cm1 was used. Solutions of 0.5 ml were scanned in 1-cm-path-length quartz cuvettes from 500 nm to 240 nm.
Antibody binding.
Direct enzyme-linked immunosorbent assays (ELISAs) were performed by coating proteins diluted in phosphate-buffered saline (PBS) overnight at 4°C onto microtiter plates (Maxisorp; Nunc) at 1 µg/ml. After being washed with PBS containing 0.05% Tween 20, plates were blocked at 37°C with PBS containing 3% milk prior to the addition of serial dilutions of scFvHC9 or TT10 antibody. TT10 is an anti-HC monoclonal antibody with toxin neutralization activity (32). scFvHC9 is a recombinant human single-chain antibody specific for HC (equilibrium dissociation constant for HCWT, approximately 90 nM). scFvHC9 was isolated by antibody phage display against HCWT and inhibits binding of HCWT to GT1b gangliosides, as determined by ELISA (O. Qazi and N. Fairweather, unpublished data). After being washed, plates were incubated for 1 h with either horseradish peroxidase (HRP)-conjugated rabbit anti-rat immunoglobulin G (IgG) antibodies (DAKO) diluted 1 in 1,000 for TT10 visualization or mouse anti-9E10 antibodies (Mike Wright, Imperial College London, United Kingdom) diluted 1 in 5 for scFvHC9 visualization. Plates incubated with scFvHC9 were washed and incubated with HRP-conjugated rabbit anti-mouse antibodies (DAKO) for a further 1 h. Antibody binding was detected at 490 nm by the addition of o-phenylenediamine dihydrochloride (Sigma). Antibody concentrations yielding 50% maximum binding were calculated and are expressed as percentages of binding to HCWT. Capture ELISAs were performed by coating of plates with TT10 (100 µl of 1 µg/ml in carbonate buffer, pH 9.6) at 4°C overnight. After being washed and blocked as described above, plates were incubated for 2 h with doubling dilutions of test proteins. After plates were washed, 100 µl purified guinea pig IgG anti-tetanus toxoid (4.75 µg/ml) was added for 2 h at 37°C. After being washed, plates were incubated with HRP-conjugated goat anti-guinea pig IgG (diluted 1 in 2,000) for 1 h, and binding was detected at 405 nm by the addition of ABTS [2,2'-azinobis(3-ethylbenzthiazolinesulfonic acid)] substrate.
Ganglioside binding ELISA.
Ganglioside binding assays were performed as described previously (25). Microtiter plates were coated with 0.5 µg of bovine ganglioside GT1b per well (Sigma) and blocked with PBS containing 3% bovine serum albumin at 37°C, and HC proteins were added for 2 h. After being washed with PBS containing 0.05% Tween 20, plates were incubated for 1 h with polyclonal rabbit anti-HC antibodies (diluted 1 in 10,000), washed, and incubated for 1 h with HRP-conjugated goat anti-rabbit IgG antibodies (diluted 1 in 1,000; DAKO). Detection was at 490 nm after the addition of o-phenylenediamine dihydrochloride (Sigma). Calculated equilibrium dissociation constants were compared with that of HCWT to give percent binding values.
Intrinsic fluorescence spectroscopy.
Fluorescence spectra were obtained using a Spex Fluoromax single-photon-counting spectrofluorometer at 23°C as described previously (14) using excitation wavelengths of 280 or 295 nm. Samples were diluted to approximately 2 µg/ml in 1 ml of 10 mM sodium phosphate buffer, pH 7.9. Spectra were corrected by subtracting the corresponding buffer baseline spectra.
CD spectroscopy.
Near- and far-UV circular-dichroism (CD) spectra were obtained using a Jasco J-720 spectropolarimeter (Jasco, Tokyo, Japan) at 20 °C (±1°C) as described previously (14). Samples contained between 1.3 and 1.9 mg/ml of HC protein. For secondary-structure analysis, the software programs Varslc1 (20) and Selcon (26, 27) were used. For Varslc1, CD data between 180 and 260 nm were used with a 33-protein basis set and default parameters; for Selcon, CD data between 190 and 250 nm were used with a 17-protein basis set (26, 27) and default parameters. The proportions of secondary-structure elements present in crystal structures were calculated using the DSSP (15) and XtlSSTR (16) computer programs.
PC12-HC cell binding assay.
