![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Infection and Immunity, September 2006, p. 5075-5084, Vol. 74, No. 9
0019-9567/06/$08.00+0 doi:10.1128/IAI.00815-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Infectious Diseases,1 Division of Immunology,2 Department of Anatomic Pathology, City of Hope National Medical Center and Beckman Research Institute, Duarte, California3
Received 19 May 2006/ Returned for modification 16 June 2006/ Accepted 23 June 2006
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Currently available antifungal agents have had only limited success in treating IPA (18) and are also associated with serious toxicities, for example, nephrotoxicity and hepatotoxicity (15, 16, 18). It is therefore attractive to propose and test methods to induce, maintain, and/or rapidly restore specific antifungal immunity in immunocompromised patients. The restoration of the immune system is the key challenge for hematopoietic cell transplant recipients in which immunopathological effects, namely, graft-versus-host disease, need to be suppressed. Several authors have encouraged the development of antifungal vaccines or immunotherapies that would enhance or restore protective antifungal immunity (1, 8, 12, 42, 43), and in vitro cell-based and animal studies have been undertaken to support the feasibility of such an approach. Experiments include specific T-cell enhancing (2, 9) and dendritic cell-pulsing vaccination methods (3, 4), both in mice with IPA. Previously, we have shown that mice vaccinated subcutaneously with crude fungal protein extracts or by intranasal inoculation of viable conidia (VC) survive an otherwise lethal pulmonary challenge under corticosteroid immunosuppression (21). Although crude protein mixtures or deliberate exposure to Aspergillus would not be suitable for use in humans due to safety concerns related to toxicity and allergenicity, the use of a recombinant protein vaccine is both attractive and feasible. Such a vaccine could be produced in large amounts at low costs and with straightforward quality and safety controls designed to avoid allergenicity.
Several strategies to identify potential vaccine candidates exist. The recent availability of the complete genomes of the A. fumigatus strain Af293 (34), Aspergillus nidulans (13), and Aspergillus oryzae (31) can enable "reverse vaccinology" projects in which putative immunogenic antigens are first computationally predicted (36, 38). Such endeavors will likely lead to hundreds of vaccine candidates being tested, presumably in animal experiments. Recombinant antigens, including allergens, can be selected from expression libraries and screened for their ability to induce a protective immune response. Here, we have undertaken an immunochemical and mass spectrometric approach to identify the dominant antigen to which antibodies are produced in naïve immunocompetent mice following nasopulmonary exposure to viable A. fumigatus conidia, as previously described (21). We demonstrate that mice protectively immunized in this way elicit a specific immunoglobulin G2a (IgG2a) response against allergen Asp f 3. Subcutaneous injection of various versions of recombinant Asp f 3 (rAsp f 3), with or without deletion of the "allergenic" IgE-binding epitope, provides a significant degree of protection in corticosteroid-immunosuppressed mice.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Aspergillus fumigatus. A strain of A. fumigatus, AFCOH1, isolated from an IPA patient at the City of Hope National Medical Center (Duarte, CA) was used for vaccine preparations and infection as described previously (21). Conidium stock suspensions were prepared by collecting spores from day 5 to day 7 cultures on potato dextrose agar (BD/Difco) grown at 37°C into sterile 0.9% saline containing 0.1% Tween 80. Clumps of conidia were dispersed with 3-mm glass beads, and the suspension was washed twice and suspended to the desired concentration with 0.9% saline containing 0.01% Tween 80 (or alternatively 1% n-octyl-ß-D-glucopyranoside) and 30% glycerol. Aliquots were frozen at –80°C and quick thawed to 37°C prior to use. This procedure gave mycelium-free suspensions of conidia, with >95% single conidia. Conidia were enumerated with a hemacytometer, and viability was assessed by agar plating.
Crude antigen and vaccine preparations. Crude hyphal extract was prepared by sonication of hyphal mass from 72-h cultures grown in Czapek Dox medium supplemented with 1% Tryptone (BD/Difco). A 50-ml conical centrifuge tube containing 25 ml of washed hyphal mass was sonicated for a total of 4 min (four 1-min cycles) on ice by use of a Misonix Sonicator 3000 fitted with a 0.5-inch horn at an intensity setting of 10. The hyphal sonicate (HS) is not sterile and contains some viable hyphal fragments in a complex mixture of released hyphal proteins and other cellular components.
