Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Delpino, M. V. Articles by Baldi, P. C. Search for Related Content PubMed PubMed Citation Articles by Delpino, M. V. Articles by Baldi, P. C.

 Previous Article  |  Next Article 

Infection and Immunity, January 2007, p. 299-305, Vol. 75, No. 1
0019-9567/07/$08.00+0     doi:10.1128/IAI.00952-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

A Bile Salt Hydrolase of Brucella abortus Contributes to the Establishment of a Successful Infection through the Oral Route in Mice ^,

M. Victoria Delpino,¹ María I. Marchesini,² Silvia M. Estein,³ Diego J. Comerci,² Juliana Cassataro,^1,4 Carlos A. Fossati,¹ and Pablo C. Baldi^1*

Instituto de Estudios de la Inmunidad Humoral (IDEHU, CONICET-UBA), Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, 1113 Buenos Aires, Argentina,¹ Instituto de Investigaciones Biotecnológicas, Universidad Nacional de Gral. San Martín, 1650 San Martín, Argentina,² Laboratorio de Inmunología, Departamento de Sanidad Animal y Medicina Preventiva, Facultad de Ciencias Veterinarias, Universidad Nacional del Centro de la Provincia de Buenos Aires, 7000 Tandil, Argentina,³ Laboratorio de Inmunogenética, Hospital de Clínicas "José de San Martín," Facultad de Medicina, Universidad de Buenos Aires, 1120 Buenos Aires, Argentina⁴

Received 14 June 2006/ Returned for modification 25 July 2006/ Accepted 23 October 2006

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Choloylglycine hydrolase (CGH), a bile salt hydrolase, has been annotated in all the available genomes of Brucella species. We obtained the Brucella CGH in recombinant form and demonstrated in vitro its capacity to cleave glycocholate into glycine and cholate. Brucella abortus 2308 (wild type) and its isogenic cgh deletion mutant exhibited similar growth rates in tryptic soy broth in the absence of bile. In contrast, the growth of the cgh mutant was notably impaired by both 5% and 10% bile. The bile resistance of the complemented mutant was similar to that of the wild-type strain. In mice infected through the intragastric or the intraperitoneal route, splenic infection was significantly lower at 10 and 20 days postinfection in animals infected with the cgh mutant than in those infected with the wild-type strain. For both routes, no differences in spleen CFU were found between animals infected with the wild-type strain and those infected with the complemented mutant. Mice immunized intragastrically with recombinant CGH mixed with cholera toxin (CGH+CT) developed a specific mucosal humoral (immunoglobulin G [IgG] and IgA) and cellular (interleukin-2) immune responses. Fifteen days after challenge by the same route with live B. abortus 2308 cells, splenic CFU counts were 10-fold lower in mice immunized with CGH+CT than in mice immunized with CT or phosphate-buffered saline. This study shows that CGH confers on Brucella the ability to resist the antimicrobial action of bile salts. The results also suggest that CGH may contribute to the ability of Brucella to infect the host through the oral route.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Bile acids are synthesized in the liver and secreted into the bile mostly as conjugated bile acids in which the steroid moiety of the acid is linked to glycine or taurine by an amide bond. The amphipathic nature of the conjugated bile acids confers on them a detergent action that helps in the dispersion and enzymatic digestion of fats. By virtue of this detergent action, bile salts also exert an antimicrobial effect, and their second physiological function is to prevent bacterial overgrowth in the small intestine (8). Conjugated bile acids are deconjugated by the intestinal microflora through the action of bile salt hydrolases (E.C. 3.5.1.24), also known as choloylglycine hydrolases (CGH) or conjugated bile acid hydrolases (14). It has been postulated that resident bacteria produce these enzymes to reduce the detergent properties of bile salts and therefore their deleterious effects on bacterial membranes, thus enhancing bacterial survival in the gut (3, 6, 8). The production of bile salt hydrolases has been described mostly for bacteria from the indigenous gut microflora, including members of the genera Lactobacillus, Bifidobacterium, Bacteroides, Clostridium, and Enterococcus (5, 9, 10, 15, 17). In other bacteria, including Francisella tularensis and Bordetella pertussis, a cgh gene has been identified by genomic analysis, but the enzymatic activity and the biological role of the encoded protein have not been characterized.