Rat pheochromocytoma (PC12) cells (Judit Herreros, Imperial College London, London, United Kingdom) were grown in Dulbecco's modified Eagle's medium containing 4 mg/liter glucose supplemented with 7.5% fetal calf serum, 7.5% horse serum, 100 µg/ml penicillin, 100 µg/ml streptomycin, and 4 mM L-glutamine. Glass coverslips coated with 5 µg poly-D-lysine were placed in 24-well cell culture plates and 5 x 104 PC12 cells added, followed by nerve growth factor (NGF) (75 ng/ml, 7S NGF; Alexis Corporation) after 1 to 2 days. HC proteins diluted to 5 µg/ml in PBS containing 3% bovine serum albumin and 10% fetal calf serum were incubated with cells for 1 h at 4°C. Cells were fixed at room temperature for 15 min with 4% formaldehyde in PBS and incubated for 1 h with rabbit anti-HC (diluted 1 in 5,000), followed by incubation for 30 min with fluorescein isothiocyanate-conjugated swine anti-rabbit IgG antibodies (diluted 1 in 1,000; DAKO). Coverslips were washed and mounted onto slides, and cell binding was visualized using a Nikon Eclipse E600 fluorescent microscope.
Immunization and immunological analysis.
Female NIH mice (18 to 22 g; Harlan, United Kingdom) were immunized subcutaneously with HC or tetanus toxoid (5,000 limit-of-flocculation units/ml, 12.5 mg/ml protein; NIBSC 01/126) in PBS on days 0 and 28 or 35 as indicated in the text. Sera were taken at day 35 or 42 and analyzed for the presence of anti-toxoid or anti-HC antibodies by ELISA. Plates were coated with antigen (0.1 µg/ml HC or 0.5 limit-of-flocculation units [
1.25 µg/ml toxoid]). ELISA antibody levels were calculated for individual sera from groups of mice and were expressed in IU/ml in relation to the mouse reference reagent calibrated to the WHO International Standard. Mice were challenged on day 62 with 50 50% paralytic doses (PD50s) of tetanus toxin and survivors assessed after 4 days. Results were expressed as percentages of animals surviving challenge in relation to total number of mice treated. Results were expressed as geometric means per group with 95% confidence intervals. Comparisons between the groups were made using the Mann-Whitney test.
 |
RESULTS
|
|---|
Immunization of mice with deletion mutants of HC.
Preliminary mouse immunization experiments were conducted using HCWT and mutant proteins containing deletions in domains of HC required for ganglioside binding. HCM28 (
Gln1274-Pro1279) and HCM37 (
His1271-Asp1282) both contain deletions within the Gal4-GalNAc3 binding site, while HCM58 (
Asp1214-Asn1219) contains a deletion within the sialic acid binding site (12, 25). These deletions could well affect the immunogenicities of the proteins, for example, by subtly altering the structure of the protein or by direct loss of protective epitopes. Mutant proteins containing defined amino acid substitutions within the ganglioside binding sites were also constructed: HCM72, containing a Trp1289Ala substitution within the Gal4-GalNAc3 site; HCM64, containing an Arg1226Ala substitution within the sialic acid site; and HCM115, containing both mutations. Ganglioside GT1b binding activities were determined for all proteins. HCM28, HCM37, and HCM58 proteins had reduced ganglioside binding activities compared to HCWT, consistent with previous results (25). Binding activities compared to those for HCWT were 12.5% for HCM64, 1.3% for HCM72, and <1% for HCM115 (Table 1). Endotoxin levels were below 120 IU/mg protein (most were <30 IU/mg protein) and were deemed acceptable (Table 1). All proteins retained the ability to bind to polyclonal anti-HC antibody and to TT10, a monoclonal antibody recognizing a neutralizing epitope within HC (32). HCWT and HCM72 also bound to scFvHC9, a single-chain human recombinant antibody selected for reactivity to HCWT (our unpublished data), whereas HCM64 and HCM115, both containing the Arg1226Ala substitution, did not bind to this antibody. Thus, scFvHC9 fortuitously can differentiate between HCWT and HCM115 by recognizing an epitope that must encompass or lie near Arg1226, part of the sialic acid binding site.
