Previous Article | Next Article ![]()
Infection and Immunity, September 2006, p. 5161-5168, Vol. 74, No. 9
0019-9567/06/$08.00+0 doi:10.1128/IAI.00488-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Division of Infectious Diseases, Massachusetts General Hospital, Boston, Massachusetts,1 Department of Pediatrics, Massachusetts General Hospital, Boston, Massachusetts,2 Department of Pediatrics, Harvard Medical School, Boston, Massachusetts,3 ICDDR,B: Centre for Health and Population Research, Dhaka, Bangladesh,4 Department of Medicine, Harvard Medical School, Boston, Massachusetts,5 Department of Oral Biology, College of Dentistry, University of Florida, Gainesville, Florida,6 Oragenics, Alachua, Florida,7 Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, Massachusetts,8 Department of Immunology and Infectious Diseases, Harvard School of Public Health, Boston, Massachusetts9
Received 24 March 2006/ Returned for modification 16 May 2006/ Accepted 1 June 2006
|
|
|---|
|
|
|---|
Although many S. enterica serovars infect a broad range of animal hosts and cause gastroenteritis in humans, serovar Typhi is among the few serovars for which natural infection appears to be limited to human hosts. In humans, serovar Typhi organisms penetrate the gastrointestinal epithelial barrier and infect phagocytes within the lamina propria. However, unlike organisms from other broad-host-range serovars, serovar Typhi organisms are adapted for prolonged intracellular survival in human macrophages, allowing the bacteria to spread to reticuloendothelial organs, including the liver, spleen, and bone marrow (16).
Because serovar Typhi organisms are human specific, there is no optimal animal model of serovar Typhi infection, and presumed factors that contribute to the pathogenesis and immunology of typhoid fever are largely extrapolated from studies of S. enterica serovar Typhimurium infection of mice. Serovar Typhimurium is a broad-host-range pathogen that causes gastroenteritis in humans, but in mice it results in a systemic infection that resembles typhoid fever in humans. While the murine typhoid model has proven useful, there are limitations in its application to the study of human infection with serovar Typhi organisms. For example, serovar Typhimurium infection induces apoptosis in mouse macrophages in vitro and results in a highly virulent infection of genetically susceptible mice. Serovar Typhi infection causes less apoptosis in human macrophages, which may correlate with the prolonged survival of the organism in vivo (23). Furthermore, while serovars Typhi and Typhimurium share genetic homology in important pathogenicity elements, over 10% of the presumed open reading frames (ORFs) identified in sequenced genomes of serovar Typhi CT18 and serovar Typhimurium LT2 are unique with respect to each other (15). This divergence includes large clusters of ORFs found uniquely in serovar Typhi. These unique elements encode an array of proteins, including presumed fimbrial and regulatory proteins, that may contribute to the host and disease specificity of the organism (24). In addition, serovar Typhi possesses a large number of pseudogenes compared to serovar Typhimurium, suggesting another possible mechanism for the host-restricted phenotype of serovar Typhi (15).
The study of organisms in cultured cells is another tool for modeling serovar Typhi infection and typhoid fever pathogenesis (4), but such models are limited to single stages of infection. Critical host-pathogen interactions as well as essential processes in the acquisition of immunity to serovar Typhi may occur prior to or after adaptation of the organism to survival within the Salmonella-containing macrophage vacuole.
To circumvent the limitations associated with animal and in vitro models of serovar Typhi infection and to identify serovar Typhi proteins that are immunogenic and expressed uniquely during human infection, we applied an immunologic screening technique termed in vivo-induced antigen technology (IVIAT) (5, 20). In summary, we screened a library of serovar Typhi proteins expressed in Escherichia coli to identify clones that were immunoreactive with convalescent-phase sera that had been adsorbed against in vitro-grown serovar Typhi and E. coli organisms. The adsorption process eliminates antibodies reactive with in vitro-expressed antigens and allows for the identification of clones that express protein antigens which are upregulated during human infection. Specifically, we hypothesized that by using IVIAT, we could identify proteins that play a role in the serovar-specific human-bacterium interactions unique to serovar Typhi infection of humans.
