Infection and Immunity, August 2006, p. 4892-4899, Vol. 74, No. 8
0019-9567/06/$08.00+0 doi:10.1128/IAI.02087-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Plasmid Diversity in Neisseriae
Mark W. J. van Passel,
Arie van der Ende, and
Aldert Bart*
Center of Infection and Immunity Amsterdam (CINIMA), Department of Medical Microbiology, Academic Medical Center, Amsterdam, The Netherlands
Received 28 December 2005/
Returned for modification 9 March 2006/
Accepted 11 May 2006
 |
ABSTRACT
|
|---|
Horizontal gene transfer constitutes an important force in prokaryotic genome evolution, and it is well-known that plasmids are vehicles for DNA transfer. Chromosomal DNA is frequently exchanged between pathogenic and commensal neisseriae, but relatively little is known about plasmid diversity and prevalence among these nasopharyngeal inhabitants. We investigated the plasmid contents of 18 Neisseria lactamica isolates and 20 nasopharyngeal Neisseria meningitidis isolates. Of 18 N. lactamica strains, 9 harbored one or more plasmids, whereas only one N. meningitidis isolate contained a plasmid. Twelve plasmids were completely sequenced, while five plasmid sequences from the public databases were also included in the analyses. On the basis of nucleic acid sequences, mobilization, and replicase protein alignments, we distinguish six different plasmid groups (I to VI). Three plasmids from N. lactamica appeared to be highly similar on the nucleotide level to the meningococcal plasmids pJS-A (>99%) and pJS-B (>75%). The genetic organizations of two plasmids show a striking resemblance with that of the recently identified meningococcal disease-associated (MDA) phage, while four putative proteins encoded by these plasmids show 25% to 39% protein identity to those encoded by the MDA phage. The putative promoter of the gene encoding the replicase on these plasmids contains a polycytidine tract, suggesting that replication is subjected to phase variation. In conclusion, extensive plasmid diversity is encountered among commensal neisseriae. Members of three plasmid groups are found in both pathogenic and commensal neisseriae, indicating plasmid exchange between these species. Resemblance between plasmids and MDA phage may be indicative of dissemination of phage-related sequences among pathogenic and commensal neisseriae.
 |
INTRODUCTION
|
|---|
The genus Neisseria includes species that may be pathogens to their human host, such as N. meningitidis and N. gonorrhoeae, the causative agents of meningococcal disease and gonorrhea, respectively. Other members of this genus, such as N. lactamica, N. sicca, N. flavescens, and various others, do not cause disease but can colonize the human nasopharynx and have been involved in antibiotic resistance transfer to N. meningitidis (21, 28). Linz and coworkers have established that commensal neisseriae and N. meningitidis frequently exchange chromosomal DNA (17), consistent with the notion of a shared neisserial global gene pool (18). In a more recent study, we have shown that N. lactamica also contains putative virulence-associated sequences (32a).
Although few plasmids of neisseriae have been sequenced, different plasmids have been identified in both pathogenic and commensal neisseriae, albeit with a bias to antibiotic resistance plasmids (7, 22, 24). This limited amount of sequence data restricts insight into neisserial plasmid diversity and evolution. Notable exceptions are the gonococcal plasmids pJD1 (15) and pJD4 (6), the meningococcal plasmids pJS-A (12) and pJS-B (5), and the commensal neisseriae plasmids pNL01 from N. lactamica (32a) and pMIDG2830 from N. flavescens (19).
In order to obtain more insight into the role of plasmids in horizontal gene transfer among neisseriae, we evaluated plasmid content and diversity and nucleotide composition.
 |
MATERIALS AND METHODS
|
|---|
Bacterial strains and growth conditions.