Fractionation. HS was prefractionated by subsequent ultrafiltration through Centricon devices (Millipore) with a 30-kDa cutoff membrane and then with a 10-kDa cutoff membrane. Crude culture filtrate (CF) as well as prefractionated HS retentate and filtrate of the 10-kDa cutoff membrane fraction was analyzed by Western blot analysis and further fractionated by reversed-phase high-pressure liquid chromatography (HPLC) (Jupiter column, 5-µm, C18 paricles with 300-Å pores, 250 by 4.6 mm; Phenomenex, Torrance, California) with a gradient of acetonitrile-water in 0.1% trifluoroacetic acid (ÄKTA purifier; GE Healthcare). Fractions were spotted on nitrocellulose membrane (Bio-Rad), and dot blots were developed with sera from VC- and HS-immunized mice or monoclonal anti-Asp f 1 antibodies and HRP-conjugated anti-mouse IgG, diluted 1:3,000, for chemiluminescent detection. Positive fractions were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and stained with GelCode blue (Pierce).
Mass spectrometric protein identification.
Gel bands were excised, placed on needle-punctured V-shaped microtiter plates (Greiner), and robotically processed using a Genesis Proteam 100 liquid handling system (Tecan) with a customized procedure encompassing gel destaining in 50% acetonitrile and 100 mM ammonium bicarbonate, protein reduction in 10 mM tris(carboxyethyl phosphine) (Pierce) and 50 mM ammonium bicarbonate, and alkylation with iodoacetamide followed by 8 h of digestion with trypsin at 37°C. Digest peptides were captured on reversed-phase Poros 20 R 2 beads (Applied Biosystems, Inc.), collected on ZipTips (Millipore), eluted onto stainless steel sample plates, and cocrystallized with 
-cyano-4-hydroxy cinnamic acid as the matrix-assisted laser desorption ionization (MALDI) mass spectrometry (MS) matrix. Single-stage mass spectrometric analyses were performed with a Protof2000 MALDI-quadrupole (MALDI-Q)-time-of-flight instrument (PerkinElmer/Sciex), and multistage mass spectrometric fragmentation spectra were obtained with a self-built MALDI-Q-ion trap essentially as previously described (22, 25). Spectra were analyzed by database searching using Profound, Xproteo, and the GPM X! Tandem.
Recombinant proteins. Asp f 1 (GenBank accession no. P67875 and AAB07779) was expressed from the pQEMW1 plasmid, kindly provided by Frank Ebel and Jürgen Heesemann at the LMU Munich, Germany, by use of an M15 Escherichia coli host strain containing the repressor plasmid pREP4 (QIAGEN) as described previously (45). Recombinant, His-tagged Ubc9 was a gift from Jing Song and Yuan Chen and has been described earlier (30). Asp f 3 (GenBank accession no. O43099) and its truncated forms were cloned and expressed using a pQE30Xa vector (QIAGEN). In brief, total mRNA was obtained from ground hyphae by use of an RNeasy mini kit (QIAGEN), reverse transcribed with a Superscript II kit (Invitrogen), and PCR amplified with the specific primers 1 (GAGCTCATGTCTGGACTCAAGGCCGGTGACA) and 2 (GGTACCTTACAGGTGCTTGAGGACGGTCTCG), containing a SacI and a KpnI site, respectively (underlined). pQE30Xa and the primers were restricted with SacI/KpnI and ligated using T4 ligase (all from New England Biolabs) (40). The resulting plasmid was named pMK2Aspf3, transformed into E. coli M15(pREP4), and selected on Luria-Bertani agar plates with 100 µg/ml ampicillin and 25 µg/ml kanamycin. The N-terminal deletion of Asp f 3, containing residues 15 to 168 [Asp f 3(15-168)], was produced by partial amplification of the insert sequence from pMK2Aspf3 with primers 2 and 3 (AGGCCTGTCTTCTCTTACATCCCC), the latter beginning with a StuI site (underlined). pQE30Xa and the PCR product were digested with StuI/KpnI, ligated, and selected as described above, yielding pMK2Aspf3(15-168). C-terminally truncated rAsp f 3(1-142) and the bipartite N- and C-terminal truncation rAsp f 3(15-142) were obtained by introduction of a stop codon at K143 into the sequences of pMK2Aspf3 and pMK2Aspf3(15-168), respectively, using a QuikChange kit (Stratagene) with PCR primers ATTGACCACGGCTAGATTACCTACG and CGTAGGTAATCTAGCCGTGGTCAAT, which mismatch the Asp f 3 sequence in the underlined base pair. DNA sequencing, performed at the DNA Sequencing Core Lab of the City of Hope, verified the construct sequences. Proteins were expressed at 37°C in 1-liter E. coli cultures with LB medium after IPTG (isopropyl-ß-D-thiogalactopyranoside) induction (40) and purified from lysed cells by use of self-packed Ni-nitrilotriacetic acid agarose columns and urea-containing lysis, wash, and elution buffers (QIAGEN). Identities of the purified recombinant proteins were confirmed by peptide mass fingerprinting of gel-separated products (see above). Protein concentrations were determined by use of a Bradford (5) protein assay (Bio-Rad).
Fungal protein extracts and Western blots.