|
|
|---|
Patient and control sera. We obtained paired acute- and convalescent-phase sera from 14 individuals presenting to the ICDDR,B: Centre for Health and Population Research's Kamalapur clinic in urban Bangladesh with febrile illness who had blood cultures positive for serovar Typhi (1). In addition, we used two sets of control sera in this study. One set of control sera included paired acute- and convalescent-phase samples from cholera patients from the same region of typhoid endemicity in Bangladesh (6). A second set of control sera was obtained from five North American volunteers with no history of serovar Typhi exposure (either travel to an endemic area or previous vaccination) (7). All human studies were approved by the institutional review board of the Massachusetts General Hospital, Boston, Mass., and the ethical and research review committees of the ICDDR, Dhaka, Bangladesh.
Adsorption of sera. We pooled convalescent-phase sera from eight patients with serovar Typhi bacteremia. We then allowed the pooled sera to adsorb extensively with in vitro-grown serovar Typhi CT18 organisms and with the expression host strain E. coli BL21(DE3), both of which were grown to late log phase in LB broth. Specifically, we concentrated serovar Typhi and E. coli cells 100-fold by centrifugation and resuspended them in phosphate-buffered saline with 0.05% sodium azide. We produced heat-denatured and nondenatured lysates of late-log-phase organisms grown in vitro by freeze-thawing the concentrated cell suspension and homogenizing it using 0.1-mm zirconia-silica beads in a Mini-Bead Beater tissue homogenizer (Biospec, Bartlesville, OK). The serum adsorption process consisted of serial stages using serovar Typhi and E. coli whole cells, followed by adsorption with nondenatured and heat-denatured whole-cell lysates immobilized on 0.5-µm polystyrene beads (Bangs Laboratories Inc., Fishers, IN). The resultant pooled serum sample retained no discernible reactivity in a whole-cell enzyme-linked immunosorbent assay (ELISA) format utilizing the CT18 strain (data not shown) and was aliquoted and stored at 80°C until use.
Construction of genomic and large plasmid expression libraries of serovar Typhi CT18. We purified genomic DNA from serovar Typhi CT18 by using Easy DNA (Invitrogen, Carlsbad, CA) and partially digested it with Sau3A under conditions optimized to yield fragments of 0.5 to 1.5 kb. We then gel purified the resulting fragments and extracted them using a QIAquick PCR purification kit (Qiagen, Valencia, CA). Serovar Typhi CT18 also harbors the large plasmids pHCM1 (218 kb) and pHCM2 (106 kb). These plasmids are not essential requirements for virulence; plasmid pHCM1 confers a drug resistance phenotype, while plasmid pHCM2 is phenotypically cryptic (15). Although neither plasmid is required to cause typhoid fever in humans, we included these in our screen since they may contribute to virulence and are often found in clinical isolates obtained from patients with typhoid fever. We purified plasmid DNA from serovar Typhi CT18 by using a QIAGEN large construct kit (Qiagen, Valencia, CA) to generate a heterogeneous pool of plasmid DNA, which was subjected to partial digestion as described above.
Using both genomic and large plasmid DNAs, we constructed expression libraries in pET30abc expression vectors (Novagen, San Diego, CA), allowing for cloning of the digested fragments in each of three possible open reading frames to generate fusion proteins under the control of an inducible T7 promoter. Vector DNA was prepared by digestion with BamHI and treated with calf and shrimp alkaline phosphatase.
We next ligated each of the three vectors separately with genomic and large plasmid DNA fragments to create six expression libraries. These libraries were electroporated into E. coli DH5
(Invitrogen, Carlsbad, CA) and spread on LB plates containing kanamycin. After overnight incubation, we collected colonies from plates by scraping and recovered plasmid DNA. We then electroporated the plasmid mixture into E. coli BL21(DE3), a protease-deficient strain optimized for expression of heterologous proteins. We then assessed the resulting libraries by PCR amplification of a random sample to determine the frequency and sizes of the insertions, and only libraries with >80% of inserts falling between 500 and 1,500 bp were used in subsequent screening assays.