Eighteen different N. lactamica isolates and 20 N. meningitidis isolates from the collection of the National Reference Laboratory for Bacterial Meningitis (RLBM), Academic Medical Center/RIVM, Amsterdam, The Netherlands, were used in this study and were obtained from healthy carriers in The Netherlands during the summer of 2004 (see Table 1). N. meningitidis and N. lactamica were differentiated by lactose fermentation, ß-galactosidase activity, and aminopeptidase tests. Three N. lactamica strains isolated from healthy carriers known to harbor plasmids were additionally selected. Neisseriae were grown on heated blood (chocolate) agar plates or in liquid tryptic soy broth (Difco) medium at 37°C in a humidified atmosphere of 5% CO2.
Plasmid DNA preparation, digestion, and sequence analysis.
Isolation of plasmid DNA from neisseriae was carried out using the Wizard kit (Promega), which allows efficient DNA isolation for plasmids up to 20 kbp in size. Restriction endonuclease digestion (both for restriction fragment length polymorphism pattern analyses and subcloning procedures) and subsequent heat inactivation were carried out according to the manufacturer's instructions (Roche). We subcloned (amplified) restriction fragments into the pCR2.1 vector (Invitrogen), pGEM-T vector (Promega), or a dephosphorylated SmaI-digested pUC18 vector (Promega) according to each respective manufacturer's instructions. Escherichia coli DH5
was transformed by the standard heat shock procedure. Plasmid inserts were sequenced using standard M13 primers or primer walking on cloned fragments or neisserial plasmid DNA according to the manufacturer's instruction (AB). Sequences were analyzed with CodonCode Aligner program (CodonCode Corporation) and analyzed with BLASTN or TBLASTX using the BLOSUM-62 substitution matrix (http://www.ncbi.nlm.nih.gov/BLAST/), the annotation tool Artemis software (www.sanger.ac.uk/), and the web tool NEBcutter version 2 (New England BioLabs, Inc.) (33).
Data analysis.
Clustering analysis of the different open reading frames (ORFs) was carried out using MEGA (Molecular Evolutionary Genetics Analysis) (16) (available from www.megasoftware.net), and genomic dissimilarity analyses of the different plasmids were carried out using 
-web as described previously (32). Tandem repeats and inverted repeats were detected using the Tandem (and Inverted) Repeats Finder at http://tandem.bu.edu/trf/trf.html (3).
Nucleotide sequence accession numbers.
The nucleotide sequence data of the various plasmids are available in the EMBL/GenBank/DDBJ nucleotide sequence databases under accession numbers DQ223897 through DQ223899, DQ227323 through DQ227327, and DQ229163 through DQ229166 as depicted in Table 1.
 |
RESULTS
|
|---|
Six different neisserial plasmid groups.
Of 18 N. lactamica strains, 9 carried one or more plasmids <20 kbp in size. In contrast, we identified only one plasmid-carrying isolate among 20 N. meningitidis throat isolates (Table 1; see Tables S1 and S2 in the supplemental material).
Three additional N. lactamica isolates, isolated prior to 2004 and known to carry plasmids, were included (Table 1). From this collection of N. lactamica isolates, a total of 12 plasmids were completely sequenced. Together with sequenced neisserial plasmids available in public databases (pJS-A, pJS-B, pJD1, pNL01, and pMIDG2830 [accession numbers are given in Table 1]), six distinct groups of neisserial plasmids (I to VI) could be distinguished on the basis of nucleotide identity and replication protein similarity. The grouping of the plasmids was supported by intragroup tandem repeat similarity (Table 2). In contrast to groups I and II, groups III and IV comprise plasmids heterogeneous in size, while groups V and VI are represented by only one plasmid each. The single N. meningitidis plasmid identified, pNM12, was approximately 4.2 kb in size on the basis of restriction fragment patterns, which were highly similar (>90% identical fragments) to that of pNL01 (group IV [data not shown]). An AluI restriction fragment of 259 bp was sequenced and was nearly identical (257/259 bp) to the N. lactamica pNL01 plasmid, which is 4,150 bp in size; therefore, pNM12 was not sequenced further. Three N. lactamica plasmids, one plasmid each from groups I, II, and IV, were not sequenced, as their AluI and RsaI restriction enzyme digestion patterns were identical to that of as a sequenced member of the corresponding plasmid group.