HS was subjected to electrophoresis on reducing Bis-Tris SDS Nu-PAGE gels (4 to 10%; Invitrogen). rAsp f 3, its sequence variants, rAsp f 1, and rUbc9 were electrophoretically separated in the same way after approximately 0.4 or 0.25 µg protein was loaded per lane. Proteins were transferred to polyvinylidene difluoride membrane (0.22 µm; Bio-Rad) by use of an Xcell II blot module (Invitrogen). Membranes were blocked at 4°C overnight in 5% milk, 0.24% Tris base, 0.8% NaCl, and 0.01% Tween 20, adjusted to pH 7.6 with 
1.2 mM HCl (final concentration). To analyze sera from multiple individuals, membranes blotted with HS from a single-slot SDS-polyacrylamide gel were cut into strips of 5 mm in width (cut alongside the direction of separation) and probed in 1.2-ml volumes of serum in milk, 1:2,500, in Accutran disposable incubation trays with multiple channels (Schleicher & Schuell, Inc., Keene, NH). HRP-conjugated secondary antibodies (see above) were used in dilutions of 1:3,000 to 1:20,000 in accordance with the manufacturer's instructions for chemiluminescent detection on X-ray films.
Mice. CF-1 female mice (H2-k major histocompatibility complex class I haplotype; Charles River Labs) were purchased at 7 weeks of age and were allowed to acclimate for at least 1 week prior to use. All experiments were conducted in a biosafety level 2 containment facility in compliance with animal care regulations and under care and use protocols approved by the institutional research animal care committee.
Vaccinations. Mice were vaccinated twice, 2 weeks apart (see Fig. 3A), subcutaneously at the base of the tail with 40 µl of the following vaccine preparations: HS, rAsp f 1, and rAsp f 3. The hyphal sonicate was administered neat and rAsp f 1 was administered neat as a 1:1 (vol/vol) emulsion in TiterMax (TM) (TiterMax, Inc., Norcross, Georgia) prepared according to the manufacturer's instructions or in a particulate form. The particulate, adjuvant-free Asp f 3 vaccine was prepared by precipitation with trichloroacetic acid and resuspension of the protein pellet in the original volume of phosphate-buffered saline (PBS) with 0.5% methylcellulose. Vortexing in the presence of glass beads produced sufficiently small protein particles that passed through a 25-gauge injection needle.
|
Immunosuppression, antibiotic treatments, and infection. Cortisone acetate was administered subcutaneously in 2.5-mg doses for six consecutive days prior to challenge, commencing 2 weeks after the second immunization (see Fig. 3A). To reduce the risk of bacterial infection associated with immunosuppression, mice were prophylactically provided acidified water containing sulfamethoxazole-trimethoprim (Sulfatrim; Alpharma) and were administered 200 µg of levofloxacin (Levaquin; Ortho-McNeil) subcutaneously 1 h prior to infection. Under light ketamine-xylazine anesthesia, mice were intranasally inoculated with 30 µl of conidial suspension containing 3 x 106 viable conidia while being held in the vertical position and were placed on their backs during recovery from anesthesia.
Assessment of infection. After inoculation, all animals fully recovered within 1 to 2 h and were normal in appearance until signs of disease became apparent 24 to 30 h after infection. Mice were observed on a regular basis during the day and were weighed each morning, and body temperature was taken in the morning and evening with a digital thermometer inserted into the vagina. Time of death or premature euthanasia was recorded, and deaths that occurred at night were assigned a time of death midway between the last evening observation and the first morning observation. Criteria for premature euthanasia were labored breathing, a 20% weight loss, and severe hypothermia (<32°C). Time-to-death data were analyzed by the Mann-Whitney U test (equivalent to the Wilcoxon rank sum test) using Leon Avery's web-based U test. Disease pathology and assessment of the fungal distribution within the lung parenchyma were performed with formalin-fixed, paraffin-embedded sections of lung tissue using standard hematoxylin and eosin and Gomori methenamine silver staining. Microscopy was performed with an Olympus AX70 model U-MPH microscope (Tokyo, Japan) with a QImaging RETIGA EXi camera and ImageProPlus 5.1 software.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
57 min by use of the monoclonal anti-Asp f 1 antibody. The same fraction also showed a weak reaction with sera from VC-exposed mice. A 70-min fraction of the HS retentate reacted strongly with IgG from VC-immune mice. This fraction was further separated by SDS-PAGE (not shown), and the protein content of an 18- to 20-kDa band was reduced, alkylated, trypsin digested, and analyzed by MALDI-Q-time-of-flight and MALDI-Q-ion trap mass spectrometry (Fig. 2B). Peptide mass fingerprinting as well as tandem MS data (see the supplemental material) identified the known allergen Asp f 3 (GenBank accession no. XP_747849) as the major component of the IgG-binding HPLC fraction, with an unusually high sequence coverage of about 93%. A few digest peptides of peptidylprolyl cis-trans isomerase (cyclophilin, PPIase, Asp f 11 [GenBank accession no. XP_749504]) and cofilin (GenBank accession no. XP_753587) were also detected in the same band (see the supplemental material), indicating the presence of these proteins as minor impurities. Taken together, our data indicate that mice infected with viable conidia produce specific antibodies predominantly against Asp f 3 and at lower levels against Asp f 1.