Screening libraries for antigenic proteins expressed during serovar Typhi infection. In the primary screening of the expression libraries, we aliquoted small volumes of each library onto multiple plates containing kanamycin to achieve a colony density of approximately 500 colonies per plate. We incubated plates overnight and lifted the resultant colonies onto a nitrocellulose membrane that was then placed on an LB plate containing isopropyl-ß-D-thiogalactopyranoside (1 mM) to induce the transcription of insert DNA. After 4 hours, we lysed colonies adhered to membranes by placing them on chloroform-soaked blotting paper. Membranes were then air dried and blocked with phosphate-buffered saline containing 5% nonfat milk. We then incubated the membranes overnight with adsorbed convalescent-phase pooled sera (described above) at a 1:5,000 dilution. We detected clones reacting with adsorbed sera using a peroxidase-conjugated goat anti-human immunoglobulin (Ig) antibody (MP Biomedicals/Cappel, Aurora, OH) at a 1:2,000 dilution and developed immunoblots using an enhanced chemiluminescence (ECL) kit (Amersham, Piscataway, NJ). Reactive clones were recovered from master plates and frozen as glycerol stocks.
We confirmed the immunoreactivities of clones selected in the primary screen by comparing them directly to the reactivity of a control strain, E. coli BL21(DE3) containing the pET30 vector with no insert, in a whole-colony immunoblot assay. We then purified plasmids from consistently reactive clones and sequenced the inserts by using pET30-specific upstream and downstream primers. For inserts that contained multiple ORFs, we performed a tertiary evaluation of the immunoreactivities of individual ORFs by cloning each of the entire predicted ORFs, generated by PCR amplification, into 5' NdeI and 3' NotI restriction enzyme sites in the pET30a vector and assaying the reactivity of each resultant clone compared to that of the control strain, E. coli BL21(DE3) containing the pET30 vector with no insert.
Prediction of function of antigens identified by IVIAT. The cellular localization of antigens identified by IVIAT was predicted using PSORTb, version 2.0.4 (http://www.psort.org). Functional classification was based, when available, on published studies of identified proteins in S. enterica. When no published functional studies for S. enterica were available, protein functional classification was based on predictive models using the Clusters of Orthologous Groups database (http://www.ncbi.nlm.nih.gov/COG/) and the Pfam database (http://www.sanger.ac.uk/Software/Pfam).
Screening antigens identified by IVIAT against sera from North American volunteers. To assess the degree of cross-reactivity of antigens identified by IVIAT, we also screened reactive clones for immunoreactivity against pooled sera from five North American volunteers with no prior history of exposure to serovar Typhi organisms or typhoid vaccines. Prior to screening, we allowed the pooled sera to adsorb with in vitro-grown E. coli BL21(DE3) (as described above) to reduce background reactivity against the host strain used in the whole-colony immunoblot assay.
Evaluation of serum IgG responses to in vitro-transcribed and -translated PagC by Western blot analysis using paired acute- and convalescent-phase sera from patients with serovar Typhi bacteremia and from control patients. To confirm the significance of the serum immunoglobulin response to PagC in a whole-colony immunoblot assay, we applied an in vitro transcription-translation system using the pagC ORF cloned into the 5' NdeI and 3' NotI restriction enzyme cloning sites of pET30a to produce a T7 promoter-inducible template DNA, which was used in a commercial cell extract system (ActivePro; Ambion, Austin, TX) to yield a 20-kDa protein. Immune responses to PagC in paired acute- and convalescent-phase serum samples from 14 patients with serovar Typhi bacteremia and 7 control patients with cholera were then compared by Western blot analysis. For these studies, we used nonadsorbed serum from each patient at a 1:10,000 dilution. We detected immune responses with peroxidase-conjugated goat anti-human IgG (KPL, Gaithersburg, MD) at a dilution of 1:100,000, using an ECL kit (Amersham, Piscataway, NJ).