The immunogenicities of the HC deletion proteins were compared with that of tetanus toxoid in a mouse protection study. Mice were given two subcutaneous doses of 0.5, 5, or 50 µg of protein 28 days apart and serum samples taken 1 week after the second immunization (Fig. 1). Antibodies to tetanus toxoid were determined by ELISA in sera from individual animals and calculated in IU/ml. Four weeks after the test bleeds, mice were directly challenged with tetanus toxin and the results expressed as percentages of animals showing protection (Fig. 1). All HC proteins afforded complete protection against toxin challenge after two 50-µg doses, but differences were observed between the proteins at lower doses. HCM37 gave no protection at the 0.5-µg dose, and HCM28 and HCM58 gave 80% and 40% protection, respectively. All mutant HC proteins induced lower anti-tetanus toxoid responses than HCWT protein, with HCM37 giving the lowest antibody level and the lowest level of protection. Pooled mouse sera from the 5-µg HCWT and toxoid groups were tested for protective antibodies in vivo using the mouse passive protection assay calibrated to the WHO International Standard for tetanus antitoxin (NIBSC TE-3). Consistent with the antibody response in ELISA to tetanus toxoid, the levels of functional antibodies in the sera of animals immunized with toxoid were 31 IU/ml (26-38), approximately fourfold higher than those of animals immunized with HCWT, which induced a response of 9.5 (5.7 to 28.5) IU/ml.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1. Antibody responses of mice immunized with tetanus toxoid and HC deletion proteins. Mice were immunized on days 0 and 28 with 0.5, 5.0, or 50 µg of HCWT, HCM28, HCM37, HCM58, or tetanus toxoid. Mice were test bled on day 35. Anti-toxoid antibodies were determined by ELISA using individual sera from groups of mice (n = 5) and are expressed in IU/ml in relation to a mouse reference calibrated to the WHO International Standard (NIBSC in-house reagent). The geometric means for five animals with upper 95% confidence limits are shown. All mice in each group (n = 5) were challenged with 50 PD50s of tetanus toxin on day 62 and the percentage of survivors assessed after 4 days.
|
|
One possible reason for the lower immunogenicities of the mutant HC proteins could be structural instability. Using the 5.0-µg dose, HCWT, HCM28, and HCM37 were treated with formaldehyde in an attempt to stabilize their structures. Treatment with 0.02% formaldehyde resulted in increased antibody levels for HCWT and HCM28 (P < 0.05) and retention of protection as determined by the mouse protection assay. However, neither an increase in antibody levels nor an increase in protection against challenge was seen for HCM37. Higher formaldehyde concentrations (0.2% and 2%) resulted in a loss of immunogenicity and reduced levels of protection, along with increased intermolecular cross-linking (our unpublished data).
Characterization of HC proteins containing defined changes within the ganglioside binding sites.
The reduced ganglioside binding was expected to result in a decreased ability to bind to neuronal cells (13, 25). Binding of HCWT to NGF-induced PC12 cells produced uniform staining of the neuronal processes and the cell membrane, displaying regions of punctate staining. In contrast, very little staining was evident with HCM64, HCM72, and HCM115, demonstrating that these proteins had very weak binding activities to PC12 cells compared with HCWT (Fig. 2).

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 2. Binding of HCWT and HCM115 protein to NGF differentiated PC12 cells. (A) HCWT. (B) HCM115. Protein (5 µg/ml) was added to differentiated cells for 1 h at 4°C prior to addition of rabbit anti-HC and visualization with fluorescein isothiocyanate-conjugated swine anti-rabbit antibody. Phase contrast images are shown on the left panel and immunofluorescence on the right. Bar is 20 µm.