|
|
Plasma obtained from all animals on the day before immunosuppression (Fig. 3A) was used to probe Western blots with different versions of rAsp f 3, rAsp f 1, rUbc9, and HS (Fig. 4A). The recombinant proteins were loaded at comparable levels (0.4 µg/lane) as determined by Bradford (5) and as indicated by the GelCode blue-stained gel shown in Fig. 4B. Antigen-specific IgG2a was detected in initial experiments (not reported here) to be the dominant immunoglobulin subclass in the sera of immunized animals. IgG2a induction is the immunoglobulin marker of a TH1-type immune response that is expected when using the TM adjuvant. TM is a proprietary synthetic formulation of TiterMax, Inc., that contains the block copolymer CRL89-41, squalene, and a microparticulate stabilizer and that, in contrast to Freund's adjuvant, is free of mycobacterium extracts. We therefore developed the Western blots with a monoclonal HRP-conjugated anti-mouse IgG2a antibody (Fig. 4A). IgG2a against full-length rAsp f 3 (168 amino acids plus His tag) was detected in the sera of animals vaccinated with rAsp f 3 or HS. Natural non-His-tagged Asp f 3 is responsible for the signal below 19 kDa on the lanes of blotted hematoxylin and eosin. The C- and N-terminally truncated versions of rAsp f 3, spanning residues 1 to 142 and 15 to 168, respectively, reacted only with sera from mice vaccinated with rAsp f 3 plus adjuvant. Similar truncated versions were reported to lack the ability to bind human IgE from ABPA patients (37). Accordingly, such engineered proteins no longer possess the IgE-binding property by which most A. fumigatus allergens have been defined (24). IgG2a from sera of HS-immunized animals reacts with full-length rAsp f 3 but not with the truncated versions, suggesting that the IgG2a epitope responded to in these mice might be similar (if not identical) to the IgE-binding conformational epitope in sera from ABPA patients (37). A His-tagged recombinant mouse protein, Ubc9, was included in the blots to test if any of the recombinant His-tagged vaccines would induce anti-His-tag antibody production. No such antibodies were observed. Mice immunized with the major allergen rAsp f 1 produce antibodies only against rAsp f 1, and the associated immune response was not protective.
|
|
Histopathology. We examined the lungs of the following groups of mice: succumbed nonimmune animals, HS-immunized survivors, rAsp f 3/TM-vaccinated survivors, and normal noninfected animals (Fig. 6). Terminally infected nonimmune individuals had numerous hyphal elements within the bronchi and invading the peribronchial tissues. This was accompanied by a compact peribronchial infiltrate consisting predominately of polymorphonuclear leukocytes, a few histiocytes, and lymphoid cells. The adjacent pulmonary parenchyma showed edema and focal hemorrhage (Fig. 6, first column). The lungs from HS-immunized survivors have a very dense peribronchial mononuclear cell infiltrate composed predominately of large reactive lymphoid cells, small lymphocytes, plasma cells, and histiocytes. The bronchial mucosal epithelium was hypersecretory, with mucin filling many of the bronchial lumens. No hyphal element could be identified by Gomori silver staining (Fig. 6, second column). Mice immunized with Asp f 3/TM were also free of hyphal elements but had fewer intrabronchial secretions than the HS-vaccinated animals. The peribronchial infiltrate was also less dense, and the cellular composition showed fewer of the large lymphoid cells and was composed predominately of small lymphocytes, plasma cells, and histiocytes (Fig. 6, third column).
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Independently of us, and while this paper was being written, Orsborn et al. recently showed that vaccinations with recombinant Pmp1 can protect mice against Coccidioides posadasii infections (35). Asp f 3 is a homologue to Pmp1 from C. posadasii, with which it shares 68% sequence identity. Both proteins have some sequence homology with two presumed peroxisomal matrix proteins, PMPA and PMPB (PMP20), from Candida boidinii (14), with which Asp f 3 was reported to share a common IgE-binding epitope (17). Several genes of other fungi encode sequences that are nearly identical to A. fumigatus Asp f 3. These include PMP20 (Asp f 3) from Aspergillus nidulans FGSC A4 (GenBank accession no. AN8692.2) with 90% identity, a cDNA from Aspergillus oryzae RIB40 (GenBank accession no. AN8692.2) with 86% identity, Pen c 3 from Penicillium citrinum (GenBank accession no. AF144753) with 81% identity, and others with significant similarity, such as a peroxisomal-like protein mRNA sequence from Paracoccidioides brasiliensis (GenBank accession no. AY376436) with 67% identity and a putative alkyl hydroperoxide reductase from Candida albicans SC5314 (GenBank accession no. XM_715419) with 38% identity. It is therefore possible that an Asp f 3-based vaccine could provide cross-protection against various fungal pathogens.