Evaluation of serum IgG responses to purified TcfB by ELISA, using paired acute- and convalescent-phase sera from patients with serovar Typhi bacteremia and from control patients. To confirm the immunoreactivity of TcfB in the whole-colony immunoblot assay, we constructed an inducible TcfB fusion protein expressing an N-terminal hexahistidine residue coupled with the C-terminal 148 amino acids encoded by tcfB. The initial 43 amino acids of the full predicted peptide sequence were predicted to be a signal peptide, and we did not include them in the expressed fusion. We generated the encoding sequences on an NdeI-XhoI fragment from serovar Typhi CT18 genomic DNA, using the 5' primer GGAGATATACATATGGTTCAGAAGGATATTACCGTC and the 3' primer ATGCGGATCCTCGAGTTAGCCGGCAGTGACAGCCTGTG, and cloned this fragment into the pET15b (Novagen, San Diego, CA) expression vector. We induced the expression of TcfB at 37°C with 1 mM isopropyl-ß-D-thiogalactopyranoside in E. coli BL21(DE3). We lysed TcfB-containing cells via sonication and purified the fusion protein by nickel-affinity chromatography under nondenaturing conditions to obtain a final 17.5-kDa product at a concentration of 100 µg/ml. We then diluted this product 1:100 in 50 mM carbonate buffer (pH 9.6) and allowed it to adsorb overnight at room temperature onto ELISA plates (Nunc Maxisorb; NalgeNunc, Rochester, NY), using 100 µl of sample per well. We applied acute- and convalescent-phase sera (1:100 dilution) from 14 patients with serovar Typhi bacteremia and 7 control patients with cholera, detected anti-TcfB IgG with horseradish peroxidase-conjugated rabbit anti-human IgG (Jackson Immunoresearch, West Grove, PA) at a 1:1,000 dilution, and measured peroxidase activity with the substrate 2,2'-azinobis(ethylbenzthiazolinesulfonic acid). The optical density at 405 nm was determined kinetically with plates read for 5 min at 19-second intervals, and the maximum slope for an optical density change was converted to ELISA units by comparison with pooled standard reference sera (obtained from healthy volunteers from Bangladesh), as described previously (10). We evaluated the statistical significance of the difference between acute- and convalescent-phase serum anti-TcfB IgG levels by using a nonparametric test (the Wilcoxon signed rank test) for comparing paired samples.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Thirty-five proteins identified by IVIAT in S. enterica serovar Typhi
|
Comparison of serovar Typhi genes identified by IVIAT to homologs in serovar Typhimurium.
Of the 35 genes identified by IVIAT, 27 had
70% homology to ORFs found in the serovar Typhimurium LT2 genome. None of the five proteins encoded on pHCM1 or pHCM2 had a homolog in serovar Typhimurium LT2, but because these plasmids are not essential requirements for virulence (15), it is not likely that the five proteins are essential to the specificity of serovar Typhi-human interactions.
Of the chromosomally encoded serovar Typhi in vivo-induced antigens identified, all were present in both sequenced genomes of serovar Typhi (CT18 and Ty2), but three were not present in the genome of serovar Typhimurium LT2. These included STY1648 and STY3683, which are predicted to localize to the inner and outer membranes, respectively, and have no known function. The third in vivo-induced antigen with no known homolog in serovar Typhimurium was TcfB, which is predicted to be a major fimbrial structural protein. In contrast to most fimbrial operons found in serovar Typhi, the tcf operon is not widely distributed among other S. enterica serovars (24); however, TcfB shares approximately 30% homology at the amino acid level with CooA, the major structural subunit of the CS1 colonizing factor antigen of enterotoxigenic E. coli, as well as with the CblA major fimbrial subunit protein of the cable II pilus of cystic fibrosis-associated Burkholderia cepacia.
Evaluation of immunoreactivities of serovar Typhi antigens identified by IVIAT to sera from North American volunteers. Many serovar Typhi antigens are conserved across Salmonella enterica species as well as across the Enterobacteriaceae in general. To identify a subset of serovar Typhi antigens identified by IVIAT whose immunoreactivities are most specific to sera from individuals with serovar Typhi infection, we tested each IVIAT-derived clone for reactivity to sera obtained from North American volunteers with no history of exposure to serovar Typhi or previous immunization against typhoid. We identified four clones expressing serovar Typhi gene products identified by IVIAT with no detectable degree of reactivity with North American volunteer sera compared to control colonies without an insert. The immunoreactivities of the clones expressing these four IVIAT-derived antigens with the pooled sera from serovar Typhi bacteremic patients compared to their reactivities with sera from North American volunteer control subjects are shown in Fig. 1.