Coexistence of a group II plasmid and a group IV plasmid was found in two N. lactamica isolates, and the combination of a group III plasmid and a group IV plasmid was found in one isolate (see Table S1 in the supplemental material).
Different groups of neisserial plasmids. (i) Group I.
Group I consists of four plasmids almost identical in size (1,986 bp) and sequence, three of which have been isolated from N. lactamica strains isolated in 1975, 1993, and 2004 (pNL750149, pNL932024, and pNL12, respectively). Previously, pJS-A (AJ238491) was identified in Germany in N. meningitidis subgroup IV isolates exclusively (between 1986 and 1988) (12). The largest ORF, encoding a putative replication initiation factor (likely a topoisomerase) of 336 amino acids (pfam02486, E = 2 x 109), shows 31% identity (93/294 amino acid residues) to a putative protein on the 2-kbp cryptic plasmid from the ammonia-oxidizing bacterium Nitrosomonas (34), but no nucleotide identity has been found.
(ii) Group II.
Of 18 N. lactamica strains isolated in 2004, 5 contained a plasmid approximately 2.25 kbp in size. These almost identical plasmids, making up plasmid group II, display two noteworthy features. First, all contain a long homopolymeric guanine tract of variable length (10, 12, 12, and 15 guanine residues for plasmids pNL18.1, pNL7.1, pNL15, and pNL11, respectively). This homopolymeric G tract is located upstream of an ORF, p153, encoding a putative protein of 153 amino acids and therefore could be involved in transcriptional phase variation (26, 29). However, it is doubtful whether the p153 sequence encodes a protein, as there is no significant similarity to NCBI database entries, and no putative 35 and 10 promoter domains could be identified.
Second, these four plasmids all contain two inverted neisserial DNA uptake sequences (DUS) (shown underlined) with two adenosine residues in between the DUS (TTCAGACGGCAAGCCGTCTGAA). However, this sequence has the reverse orientation in plasmid pNL15.
(iii) Group III.
Group III consists of three different plasmids, of which two have been isolated from N. lactamica isolates (pNL3.2 and pNL9 [this study]) and one from N. meningitidis (pJS-B [5]). The remaining plasmid was previously identified among isolates from a cluster of hypervirulent N. meningitidis ET-37 (plasmid pJS-B, which can also occur as a chromosomal integration [5]). These plasmids vary considerably in size (ranging from 4 kbp [pNL3.2] to 8.3 kbp [pNL9]), and the genetic organization of the plasmids resembles that of the recently described meningococcal disease-associated (MDA) phage (4) (Fig. 1), as well as that of the recently described Eikenella corrodens virulence-associated plasmid pMU1 (1). Their putative replication-associated protein shows similarity to phage replication proteins (COG2946, E = 6 x1066). In addition, pJS-B and pNL9 both contain an ORF (pJS-B_8 and pNL9-8, respectively) with a conserved domain of the zonular occludens toxin Zot (pfam05707, E = 1 x 1048) family of proteins, which is 39% identical to its MDA homolog NMA1799 (Table 3).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1. Comparison of the genetic organizations of N. meningitidis plasmids pNL3.2, pNL9, and pJS-B and the meningococcal disease-associated island with the ORFs NMA1792 to NMA1800. Similar colors indicate similar protein-coding ORFs (except for white). The Eikenella corrodens pMU1 plasmid is depicted at the top of the figure.
|
|
Upstream of the genes encoding the putative phage replication proteins (pNL9-3, pJS-B_3, and pNL3.2_2) on the different plasmids of group III, a polymeric cytidine tract of variable length in the sequence C6-10N10G7 is found. With its flanking sequences, this sequence shows a striking resemblance with the phase-variable porA promoter sequence (30) (Fig. 2).