|
|
In order to determine whether the mutant HC proteins were folded in a manner similar to that of HCWT, intrinsic fluorescence and CD spectroscopy were employed. Intrinsic fluorescence spectroscopy demonstrated that HCWT, HCM64, HCM72, and HCM115 proteins displayed similar emission spectra, using an excitation wavelength of 280 or 295 nm. Fluorescence emission maxima of 328 nm for HCWT and 328 to 329 nm for the mutants were obtained. For tryptophan fluorescence (excitation wavelength, 295 nm), fluorescence emission maxima of 330 nm for HCWT and 330 to 331 nm for the HC mutants were found. Near-UV (250 to 320 nm) and far-UV (180 to 260 nm) CD spectra were collected for HCWT and for mutant HC proteins. Small but insignificant changes in the conformation or secondary-structure content of HCM115 (or the single-amino-acid mutant HCM64 or HCM72) compared to that of HCWT were apparent from the far-UV spectra (Fig. 3A). The secondary-structure contents of HCWT and HCM115 proteins were determined from the far-UV CD spectra recorded (Table 2). The proportions of secondary-structure elements present in the crystal structures of HC (8, 31) were also calculated for comparison using the DSSP (15) and XtlSSTR (16) programs. The secondary-structure calculations from the CD data differ slightly from the values calculated from the crystal structures. Taken together, these results indicate that there may be structural differences between HCWT and HCM115 but that these are likely to be minor. Analysis of the near-UV CD spectra (Fig. 3B) showed that HCM115 displayed a slightly less intense Tyr-Trp spectrum than either HCWT or HCM72. This could be indicative of structural destabilization surrounding the Gal4-GalNAc3 and sialic acid binding sites as a consequence of the mutations introduced.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3. Far-UV (180 to 260 nm) (A) and near-UV (250 to 320 nm) (B) CD spectra of HCWT, HCM115, HCM64, and HCM72 proteins at between 1.3 and 1.9 mg/ml.
|
|
Immunization of mice with ganglioside binding site mutants of HC.
A second immunization study was carried out using the HCWT and HCM115 proteins. A size exclusion chromatography step was introduced following the Ni2+ affinity chromatography to ensure that endotoxin levels were acceptable (Table 1). Groups of five mice were immunized subcutaneously with two doses of either 5 µg or 0.5 µg of HCWT or HCM115 35 days apart. Control groups were immunized with 5, 1, or 0.1 µg of tetanus toxoid or with PBS alone. Sera from individual animals were then tested for the presence of antibodies to tetanus toxoid or HC protein (Fig. 4). HCM115 induced an 80- to 100-fold-lower anti-HC response than HCWT at both 0.5-µg and 5-µg doses (P < 0.05 for both). A significant difference is also seen when the anti-toxoid titers are compared, where a 20- to 200-fold-lower response was seen with HCM115 than with HCWT (P < 0.05 at the 5-µg dose). The results were found to be dependent on the coating antigen used. When HC was used as the coating antigen, the titers for HCWT were approximately three times higher than those of tetanus toxoid, but these differences were not found to be significant. However, when toxoid was used as the coating antigen, the anti-toxoid titers were approximately four times greater than the anti-HC titers. These results were significant; responses to HC were significantly lower than responses to tetanus toxoid at doses of both 0.5 µg and 5 µg (P < 0.05 for both). Three weeks after the second immunization, mice were challenged with tetanus toxin (Fig. 4). Complete protection was afforded to those mice immunized with 5 µg or 0.5 µg of HCWT, with 5 µg of HCM115, or with 0.1 or 0.5 µg of tetanus toxoid. However, only 50% of mice receiving 0.5 µg HCM115 survived the challenge, consistent with the lower titers of anti-HC and anti-toxoid generated by this group. Overall, the antibody responses were higher in this experiment than in the preliminary experiment (Fig. 1). This is most likely due to the longer time between the primary immunization and the boost in the second experiment (Fig. 4).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4. Antibody responses of mice immunized with tetanus toxoid and HCM115 protein. Mice were immunized on days 0 and 35 with 5.0 or 0.5 µg of HCWT or HCM115 or with 5.0, 0.5, or 01 µg of tetanus toxoid. Mice were test bled on day 42. Anti-toxoid (A) and anti-HC (B) antibodies were determined by ELISA using individual sera from groups of mice (n = 5) and are expressed in IU/ml in relation to a mouse reference calibrated to the WHO International Standard (NIBSC in-house reagent). The geometric means for 5 animals with upper 95% confidence limits are shown. All mice in each group (n = 5, except for the 50% protection group [n = 4]) were challenged with 50 PD50s of tetanus toxin on day 62 and the percentage of survivors assessed after 4 days.
|
|
 |
DISCUSSION
|
|---|
In this study, we compared the immunogenicities of wild-type HC protein, mutants of HC defective in ganglioside binding, and tetanus toxoid. HC holds considerable promise as a tetanus vaccine, particularly in formulations that can be given by the intranasal (5, 7), transcutaneous, (29), or oral (28) route. The evaluation of the immunogenicity of HC compared to that of toxoid is therefore of considerable importance. HCWT elicited protective antibodies as measured by direct toxin challenge and at all doses used (0.5, 5, and 50 µg) provided full protection. The levels of anti-toxoid antibodies generated by HC were lower than those generated by toxoid on a weight-for-weight basis, but the levels of anti-HC antibodies did not vary significantly. Functional antibodies in sera of animals immunized with toxoid were approximately fourfold higher than those in sera of animals immunized with the same amount of HCWT protein, which induced a response of 9.5 (5.7 to 28.5) IU/ml, almost 1,000-fold higher than the level considered to confer full protection.