The four recombinant versions of rAsp f 3 tested here appear to be processed differently during immunization. It should also be noted that both the full-length Asp f 3(1-168) and the double-truncated version rAsp f 3(15-142) could be purified from E. coli lysates in the absence of urea. In contrast, the N- and C-terminal truncations, comprising residues 15 to 168 and 1 to 142, respectively, are not very soluble and needed to be purified from the lysates with urea. These findings suggest distinct structural properties for the various versions of rAsp f 3. Such conformational differences could influence phagocytosis, proteasomal processing, and major histocompatibility complex display and, as a consequence, might result in different immunogenic properties. This speculation is supported by the protective effect of the adjuvant-free particulate rAsp f 3 compared to the observed lack of protection when soluble adjuvant-free rAsp f 3 was tested. The use of particulate vaccines is the basis for various immunization strategies, including the use of alum and emulsions as the particle-forming matrix for soluble vaccine candidates. In this context, particulate recombinant vaccines against hepatitis viruses have been produced and immunogenic differences between particulate and nonparticulate antigens have been found (20, 29). Although we originally exploited a specific antibody response to identify the immunodominant Asp f 3 antigen, it turned out that protective N- or C-terminally truncated versions of the same protein induce only weak antibody responses. A potential protective effect of anti-Asp f 3 antibodies alone seems therefore unlikely. Considering the patchy infiltrate of mononuclear cells found in the hypha-free lungs of Asp f 3-vaccinated mice, we hypothesize that such vaccinations may induce adaptive cell-based immunity. In a likely but yet to be tested scenario, "vaccine-trained" lymphocytes (presumably T cells) could be activated upon infection and in turn perhaps enhance and/or restore the function of corticosteroid-suppressed macrophages (6, 7), allowing them to efficiently clear fungal elements from the lungs. Currently there are insufficient data to test such a hypothesis, and further experiments will be required to analyze the mechanisms by which an Asp f 3-based vaccine functions.
Conclusion. We have demonstrated that a combined immunochemical and mass spectrometric approach was useful in identifying Asp f 3 as a potential vaccine candidate against IPA. Full-length recombinant Asp f 3 and some truncated versions that lack the human "allergenic" IgE-binding epitope are immunoprotective. We propose that such modified, recombinant Asp f 3-based vaccines are potentially suitable for human use.
|
ACKNOWLEDGMENTS |
|---|
We thank Frank Ebel and Jürgen Heesemann from the Max von Pettenkofer-Institut/Bakteriologie, LMU Munich, Germany, for the pQEMW1 plasmid and Jing Song and Yuan Chen from the City of Hope, Duarte, CA, for rUbc9.
|
FOOTNOTES |
|---|
Supplemental material for this article may be found at http://iai.asm.org/.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
| 1. | Bellocchio, S., S. Bozza, C. Montagnoli, K. Perruccio, R. Gaziano, L. Pitzurra, and L. Romani. 2005. Immunity to Aspergillus fumigatus: the basis for immunotherapy and vaccination. Med. Mycol. 43(Suppl. 1):S181-S188. |
| 2. | Bozza, S., R. Gaziano, G. B. Lipford, C. Montagnoli, A. Bacci, P. Di Francesco, V. P. Kurup, H. Wagner, and L. Romani. 2002. Vaccination of mice against invasive aspergillosis with recombinant Aspergillus proteins and CpG oligodeoxynucleotides as adjuvants. Microbes Infect. 4:1281-1290.[CrossRef][Medline] |
| 3. | Bozza, S., C. Montagnoli, R. Gaziano, G. Rossi, G. Nkwanyuo, S. Bellocchio, and L. Romani. 2004. Dendritic cell-based vaccination against opportunistic fungi. Vaccine 22:857-864.[CrossRef][Medline] |