|
View larger version (13K): [in a new window] |
FIG. 1. Evaluation of the specificity of immunoreactivity of three fimbria-related antigens and PagC. We compared the immunoreactivity to each antigen identified by IVIAT in a whole-colony blot assay using pooled sera from patients with serovar Typhi bacteremia to the reactivity of pooled sera from adult North American volunteers. Four of the IVIAT-identified antigens (PagC, TcfB, STY0860, and STY3683) had no detectable immunoreactivity with the North American volunteer sera compared to control colonies with no insert. Each antigen was screened in triplicate with both patient and control sera, and a single representative immunoblot is shown.
|
Evaluation of immune responses to PagC and PagC homologs. Among the serovar Typhi antigens identified by IVIAT, PagC was one of the most immunoreactive proteins. We thus compared humoral immune responses to PagC in individual paired sera from 14 patients with fever and confirmed serovar Typhi bacteremia (including samples from the 8 patients used to generate the pooled sample). We also measured humoral immune responses to PagC using sera from seven control individuals with confirmed Vibrio cholerae infection who presented to the same care facility in Bangladesh as did the typhoid patients. Although our initial attempts to purify a full-length PagC fusion protein by affinity chromatography were unsuccessful, we utilized an in vitro transcription and translation system to generate the full-length PagC protein and found that 11 of 14 patients with symptomatic serovar Typhi bacteremia had a detectable increase in circulating anti-PagC IgG, as detected by Western blot analysis, while none of the controls had an apparent increase in their anti-PagC antibodies (Fig. 2). Notably, some Bangladeshi patients and controls residing in an area of serovar Typhi endemicity did have detectable anti-PagC IgG in acute-phase serum samples, possibly representing prior infections or low levels of cross-reactive antibodies. However, we did not observe reactivity to PagC when we used sera from North American volunteers who were never exposed to serovar Typhi organisms or vaccines (data not shown).
![]() View larger version (30K): [in a new window] |
FIG. 2. Responses to PagC in paired serum samples obtained from patients infected with S. enterica serovar Typhi or V. cholerae (controls). PagC was produced by a cell-free in vitro transcription-translation system, and individual patient immune responses were visualized by Western blotting. (A) Eleven of 14 patients infected with serovar Typhi had a visible increase in anti-PagC IgG antibodies during convalescence (conv.). +, visually significant increase in reactivity between paired acute- and convalescent-phase samples by Western blotting; , no response. (B) None of the patients infected with V. cholerae had a visible increase in PagC reactivity with convalescent-phase serum. None of the North American volunteers had visible reactivity against PagC in this assay (data not shown).
|
Evaluation of immune responses to TcfB. To further evaluate the anti-TcfB responses in individuals with documented serovar Typhi infections, we purified a His-TcfB fusion protein and compared anti-TcfB humoral immune responses in 14 serovar Typhi-infected patients and 7 control patients with cholera. During convalescence, in contrast to the case during the acute stage of infection, anti-TcfB IgG responses increased in individuals with serovar Typhi bacteremia but not in individuals with cholera (P = 0.05) (Fig. 3).
![]() View larger version (24K): [in a new window] |
FIG. 3. Responses to TcfB in paired serum samples obtained from patients infected with S. enterica serovar Typhi or V. cholerae (controls). Sera were collected at the time of presentation to a health care facility (acute phase) and again 2 to 3 weeks later (convalescent phase [conv.]). Columns represent geometric means, and error bars represent the standard errors of the means.
|
|
|
|---|
Our identification of PagC by IVIAT, the differential anti-PagC reactivity in convalescent- versus acute-phase sera from 11 of 14 patients with confirmed serovar Typhi bacteremia, the absence of comparable seroreactivity in individuals with cholera, and the absence of seroreactivity in North American volunteers with no prior exposure to serovar Typhi organisms or vaccines suggest that immune responses to PagC may be specific to patients with at least S. enterica (if not more specifically serovar Typhi) infection. The potential diagnostic significance of anti-PagC humoral immune responses, as well as the roles of humoral and cellular anti-PagC responses in adaptive immunity to serovar Typhi infection, requires further evaluation.