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 2. Analysis of the upstream region of the phage-associated replication proteins on plasmids from group III (pJS-B_3, pNL9-3, and pNL3.2_2 [see also Table 3]). In the comparison we included the upstream region of the putative phage-associated protein from the meningococcal disease-associated gene cluster (NMA1792), which is thought to be inactive, and the phase-variable promoter from the porA gene (from N. meningitidis MC58 [NMB1429]). The boxes represent regions of similarity between the porA promoter and plasmid sequences. The 35 and 10 domains of the porA promoter are underscored. The putative 35 region of the (inactive) NMA1792 promoter seems to have degenerated.
|
|
(iv) Group IV.
Plasmids in group IV are heterogeneous in size and were isolated from different bacterial species, N. gonorrhoeae, N. meningitidis, and N. lactamica (Table 4). pJD1 has been isolated from N. gonorrhoeae (15), which displays 72.3% nucleotide identity to pNL01 from N. lactamica (32a). However, on the basis of plasmid size, mobilization protein similarity, and replication protein similarity, four different subclasses (A to D) can be identified (Table 4). Some of these plasmids harbor combinations of these genes, suggestive of hybrid plasmids. Indeed, we were able to identify hybrid plasmids (pNL14 and pNL871104) based on nucleotide sequence similarity. Alternatively, the other plasmids evolved after several deletion events.
(v) Groups V and VI.
Group V and group VI plasmids (pMIDG2830 (accession number AY174058) and pJD4 (accession number NC_002098), respectively) consist of plasmids sequenced by other groups and are different from all previously mentioned neisserial plasmid groups on the basis of replication or mobility proteins.
Genome signature comparisons between plasmid DNA and chromosomal DNA display large differences.
The genome signature, which is the set of dinucleotide relative abundance values (13, 14), is one of the parameters available to identify putative horizontally transferred DNA. We compare the genome signature dissimilarity scores (
*) between the different neisserial plasmids identified in this study and a representative genome sequence (for N. lactamica we use the preliminary N. lactamica sequence, available as contigs at the Sanger Institute) as described previously (32). Briefly, the
* of the plasmids are compared to the
* of identical-sized fragments of the host genomes. High compositional dissimilarity between plasmid and host genome is reflected by a large percentage of genomic fragments with a lower
* than the
* for the plasmid. We find high compositional dissimilarity between plasmid DNA and chromosomal DNA for most plasmid groups (Table 5), as noted previously for a large collection of prokaryotic plasmids from the Plasmid Database (31). However, group II plasmids do not display a high genomic dissimilarity with the N. lactamica genome sequence.
View this table:
[in this window]
[in a new window]
|
TABLE 5. Compositional analyses based on the genome signatures between the different neisserial plasmids and neisserial speciesa
|
|
 |
DISCUSSION
|
|---|
In this study we describe the isolation and identification of 12 plasmids from N. lactamica isolates. Only 1 of 20 N. meningitidis throat isolates carried a plasmid, which is in accordance with the previous results of Backmann and colleagues (2). They found plasmids in 2 of 119 invasive meningococcal strains and in 1 of 50 meningococcal strains from the respiratory tract (2). In contrast, we found half of the N. lactamica isolates harboring a plasmid. Among gonococci, an even larger proportion of the isolates (96%) harbor plasmids (23), and multiple plasmids may be present in individual strains (6). Three N. lactamica strains were also found to carry more than one plasmid. In each case, the different plasmids belong to different plasmid groups (see Tables S1 and S2 in the supplemental material).