| 4. | Bozza, S., K. Perruccio, C. Montagnoli, R. Gaziano, S. Bellocchio, E. Burchielli, G. Nkwanyuo, L. Pitzurra, A. Velardi, and L. Romani. 2003. A dendritic cell vaccine against invasive aspergillosis in allogeneic hematopoietic transplantation. Blood 102:3807-3814. |
| 5. | Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.[CrossRef][Medline] |
| 6. | Brummer, E., J. H. Choi, and D. A. Stevens. 2005. Interaction between conidia, lung macrophages, immunosuppressants, proinflammatory cytokines and transcriptional regulation. Med. Mycol. 43(Suppl. 1):S177-S179. |
| 7. | Brummer, E., M. Kamberi, and D. A. Stevens. 2003. Regulation by granulocyte-macrophage colony-stimulating factor and/or steroids given in vivo of proinflammatory cytokine and chemokine production by bronchoalveolar macrophages in response to Aspergillus conidia. J. Infect. Dis. 187:705-709.[CrossRef][Medline] |
| 8. | Casadevall, A., and L. A. Pirofski. 2005. Feasibility and prospects for a vaccine to prevent cryptococcosis. Med. Mycol. 43:667-680.[CrossRef][Medline] |
| 9. | Cenci, E., A. Mencacci, A. Bacci, F. Bistoni, V. P. Kurup, and L. Romani. 2000. T cell vaccination in mice with invasive pulmonary aspergillosis. J. Immunol. 165:381-388. |
| 10. | Denning, D. W. 1998. Invasive aspergillosis. Clin. Infect. Dis. 26:781-803, 804-805.[Medline] |
| 11. | Duthie, R., and D. W. Denning. 1995. Aspergillus fungemia: report of two cases and review. Clin. Infect. Dis. 20:598-605.[Medline] |
| 12. | Feldmesser, M. 2005. Prospects of vaccines for invasive aspergillosis. Med. Mycol. 43:571-587.[CrossRef][Medline] |
| 13. | Galagan, J. E., S. E. Calvo, C. Cuomo, L. J. Ma, J. R. Wortman, S. Batzoglou, S. I. Lee, M. Basturkmen, C. C. Spevak, J. Clutterbuck, V. Kapitonov, J. Jurka, C. Scazzocchio, M. Farman, J. Butler, S. Purcell, S. Harris, G. H. Braus, O. Draht, S. Busch, C. D'Enfert, C. Bouchier, G. H. Goldman, D. Bell-Pedersen, S. Griffiths-Jones, J. H. Doonan, J. Yu, K. Vienken, A. Pain, M. Freitag, E. U. Selker, D. B. Archer, M. A. Penalva, B. R. Oakley, M. Momany, T. Tanaka, T. Kumagai, K. Asai, M. Machida, W. C. Nierman, D. W. Denning, M. Caddick, M. Hynes, M. Paoletti, R. Fischer, B. Miller, P. Dyer, M. S. Sachs, S. A. Osmani, and B. W. Birren. 2005. Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae. Nature 438:1105-1115.[CrossRef][Medline] |
| 14. | Garrard, L. J., and J. M. Goodman. 1989. Two genes encode the major membrane-associated protein of methanol-induced peroxisomes from Candida boidinii. J. Biol. Chem. 264:13929-13937. |
| 15. | Gupta, A. K., and E. Tomas. 2003. New antifungal agents. Dermatol. Clin. 21:565-576.[CrossRef][Medline] |
| 16. | Hamza, N. S., M. A. Ghannoum, and H. M. Lazarus. 2004. Choices aplenty: antifungal prophylaxis in hematopoietic stem cell transplant recipients. Bone Marrow Transplant. 34:377-389.[CrossRef][Medline] |
| 17. | Hemmann, S., K. Blaser, and R. Crameri. 1997. Allergens of Aspergillus fumigatus and Candida boidinii share IgE-binding epitopes. Am. J. Respir. Crit. Care Med. 156:1956-1962. |
| 18. | Herbrecht, R., D. W. Denning, T. F. Patterson, J. E. Bennett, R. E. Greene, J. W. Oestmann, W. V. Kern, K. A. Marr, P. Ribaud, O. Lortholary, R. Sylvester, R. H. Rubin, J. R. Wingard, P. Stark, C. Durand, D. Caillot, E. Thiel, P. H. Chandrasekar, M. R. Hodges, H. T. Schlamm, P. F. Troke, B. de Pauw, et al. 2002. Voriconazole versus amphotericin B for primary therapy of invasive aspergillosis. N. Engl. J. Med. 347:408-415. |
| 19. | Ho, P. L., and K. Y. Yuen. 2000. Aspergillosis in bone marrow transplant recipients. Crit. Rev. Oncol. Hematol. 34:55-69.[Medline] |
| 20. | Huang, C. F., S. S. Lin, Y. C. Ho, F. L. Chen, and C. C. Yang. 2006. The immune response induced by hepatitis B virus principal antigens. Cell. Mol. Immunol. 3:97-106.[Medline] |