Genes coding for a putative CGH have been described for the genomes of Brucella abortus 2308 (BAB1_1488), B. abortus 9-941 (BruAb1_1463), Brucella melitensis 16M (BMEI0543), and Brucella suis 1330 (BR1468) (1, 2, 7, 12), but no studies have been performed to characterize the encoded proteins or their role in the biology of brucellae. While Brucella species do not reside in the gut, oral infection is one of the main forms in which the disease is acquired, both in humans and animals (11). Animals usually smell and lick fetal and placental tissues from abortions, most of which are caused by brucellae. Among humans, Brucella infection is frequently acquired through consumption of raw or undercooked meat or cheese made from unpasteurized milk. After reaching the gut, the bacterium must overcome the detergent action of bile acids before leaving the gut lumen. In consequence, it can be speculated that CGH expression is important for the success of Brucella infection through the oral route. In spite of the importance of oral infection in brucellosis, potential virulence factors involved in this mode of infection have not been assessed. Therefore, the purposes of the present study were to confirm the enzymatic nature of the putative CGH from B. abortus and to analyze its contribution to the success of oral infection in mice. We also assessed whether a specific anti-CGH local mucosal immune response can protect mice against such infection.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Sequence analysis of Brucella CGH. BLAST software was used to search for homologies between the amino acid sequence of the CGH from B. abortus 2308 (CAJ11444) and those from other bacterial proteins. Multiple sequence alignment with bile salt hydrolases from other bacteria was performed with CLUSTALW. The amino acid sequences of B. abortus CGH and its homologues were also analyzed with SignalP 3.0 to search for signal peptides.

Production of recombinant CGH. The open reading frame of cgh (including its signal sequence) was amplified by PCR with primers 5'GCGGCTCATATGGCTTGCACGAGCTTC3' (NdeI) and 5'TTCATGGGATCCTTACTTTTTCAGTGA3' (BamHI) by use of B. abortus genomic DNA as the template (underlining indicates restriction sites for the enzymes). The amplicon was inserted into plasmid pET17b (Novagen, Madison, WI) and the recombinant plasmid was used to transform Escherichia coli JM109 competent cells. Miniprep-purified plasmid DNA from a colony containing the insert was used to transform E. coli strain BL21(DE3) competent cells (Stratagene). Recombinant CGH was successfully expressed in inclusion bodies of E. coli cells after induction with 1 mM isopropyl-ß-D-thiogalactopyranoside (IPTG). Inclusion bodies were solubilized in 50 mM Tris-8 M urea (pH 8.0) and refolded by dialysis against phosphate-buffered saline (PBS) containing 1 mM dithiothreitol. Recombinant CGH was purified by anion exchange chromatography and adsorbed with Sepharose-polymyxin B (Sigma) to eliminate lipopolysaccharide contamination.

Measurement of the enzymatic activity of recombinant CGH. The CGH activity of the recombinant protein was measured in vitro essentially as described by Tanaka et al. (16) with slight modifications. Briefly, 100 µg of CGH (100 µl) was incubated at 37°C with 100 µl of 20 mM sodium glycocholate (Sigma) and 1.8 ml of phosphate buffer, pH 6.0, in the presence of 10 mM dithiothreitol. At different times, samples (50 µl) were obtained and the reaction was stopped with an equal volume of 15% trichloroacetic acid. Samples were centrifuged and supernatants were separated to measure the amount of released glycine. Samples (100 µl) were mixed with 500 µl of 1% ninhydrin, 200 µl of 0.5 M citrate buffer, pH 5.5, and 1.2 ml of glycerol. The mixture was heated in boiling water for 14 min and cooled in a water bath for 3 min. The absorbance of samples at 570 nm was interpolated in a curve obtained with glycine standard solutions. In some experiments, recombinant CGH was preincubated for 15 min with a mouse anti-CGH serum or with mouse normal serum before the addition of glycocholate.