The reason for this erratic distribution of plasmids among different neisserial species remains unknown, but the erratic distribution suggests either limited establishment of plasmids in N. meningitidis or more efficient exchange between N. lactamica and N. gonorrhoeae or successful acquisition by N. lactamica and N. gonorrhoeae. Limited establishment might result if plasmids more readily integrate into the chromosome in N. meningitidis. Integration of pJS-B into the meningococcal chromosome was shown by Claus and colleagues (5). Differences in the ability to take up extracellular DNA could explain differences in plasmid acquisition. Although most neisseriae were found to be naturally competent, DUS-mediated transformation has been established only for the pathogenic species (9), and to our knowledge, natural transformation of N. lactamica has not yet been reported. However, plasmid transfer may follow a DUS-independent route for most plasmid groups, as only the compositionally nonanomalous group II plasmids contain copies of the DUS. Finally, different restriction barriers between the different species could influence successful establishment. Only a few restriction and modification systems that are present in N. meningitidis and have no isoschizomer in N. lactamica, are known notably NmeBI, NmeRI, and NmeSI. Only two plasmids (pNL3.1 and pJD4) contain sites for these restriction and modification systems, so it is unlikely that restriction barriers are the main reason for the observed differences in occurrence of all plasmids in N. meningitidis and N. lactamica.
The broad spectrum of plasmids described in this study should harbor suitable vectors for N. lactamica, which may be of interest, as N. lactamica is currently under consideration for its vaccine potential against meningococcal disease (10, 11).
The nucleotide sequences of the different neisserial plasmids display substantial diversity both in length and composition within the relatively small number of tested isolates. Together with the neisserial plasmids with chromosomal sequences available in public databases, we identified six distinct plasmid groups (I to VI) on the basis of nucleotide identity, restriction fragment length polymorphism, and protein similarity. Additionally, we considered intragroup genome signature resemblance and tandem repeat similarity. Group IV plasmids could be subdivided on the basis of the presence or absence of genes encoding Rep and Mob proteins. Plasmids pNL14 and pNL871104, harboring combinations of these genes, appear to be hybrid plasmids on the basis of sequence comparisons. As a consequence, these plasmids may have extended their host range, as they are found in three species, N. meningitidis, N. lactamica, and N. gonorrhoeae.
In group III, the different plasmids vary in length considerably. The genetic organizations of the ORFs encoding putative phage-associated proteins (including a putative toxin and a phage replication-associated protein) on the larger plasmids resemble that of the recently identified, integrated, MDA phage from N. meningitidis Z2491 (4). It is tempting to hypothesize that these N. lactamica plasmids may in fact be phage replicative forms isolated during the plasmid DNA isolation procedure. Further experiments are to be performed to confirm or refute this hypothesis. The identification of a putative phage toxin-encoding gene on N. lactamica plasmids highly similar (39% identical) to that of the MDA phage raises questions concerning the association between the MDA phages and pathogenic potential, as found recently in a study by Bille and coworkers (4). Obviously, N. lactamica lacks other virulence factors important in the pathogenicity of invasive disease (the capsule is one clear example).
The presence of disease-associated sequences in commensal bacteria indicates that commensal strains may form a reservoir of latent virulence factors, which may contribute to the variability of these factors in pathogenic neisseriae. As a clear example, Linz and coworkers demonstrated the frequent exchange of tbpB sequences between commensal neisseriae and N. meningitidis, which contributed significantly to the antigenic variation of the transferrin binding protein TbpB in meningococci (17). In a more recent study, we have shown that N. lactamica also contains genomic islands encoding putative virulence-associated genes with high similarity to genes on genomic islands in meningococci (32a).
The phase variation-associated sequence C6-10N10G7 upstream of the ORF encoding phage replication-associated protein is another feature in group III plasmids. The variation among the different plasmids in its homopolymeric cytidine tract and the striking resemblance with the phase-variable porA promoter in N. meningitidis (30) are indicative of a phase-variable expression of the Rep protein on these plasmids. Of note, a similar phase variation-associated sequence was previously identified upstream of NMA1792 by Snyder and coworkers (27). In vitro verification of phase variation for the putative phage replication proteins is required, but these sequences indicate that plasmids (or replicative forms of phages), neisserial phages, and even Eikenella corrodens plasmids potentially contain phase-variable genes.