| 21. | Ito, J. I., and J. M. Lyons. 2002. Vaccination of corticosteroid immunosuppressed mice against invasive pulmonary aspergillosis. J. Infect. Dis. 186:869-871.[CrossRef][Medline] |
| 22. | Kalkum, M., G. J. Lyon, and B. T. Chait. 2003. Detection of secreted peptides by using hypothesis-driven multistage mass spectrometry. Proc. Natl. Acad. Sci. USA 100:2795-2800. |
| 23. | Kibbler, C. 2003. Aspergillus: the invisible threat. Nurs. Times 99:48-50.[Medline] |
| 24. | Kodzius, R., C. Rhyner, Z. Konthur, D. Buczek, H. Lehrach, G. Walter, and R. Crameri. 2003. Rapid identification of allergen-encoding cDNA clones by phage display and high-density arrays. Comb. Chem. High Throughput Screen. 6:147-154.[Medline] |
| 25. | Krutchinsky, A. N., M. Kalkum, and B. T. Chait. 2001. Automatic identification of proteins with a MALDI-quadrupole ion trap mass spectrometer. Anal. Chem. 73:5066-5077.[Medline] |
| 26. | Kurup, V. P., J. Q. Xia, R. Crameri, D. A. Rickaby, H. Y. Choi, S. Fluckiger, K. Blaser, C. A. Dawson, and K. J. Kelly. 2001. Purified recombinant A. fumigatus allergens induce different responses in mice. Clin. Immunol. 98:327-336.[CrossRef][Medline] |
| 27. | Latge, J. P. 1999. Antigen and DNA patterns characteristic of Aspergillus fumigatus. Contrib. Microbiol. 2:69-87.[Medline] |
| 28. | Latge, J. P. 1999. Aspergillus fumigatus and aspergillosis. Clin. Microbiol. Rev. 12:310-350. |
| 29. | Li, S. W., J. Zhang, Y. M. Li, S. H. Ou, G. Y. Huang, Z. Q. He, S. X. Ge, Y. L. Xian, S. Q. Pang, M. H. Ng, and N. S. Xia. 2005. A bacterially expressed particulate hepatitis E vaccine: antigenicity, immunogenicity and protectivity on primates. Vaccine 23:2893-2901.[CrossRef][Medline] |
| 30. | Liu, Q., C. Jin, X. Liao, Z. Shen, D. J. Chen, and Y. Chen. 1999. The binding interface between an E2 (UBC9) and a ubiquitin homologue (UBL1). J. Biol. Chem. 274:16979-16987. |
| 31. | Machida, M., K. Asai, M. Sano, T. Tanaka, T. Kumagai, G. Terai, K. Kusumoto, T. Arima, O. Akita, Y. Kashiwagi, K. Abe, K. Gomi, H. Horiuchi, K. Kitamoto, T. Kobayashi, M. Takeuchi, D. W. Denning, J. E. Galagan, W. C. Nierman, J. Yu, D. B. Archer, J. W. Bennett, D. Bhatnagar, T. E. Cleveland, N. D. Fedorova, O. Gotoh, H. Horikawa, A. Hosoyama, M. Ichinomiya, R. Igarashi, K. Iwashita, P. R. Juvvadi, M. Kato, Y. Kato, T. Kin, A. Kokubun, H. Maeda, N. Maeyama, J. Maruyama, H. Nagasaki, T. Nakajima, K. Oda, K. Okada, I. Paulsen, K. Sakamoto, T. Sawano, M. Takahashi, K. Takase, Y. Terabayashi, J. R. Wortman, O. Yamada, Y. Yamagata, H. Anazawa, Y. Hata, Y. Koide, T. Komori, Y. Koyama, T. Minetoki, S. Suharnan, A. Tanaka, K. Isono, S. Kuhara, N. Ogasawara, and H. Kikuchi. 2005. Genome sequencing and analysis of Aspergillus oryzae. Nature 438:1157-1161.[CrossRef][Medline] |
| 32. | Maschke, M., U. Dietrich, M. Prumbaum, O. Kastrup, B. Turowski, U. W. Schaefer, and H. C. Diener. 1999. Opportunistic CNS infection after bone marrow transplantation. Bone Marrow Transplant. 23:1167-1176.[CrossRef][Medline] |
| 33. | Montagnoli, C., S. Bozza, A. Bacci, R. Gaziano, P. Mosci, J. Morschhauser, L. Pitzurra, M. Kopf, J. Cutler, and L. Romani. 2003. A role for antibodies in the generation of memory antifungal immunity. Eur. J. Immunol. 33:1193-1204.[CrossRef][Medline] |