Mutants of HC lacking 6 amino acid residues (HCM28 and HCM58) with reduced ganglioside and cell binding activity showed reduced levels of protection at low doses of antigen compared to HCWT, but removal of 12 residues (HCM37) resulted in a more substantial reduction in both anti-toxoid antibodies and protection against toxin challenge. This reduced immunogenicity can most easily be explained by loss of epitopes and/or by structural alteration, although these were not formally tested here. Examination of the crystal structure of HC (8, 31) reveals that, although the residues deleted do not encompass helical or sheet regions, these mutant proteins nevertheless are unlikely to fold in exactly the same way as HCWT protein. The defined mutant HCM115, containing only two amino acid substitutions, had greatly reduced ganglioside binding and cell binding activities but surprisingly was significantly reduced in immunogenicity compared to HCWT. HCM115 had minimal structural differences compared to HCWT as determined by CD spectroscopy, and therefore, the reasons behind this reduced immunogenicity are uncertain, although HCM115 has lost at least one epitope that is recognized by the single-chain antibody scFvHC9. The loss of ganglioside binding activity could interfere with interactions involving cellular receptors involved in antigen recognition or processing pathways. However, tetanus toxoid does not bind gangliosides or neuronal cells and is highly immunogenic. This raises the possibility that the mechanisms for inducing a protective response may be different between tetanus toxoid and HC protein. The ability of HC to bind gangliosides may be an important factor contributing to its stability, a parameter essential for induction of protective response to proteins, particularly by the subcutaneous route. As a general rule, proteins with high serum clearance rates and high susceptibilities to proteases are poorly immunogenic. Further experiments to determine the in vitro and in vivo stabilities of HCM115 would address these questions. For example, antigens could be incubated with serum and degradation monitored over a period of time by Western blot analysis. Robbins et al. (22) have argued that the current diphtheria and pertussis components should be replaced with genetically inactivated mutant toxins. This argument could be extended to all three components of the diphtheria-tetanus-pertussis vaccine, and the data reported here support the notion that HC should be seriously considered as the nontoxic component of new diphtheria-tetanus-pertussis vaccines.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Mike Wright and Mahendra Deonarain for assistance and helpful discussions on single-chain antibodies.
O.Q. was supported by a Ph.D. studentship from the Biotechnology and Biological Sciences Research Council (United Kingdom).
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Centre for Microbiology and Infection, Imperial College London, Flowers Building, South Kensington Campus, London SW7 2AZ, United Kingdom. Phone: 44 (0) 20 7594 5247. Fax: 44 (0) 20 7594 3069. E-mail: n.fairweather{at}imperial.ac.uk. 