A homopolymeric nucleotide tract of variable length was also identified in group II plasmids. Association of the expression of the ORF downstream of this homopolymeric guanidine tract with phase variation is uncertain, since the ORF shows no similarity to any database entry and we were unable to identify a putative promoter in the sequences flanking this guanidine tract.
Most of the plasmids have very high genomic dissimilarity scores compared to their respective genomic contexts. How this relates to the plasmid host histories is unclear. A high genomic dissimilarity score may reflect either a recent acquisition of the mobile element, a bias supporting extracellular stability, or an atypical genetic organization required to maintain its selfish and/or mobile behavior (31). In contrast, plasmids of group II have a genome signature similar to that of the N. lactamica genome. Also, group II plasmids contain a dyad neisserial DUS, as well as tandem repeat sequences that are relatively overrepresented in the meningococcal, gonococcal, and preliminary N. lactamica genome sequences, in contrast to plasmids of other groups. Together, these results suggest that plasmids of group II may have a longer evolutionary relationship with their host than plasmids of the other plasmid groups.
Carriage of N. lactamica may assist in the development of natural immunity to N. meningitidis by induction of cross-reactive antibodies (8). Moreover, the incidence of meningococcal disease is lower in communities with high N. lactamica carrier rates (20). It has been previously established that commensal and pathogenic neisseriae share a common gene pool (17, 18). Our data indicate that commensal neisseriae may function as a reservoir for putative virulence-associated sequences located on plasmids (e.g., those of group III) and on chromosomal genomic islands (32a). Possibly, during carriage of N. lactamica early in life, these pathogenicity-associated factors may contribute to the natural immunity to meningococcal infection later in life (25).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Kim Schipper for expert technical assistance.
This research was part of the Network of Excellence "European Virtual Institute for Functional Genomics of Bacterial Pathogens" funded by the Sixth Framework Programme of the European Commission (proposal/contract no. 512061).
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Department of Medical Microbiology, Academic Medical Center, P.O. Box 22660, 1100 DD Amsterdam, The Netherlands. Phone: 31 20 5664863. Fax: 31 20 6979271. E-mail: a.bart{at}amc.uva.nl. 
Editor: V. J. DiRita
Supplemental material for this article may be found at http://iai.asm.org/. 
 |
REFERENCES
|
|---|
| 1. | Azakami, H., H. Akimichi, M. Usui, H. Yumoto, S. Ebisu, and A. Kato. 2005. Isolation and characterization of a plasmid DNA from periodontopathogenic bacterium, Eikenella corrodens 1073, which affects pilus formation and colony morphology. Gene 351:143-148.[CrossRef][Medline] |
| 2. | Backmann, A., D. Danielsson, and P. Olcen. 1993. Plasmid carriage and antibiotic susceptibility of Neisseria meningitidis strains isolated in Sweden 1981-1990. Eur. J. Clin. Microbiol. Infect. Dis. 12:683-689.[CrossRef][Medline] |
| 3. | Benson, G. 1999. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 27:573-580.[Abstract/Free Full Text] |