Of the other potential virulence factors identified by IVIAT, the largest functional category included six fimbria-related proteins, including proteins derived from three separate fimbrial operons, i.e., tcf, stb, and agf. These results are consistent with findings from the murine serovar Typhimurium typhoid model, in which only one fimbrial antigen, FimA, is detectable in organisms grown in vitro but infected mice develop humoral immune responses to 11 fimbrial antigens that are detectable by Western blotting, suggesting a significant upregulation of these fimbrial antigens in vivo (9). In concordance with these data, we identified several S. enterica fimbrial antigens by using IVIAT, including proteins involved in the biogenesis of aggregative fimbriae (or curli) and two chaperone-usher class pili encoded by the stbABCDE and tcfABCD operons (24). This is relevant given the significance of fimbrial antigens both in the pathogenesis of bacterial infections and in host innate and adaptive immune responses to bacterial pathogens.
Our identification of the fimbrial antigen TcfB by IVIAT is of particular interest. Unlike the majority of the 12 fimbrial operons predicted or described for the sequenced isolates of serovar Typhi organisms, the tcf operon is not found in serovar Typhimurium, nor is this operon widely distributed among other S. enterica serovars. Interestingly, the tcf operon is found in serovar Paratyphi A organisms, which, like serovar Typhi organisms, are restricted to human hosts and are another major etiologic agent of enteric fever (24). Based on this genomic evidence alone, tcf has been theorized to play a role in the host specificity of serovar Typhi. TcfB represents the major structural antigen of this fimbrial operon, and as with PagC, we found no appreciable immunoreactivity to TcfB in a serovar Typhi-naive population. We also found that there was a significant increase in circulating anti-TcfB IgG antibodies in patients presenting with serovar Typhi bacteremia, which were absent in control patients from the same area of serovar Typhi endemicity. Our identification of the main structural subunit encoded by the tcf operon as an in vivo-induced antigen provides support for the hypothesis that this protein plays a role in the host specificity of serovar Typhi. However, because TcfB is not found in serovar Typhimurium, additional experiments will be required to evaluate the role of Tcf in natural infection and pathogenesis.
In addition to TcfB, we also identified two other serovar Typhi antigens (STY1648 and STY3683) by IVIAT that may play a role in the host-restricted phenotype of serovar Typhi, based on their absence from the serovar Typhimurium genome. Of these, the putative membrane protein STY3683 is of particular interest for future evaluation since, like TcfB, no cross-reactive antibodies to this antigen were found in a serovar Typhi-naive population.
Although IVIAT has been used to identify proteins specifically expressed in vivo during infection with a number of organisms (20), IVIAT has particular utility when in vitro and animal models present only limited representations of human infection and when genomic and proteomic analyses are limited by a small number of recoverable organisms during the infectious process, such as during human infection with serovar Typhi organisms. As with any technology, IVIAT does have potential limitations, including (i) the identification of exclusively in vivo-expressed protein antigens, with the exclusion of potentially important in vitro-expressed and nonprotein antigens; (ii) cross-reactivity of homologous antigens; (iii) the identification of targets of humoral but not cellular immunity; and (iv) the fact that while IVIAT identifies genes that are upregulated in vivo and are antigenic, assessing the potential roles of these antigens in pathogenesis and protective immunity requires additional study (20). IVIAT does, however, identify a subset of antigens that warrant additional evaluation for their roles in pathogenesis and immunity and their use in clinical applications.
In summary, applying IVIAT to S. enterica serovar Typhi, we identified 35 immunogenic bacterial proteins which are expressed uniquely in vivo and are reactive with convalescent-phase sera from humans with serovar Typhi bacteremia. A subset of these antigens are present in serovar Typhi organisms and are not present in serovar Typhimurium (STY1648, STY3683, and TcfB), and another subset does not have any reactivity with sera from North American volunteers who were never exposed to serovar Typhi organisms or vaccines (STY0860, STY3683, PagC, and TcfB). Only TcfB and STY3683 are both unique to serovar Typhi organisms and are not cross-reactive with naïve sera, and as such, we believe that these antigens warrant focused evaluation of possible contributions to the host specificity of systemic serovar Typhi infection.
We thank Doli Goswami for assistance with the patient data, Kathleen Sheridan for assistance in preparation of the manuscript, and the staff of the ICDDR,B Kamalapur clinic.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»