Editor: D. L. Burns
 |
REFERENCES
|
|---|
| 1. | Anderson, R., X. M. Gao, A. Papakonstantinopoulou, M. Roberts, and G. Dougan. 1996. Immune response in mice following immunization with DNA encoding fragment C of tetanus toxin. Infect. Immun. 64:3168-3173.[Abstract] |
| 2. | Chatfield, S. N., N. Fairweather, I. Charles, D. Pickard, M. Levine, D. Hone, M. Posada, R. A. Strugnell, and G. Dougan. 1992. Construction of a genetically defined Salmonella typhi Ty2 aroA, aroC mutant for the engineering of a candidate oral typhoid-tetanus vaccine. Vaccine 10:53-60.[Medline] |
| 3. | Coen, L., R. Osta, M. Maury, and P. Brulet. 1997. Construction of hybrid proteins that migrate retrogradely and transynaptically into the central nervous system. Proc. Natl. Acad. Sci. USA 94:9400-9405.[Abstract/Free Full Text] |
| 4. | Dietz, V., J. B. Milstien, F. van Loon, S. Cochi, and J. Bennett. 1996. Performance and potency of tetanus toxoid: implications for eliminating neonatal tetanus. Bull. W. H. O. 74:619-628.[Medline] |
| 5. | Douce, G., M. Fontana, M. Pizza, R. Rappuoli, and G. Dougan. 1997. Intranasal immunogenicity and adjuvanticity of site-directed mutant derivatives of cholera toxin. Infect. Immun. 65:2821-2828.[Abstract] |
| 6. | Douce, G., C. Turcotte, I. Cropley, M. Roberts, M. Pizza, M. Domenghini, R. Rappuoli, and G. Dougan. 1995. Mutants of Escherichia coli heat-labile toxin lacking ADP-ribosyltransferase activity act as nontoxic, mucosal adjuvants. Proc. Natl. Acad. Sci. USA 92:1644-1648.[Abstract/Free Full Text] |
| 7. | Duc, L. H., H. A. Hong, N. Fairweather, E. Ricca, and S. M. Cutting. 2003. Bacterial spores as vaccine vehicles. Infect. Immun. 71:2810-2818.[Abstract/Free Full Text] |
| 8. | Emsley, P., C. Fotinou, I. Black, N. F. Fairweather, I. G. Charles, C. Watts, E. Hewitt, and N. W. Isaacs. 2000. The structures of the H(C) fragment of tetanus toxin with carbohydrate subunit complexes provide insight into ganglioside binding. J. Biol. Chem. 275:8889-8894.[Abstract/Free Full Text] |
| 9. | Fairweather, N. F., S. N. Chatfield, A. J. Makoff, R. A. Strugnell, J. Bester, D. J. Maskell, and G. Dougan. 1990. Oral vaccination of mice against tetanus by use of a live attenuated Salmonella carrier. Infect. Immun. 58:1323-1326.[Abstract/Free Full Text] |
| 10. | Farrar, J. J., L. M. Yen, T. Cook, N. Fairweather, N. Binh, J. Parry, and C. M. Parry. 2000. Tetanus. J. Neurol. Neurosurg. Psychiatry 69:292-301.[Free Full Text] |
| 11. | Fishman, P. S., and D. R. Carrigan. 1987. Retrograde transneuronal transfer of the C-fragment of tetanus toxin. Brain Res. 406:275-279.[CrossRef][Medline] |
| 12. | Fotinou, C., P. Emsley, I. Black, H. Ando, H. Ishida, M. Kiso, K. A. Sinha, N. F. Fairweather, and N. W. Isaacs. 2001. The crystal structure of tetanus toxin Hc fragment complexed with a synthetic GT1b analogue suggests cross-linking between ganglioside receptors and the toxin. J. Biol. Chem. 276:32274-32281.[Abstract/Free Full Text] |
| 13. | Herreros, J., G. Lalli, and G. Schiavo. 2000. C-terminal half of tetanus toxin fragment C is sufficient for neuronal binding and interaction with a putative protein receptor. Biochem. J. 347:199-204.[Medline] |
| 14. | Ho, M. M., B. Bolgiano, and M. J. Corbel. 2000. Assessment of the stability and immunogenicity of meningococcal oligosaccharide C-CRM197 conjugate vaccines. Vaccine 19:716-725.[CrossRef][Medline] |
| 15. | Kabsch, W., and C. Sander. 1983. Dictionary of protein secondary structure: pattern recognition of hydrogen-bonded and geometrical features. Biopolymers 22:2577-2637.[CrossRef][Medline] |
| 16. | King, S. M., and W. C. Johnson. 1999. Assigning secondary structure from protein coordinate data. Proteins 35:313-320.[CrossRef][Medline] |
| 17. | Lalli, G., J. Herreros, S. L. Osborne, C. Montecucco, O. Rossetto, and G. Schiavo. 1999. Functional characterisation of tetanus and botulinum neurotoxins binding domains. J. Cell Sci. 112:2715-2724.[Abstract] |