| 4. | Bille, E., J. R. Zahar, A. Perrin, S. Morelle, P. Kriz, K. A. Jolley, M. C. Maiden, C. Dervin, X. Nassif, and C. R. Tinsley. 2005. A chromosomally integrated bacteriophage in invasive meningococci. J. Exp. Med. 201:1905-1913.[Abstract/Free Full Text] |
| 5. | Claus, H., J. Stoevesandt, M. Frosch, and U. Vogel. 2001. Genetic isolation of meningococci of the electrophoretic type 37 complex. J. Bacteriol. 183:2570-2575.[Abstract/Free Full Text] |
| 6. | Dillon, J. R., H. Li, K. Yeung, and T. A. Aman. 1999. A PCR assay for discriminating Neisseria gonorrhoeae beta-lactamase-producing plasmids. Mol. Cell Probes 13:89-92.[CrossRef][Medline] |
| 7. | Genco, C. A., J. S. Knapp, and V. L. Clark. 1984. Conjugation of plasmids of Neisseria gonorrhoeae to other Neisseria species: potential reservoirs for the beta-lactamase plasmid. J. Infect. Dis. 150:397-401.[Medline] |
| 8. | Gold, R., I. Goldschneider, M. L. Lepow, T. F. Draper, and M. Randolph. 1978. Carriage of Neisseria meningitidis and Neisseria lactamica in infants and children. J. Infect. Dis. 137:112-121.[Medline] |
| 9. | Goodman, S. D., and J. J. Scocca. 1988. Identification and arrangement of the DNA sequence recognized in specific transformation of Neisseria gonorrhoeae. Proc. Natl. Acad. Sci. USA 85:6982-6986.[Abstract/Free Full Text] |
| 10. | Gorringe, A., D. Halliwell, M. Matheson, K. Reddin, M. Finney, and M. Hudson. 2005. The development of a meningococcal disease vaccine based on Neisseria lactamica outer membrane vesicles. Vaccine 23:2210-2213.[CrossRef][Medline] |
| 11. | Gorringe, A. R. 2005. Can Neisseria lactamica antigens provide an effective vaccine to prevent meningococcal disease? Expert Rev. Vaccines 4:373-379.[CrossRef][Medline] |
| 12. | Hilse, R., J. Stoevesandt, D. A. Caugant, H. Claus, M. Frosch, and U. Vogel. 2000. Distribution of the meningococcal insertion sequence IS1301 in clonal lineages of Neisseria meningitidis. Epidemiol. Infect. 124:337-340.[CrossRef][Medline] |
| 13. | Karlin, S. 2001. Detecting anomalous gene clusters and pathogenicity islands in diverse bacterial genomes. Trends Microbiol. 9:335-343.[CrossRef][Medline] |
| 14. | Karlin, S., and C. Burge. 1995. Dinucleotide relative abundance extremes: a genomic signature. Trends Genet. 11:283-290.[CrossRef][Medline] |
| 15. | Korch, C., P. Hagblom, H. Ohman, M. Goransson, and S. Normark. 1985. Cryptic plasmid of Neisseria gonorrhoeae: complete nucleotide sequence and genetic organization. J. Bacteriol. 163:430-438.[Abstract/Free Full Text] |
| 16. | Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief. Bioinform. 5:150-163.[Abstract/Free Full Text] |
| 17. | Linz, B., M. Schenker, P. Zhu, and M. Achtman. 2000. Frequent interspecific genetic exchange between commensal neisseriae and Neisseria meningitidis. Mol. Microbiol. 36:1049-1058.[CrossRef][Medline] |
| 18. | Maiden, M. C., B. Malorny, and M. Achtman. 1996. A global gene pool in the neisseriae. Mol. Microbiol. 21:1297-1298.[CrossRef][Medline] |
| 19. | O'Dwyer, C., P. R. Langford, and J. S. Kroll. 2005. A novel neisserial shuttle plasmid: a useful new tool for meningococcal research. FEMS Microbiol. Lett. 251:143-147. |
| 20. | Olsen, S. F., B. Djurhuus, K. Rasmussen, H. D. Joensen, S. O. Larsen, H. Zoffman, and I. Lind. 1991. Pharyngeal carriage of Neisseria meningitidis and Neisseria lactamica in households with infants within areas with high and low incidences of meningococcal disease. Epidemiol. Infect. 106:445-457.[Medline] |