| 34. | Nierman, W. C., A. Pain, M. J. Anderson, J. R. Wortman, H. S. Kim, J. Arroyo, M. Berriman, K. Abe, D. B. Archer, C. Bermejo, J. Bennett, P. Bowyer, D. Chen, M. Collins, R. Coulsen, R. Davies, P. S. Dyer, M. Farman, N. Fedorova, T. V. Feldblyum, R. Fischer, N. Fosker, A. Fraser, J. L. Garcia, M. J. Garcia, A. Goble, G. H. Goldman, K. Gomi, S. Griffith-Jones, R. Gwilliam, B. Haas, H. Haas, D. Harris, H. Horiuchi, J. Huang, S. Humphray, J. Jimenez, N. Keller, H. Khouri, K. Kitamoto, T. Kobayashi, S. Konzack, R. Kulkarni, T. Kumagai, A. Lafton, J. P. Latge, W. Li, A. Lord, C. Lu, W. H. Majoros, G. S. May, B. L. Miller, Y. Mohamoud, M. Molina, M. Monod, I. Mouyna, S. Mulligan, L. Murphy, S. O'Neil, I. Paulsen, M. A. Penalva, M. Pertea, C. Price, B. L. Pritchard, M. A. Quail, E. Rabbinowitsch, N. Rawlins, M. A. Rajandream, U. Reichard, H. Renauld, G. D. Robson, S. Rodriguez de Cordoba, J. M. Rodriguez-Pena, C. M. Ronning, S. Rutter, S. L. Salzberg, M. Sanchez, J. C. Sanchez-Ferrero, D. Saunders, K. Seeger, R. Squares, S. Squares, M. Takeuchi, F. Tekaia, G. Turner, C. R. Vazquez de Aldana, J. Weidman, O. White, J. Woodward, J. H. Yu, C. Fraser, J. E. Galagan, K. Asai, M. Machida, N. Hall, B. Barrell, and D. W. Denning. 2005. Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature 438:1151-1156.[CrossRef][Medline] |
| 35. | Orsborn, K. I., L. F. Shubitz, T. Peng, E. M. Kellner, M. J. Orbach, P. A. Haynes, and J. N. Galgiani. 2006. Protein expression profiling of Coccidioides posadasii by two-dimensional differential in-gel electrophoresis and evaluation of a newly recognized peroxisomal matrix protein as a recombinant vaccine candidate. Infect. Immun. 74:1865-1872. |
| 36. | Pizza, M., V. Scarlato, V. Masignani, M. M. Giuliani, B. Arico, M. Comanducci, G. T. Jennings, L. Baldi, E. Bartolini, B. Capecchi, C. L. Galeotti, E. Luzzi, R. Manetti, E. Marchetti, M. Mora, S. Nuti, G. Ratti, L. Santini, S. Savino, M. Scarselli, E. Storni, P. Zuo, M. Broeker, E. Hundt, B. Knapp, E. Blair, T. Mason, H. Tettelin, D. W. Hood, A. C. Jeffries, N. J. Saunders, D. M. Granoff, J. C. Venter, E. R. Moxon, G. Grandi, and R. Rappuoli. 2000. Identification of vaccine candidates against serogroup B meningococcus by whole-genome sequencing. Science 287:1816-1820. |
| 37. | Ramachandran, H., V. Jayaraman, B. Banerjee, P. A. Greenberger, K. J. Kelly, J. N. Fink, and V. P. Kurup. 2002. IgE binding conformational epitopes of Asp f 3, a major allergen of Aspergillus fumigatus. Clin. Immunol. 103:324-333.[CrossRef][Medline] |
| 38. | Rappuoli, R., and A. Covacci. 2003. Reverse vaccinology and genomics. Science 302:602. |
| 39. | Rementeria, A., N. Lopez-Molina, A. Ludwig, A. B. Vivanco, J. Bikandi, J. Ponton, and J. Garaizar. 2005. Genes and molecules involved in Aspergillus fumigatus virulence. Rev. Iberoam. Micol. 22:1-23.[Medline] |
| 40. | Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 41. | Schaffner, A., H. Douglas, and A. Braude. 1982. Selective protection against conidia by mononuclear and against mycelia by polymorphonuclear phagocytes in resistance to Aspergillus. Observations on these two lines of defense in vivo and in vitro with human and mouse phagocytes. J. Clin. Investig. 69:617-631.[Medline] |
| 42. | Segal, B. H., J. Kwon-Chung, T. J. Walsh, B. S. Klein, M. Battiwalla, N. G. Almyroudis, S. M. Holland, and L. Romani. 2006. Immunotherapy for fungal infections. Clin. Infect. Dis. 42:507-515.[CrossRef][Medline] |
| 43. | Stevens, D. A. 2004. Vaccinate against aspergillosis! A call to arms of the immune system. Clin. Infect. Dis. 38:1131-1136.[CrossRef][Medline] |
| 44. | Subira, M., R. Martino, T. Franquet, C. Puzo, A. Altes, A. Sureda, S. Brunet, and J. Sierra. 2002. Invasive pulmonary aspergillosis in patients with hematologic malignancies: survival and prognostic factors. Haematologica 87:528-534. |
| 45. | Weig, M., M. Frosch, K. Tintelnot, A. Haas, U. Gross, B. Linsmeier, and J. Heesemann. 2001. Use of recombinant mitogillin for improved serodiagnosis of Aspergillus fumigatus-associated diseases. J. Clin. Microbiol. 39:1721-1730. |
| 46. | Wiederhold, N. P., R. E. Lewis, and D. P. Kontoyiannis. 2003. Invasive aspergillosis in patients with hematologic malignancies. Pharmacotherapy 23:1592-1610.[CrossRef][Medline] |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