| 18. | Mach, H., C. R. Middaugh, and R. V. Lewis. 1992. Statistical determination of the average values of the extinction coefficients of tryptophan and tyrosine in native proteins. Anal. Biochem. 200:74-80.[CrossRef][Medline] |
| 19. | Makoff, A. J., S. P. Ballantine, A. E. Smallwood, and N. F. Fairweather. 1989. Expression of tetanus toxin fragment C in E. coli: its purification and potential as a vaccine. Bio/Technology 7:1043-1046. |
| 20. | Manavalan, P., and W. C. Johnson, Jr. 1987. Variable selection method improves the prediction of protein secondary structure from circular dichroism spectra. Anal. Biochem. 167:76-85.[CrossRef][Medline] |
| 21. | Montecucco, C., and G. Schiavo. 1993. Tetanus and botulism neurotoxins: a new group of zinc proteases. Trends Biochem. Sci. 18:324-327.[CrossRef][Medline] |
| 22. | Robbins, J. B., R. Schneerson, B. Trollfors, H. Sato, Y. Sato, R. Rappuoli, and J. M. Keith. 2005. The diphtheria and pertussis components of diphtheria-tetanus toxoids-pertussis vaccine should be genetically inactivated mutant toxins. J. Infect. Dis. 191:81-88.[CrossRef][Medline] |
| 23. | Rummel, A., S. Bade, J. Alves, H. Bigalke, and T. Binz. 2003. Two carbohydrate binding sites in the H(CC)-domain of tetanus neurotoxin are required for toxicity. J. Mol. Biol. 326:835-847.[CrossRef][Medline] |
| 24. | Schiavo, G., F. Benfenati, B. Poulain, O. Rossetto, P. Polverino de Laureto, B. R. DasGupta, and C. Montecucco. 1992. Tetanus and botulinum-B neurotoxins block neurotransmitter release by proteolytic cleavage of synaptobrevin. Nature 359:832-835.[CrossRef][Medline] |
| 25. | Sinha, K., M. Box, G. Lalli, G. Schiavo, H. Schneider, M. Groves, G. Siligardi, and N. Fairweather. 2000. Analysis of mutants of tetanus toxin HC fragment: ganglioside binding, cell binding and retrograde axonal transport properties. Mol. Microbiol. 37:1041-1051.[CrossRef][Medline] |
| 26. | Sreerama, N., and R. W. Woody. 1994. Protein secondary structure from circular dichroism spectroscopy. Combining variable selection principle and cluster analysis with neural network, ridge regression and self-consistent methods. J. Mol. Biol. 242:497-507.[Medline] |
| 27. | Sreerama, N., and R. W. Woody. 1993. A self-consistent method for the analysis of protein secondary structure from circular dichroism. Anal. Biochem. 209:32-44.[CrossRef][Medline] |
| 28. | Tacket, C. O., J. Galen, M. B. Sztein, G. Losonsky, T. L. Wyant, J. Nataro, S. S. Wasserman, R. Edelman, S. Chatfield, G. Dougan, and M. M. Levine. 2000. Safety and immune responses to attenuated Salmonella enterica serovar typhi oral live vector vaccines expressing tetanus toxin fragment C. Clin. Immunol. 97:146-153.[CrossRef][Medline] |
| 29. | Tierney, R., A. S. Beignon, R. Rappuoli, S. Muller, D. Sesardic, and C. D. Partidos. 2003. Transcutaneous immunization with tetanus toxoid and mutants of Escherichia coli heat-labile enterotoxin as adjuvants elicits strong protective antibody responses. J. Infect. Dis. 188:753-758.[CrossRef][Medline] |
| 30. | Tregoning, J. S., P. Nixon, H. Kuroda, Z. Svab, S. Clare, F. Bowe, N. Fairweather, J. Ytterberg, K. J. van Wijk, G. Dougan, and P. Maliga. 2003. Expression of tetanus toxin fragment C in tobacco chloroplasts. Nucleic Acids Res. 31:1174-1179.[Abstract/Free Full Text] |
| 31. | Umland, T. C., L. M. Wingert, S. Swaminathan, W. F. Furey, J. J. Schmidt, and M. Sax. 1997. Structure of the receptor binding fragment HC of tetanus neurotoxin. Nat. Struct. Biol 4:788-792.[CrossRef][Medline] |
| 32. | Xing, D. K. L., K. McLellan, M. J. Corbel, and D. Sesardic. 1996. Estimation of antigenic tetanus toxoid extracted from biodegradable microspheres. Biologicals 24:57-65.[CrossRef][Medline] |
Infection and Immunity, August 2006, p. 4884-4891, Vol. 74, No. 8
0019-9567/06/$08.00+0 doi:10.1128/IAI.00500-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Wright, A., Drudy, D., Kyne, L., Brown, K., Fairweather, N. F.
(2008). Immunoreactive cell wall proteins of Clostridium difficile identified by human sera. J Med Microbiol
57: 750-756
[Abstract]
[Full Text]