| 21. | Orus, P., and M. Vinas. 2000. Transfer of penicillin resistance between neisseriae in microcosm. Microb. Drug Resist. 6:99-104.[CrossRef][Medline] |
| 22. | Pintado, C., C. Salvador, R. Rotger, and C. Nombela. 1985. Multiresistance plasmid from commensal Neisseria strains. Antimicrob. Agents Chemother. 27:120-124.[Abstract/Free Full Text] |
| 23. | Roberts, M., P. Piot, and S. Falkow. 1979. The ecology of gonococcal plasmids. J. Gen. Microbiol. 114:491-494.[Medline] |
| 24. | Rotger, R., F. Rubio, and C. Nombela. 1986. A multi-resistance plasmid isolated from commensal Neisseria species is closely related to the enterobacterial plasmid RSF1010. J. Gen. Microbiol. 132:2491-2496.[Medline] |
| 25. | Ruggeberg, J. U., and A. J. Pollard. 2004. Meningococcal vaccines. Paediatr. Drugs 6:251-266.[CrossRef][Medline] |
| 26. | Sarkari, J., N. Pandit, E. R. Moxon, and M. Achtman. 1994. Variable expression of the Opc outer membrane protein in Neisseria meningitidis is caused by size variation of a promoter containing poly-cytidine. Mol. Microbiol. 13:207-217.[Medline] |
| 27. | Snyder, L. A., S. A. Butcher, and N. J. Saunders. 2001. Comparative whole-genome analyses reveal over 100 putative phase-variable genes in the pathogenic Neisseria spp. Microbiology 147:2321-2332.[Abstract/Free Full Text] |
| 28. | Spratt, B. G., L. D. Bowler, Q. Y. Zhang, J. Zhou, and J. M. Smith. 1992. Role of interspecies transfer of chromosomal genes in the evolution of penicillin resistance in pathogenic and commensal Neisseria species. J. Mol. Evol. 34:115-125.[Medline] |
| 29. | van der Ende, A., C. T. Hopman, and J. Dankert. 1999. Deletion of porA by recombination between clusters of repetitive extragenic palindromic sequences in Neisseria meningitidis. Infect. Immun. 67:2928-2934.[Abstract/Free Full Text] |
| 30. | van der Ende, A., C. T. Hopman, S. Zaat, B. B. Essink, B. Berkhout, and J. Dankert. 1995. Variable expression of class 1 outer membrane protein in Neisseria meningitidis is caused by variation in the spacing between the 10 and 35 regions of the promoter. J. Bacteriol. 177:2475-2480.[Abstract/Free Full Text] |
| 31. | van Passel, M. W., A. Bart, A. C. Luyf, A. H. van Kampen, and A. van der Ende. 2006. Compositional discordance between prokaryotic plasmids and host chromosomes. BMC Genomics 7:26.[CrossRef][Medline] |
| 32. | van Passel, M. W., A. C. Luyf, A. H. van Kampen, A. Bart, and A. van der Ende. 2005.  -Web, an online tool to assess composition similarity of individual nucleic acid sequences. Bioinformatics 21:3053-3055.[Abstract/Free Full Text] |
| 32a. | van Passel, M. W., A. Bart, A. C. Luyf, A. H. van Kampen, and A. van der Ende. Identification of acquired DNA in Neisseria lactamica. FEMS Microbiol. Lett., in press. |
| 33. | Vincze, T., J. Posfai, and R. J. Roberts. 2003. NEBcutter: a program to cleave DNA with restriction enzymes. Nucleic Acids Res. 31:3688-3691.[Abstract/Free Full Text] |
| 34. | Yamagata, A., J. Kato, R. Hirota, A. Kuroda, T. Ikeda, N. Takiguchi, and H. Ohtake. 1999. Isolation and characterization of two cryptic plasmids in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11. J. Bacteriol. 181:3375-3381.[Abstract/Free Full Text] |
Infection and Immunity, August 2006, p. 4892-4899, Vol. 74, No. 8
0019-9567/06/$08.00+0 doi:10.1128/IAI.02087-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.