DNA manipulations. (i) Construction of the Brucella abortus cgh mutant strain. For the construction of a cgh (BAB1_1488) unmarked chromosomal mutant from B. abortus 2308, two PCR fragments of approximately 500 bp were generated immediately upstream and downstream of the cgh gene (complete open reading frame, including the signal sequence). Oligonucleotides cghF1 (5'-CGGGATCCGTCCAGATTATCGAAAATGTC-3') and cghR2 (5'-TCCAGACTGCTACGTATCGCGAGAGAGCTTTTCGTTTCCAT-3') were used to amplify a fragment including codons 1 to 7 of cgh, and oligonucleotides cghF3 (5'-GCGATACGTAGCAGTCTGGAGCGCCGTCACTGAAAAAGTAA-3') and cghR4 (5'-GGACTAGTCCCGTGACCGTGCGAGAAAAA-3') were used to amplify a fragment including codons 327 to 333 of cgh. Both fragments (containing complementary regions) were ligated by overlapping PCR using oligonucleotides cghF1 and cghR4. The resulting fragment containing the cgh deletion allele was cloned into pBluescript KSII-sacB, which encodes the levansucrase from Bacillus subtilis. The plasmid was introduced into B. abortus 2308 by electroporation. The integration of the suicide vector into the chromosome was selected by resistance to carbenicillin (50 µg/ml) and sensitivity to sucrose (10% [wt/vol]) in tryptic soy agar (TSA) plates. A selected colony was grown overnight in tryptic soy broth (TSB) without antibiotics and plated in TSA-sucrose. Sucrose-resistant colonies were replica plated in TSA-carbenicillin. Carbenicillin-sensitive colonies were selected to confirm the excision of the plasmid and the generation of the mutant strain by allelic exchange. A colony PCR with primers cghF1 and cghR4 yielded an amplicon of 1 kbp in the mutant strain and a fragment of 2 kbp in the parental wild-type strain. The mutant strain carrying an unmarked deletion of cgh was called the cgh mutant.

(ii) Complementation of the cgh mutant by knock-in. Despite several attempts, it was not possible to complement the cgh mutant by expression of the missing gene from a plasmid. Thus, we adopted a knock-in strategy, whereby the deleted gene was replaced at the original locus. A PCR fragment containing the wild-type cgh gene was obtained using oligonucleotides cghF1 and cghR4. This fragment was cloned into the pGEM-T Easy (Promega) suicide vector, and the resulting plasmid was electroporated into the B. abortus cgh strain. Double recombination events were selected by resistance to 3% bile salts and by sensitivity to carbenicillin (50 µg/ml) in TSA plates. Colonies were screened by PCR with oligonucleotides cghF1 and cghR4 as described above. The production of CGH in the reconstituted strain was checked by Western blotting.

Assessment of B. abortus resistance to bile salts in vitro. Two in vitro methods were used to test the effect of CGH deletion on the resistance of B. abortus to bile salts. The wild-type strain and the cgh mutant were grown in TSB up to an optical density at 600 nm (OD₆₀₀) of 1.0 and were resuspended to an OD₆₀₀ of 0.1 in TSB alone or in TSB containing 5% or 10% bovine bile. Cultures were incubated at 37°C with shaking for 18 h, and aliquots were plated on TSA for CFU counting.

In the second method, both the wild-type strain and the cgh mutant were grown in TSB to an OD₆₀₀ of 0.6. Aliquots (200 µl) from these cultures were uniformly spread on TSA plates. Nitrocellulose discs (5 mm) embedded with different concentrations (0%, 5%, and 10%) of bovine bile were laid on the TSA plates, which were incubated for 48 h before the diameter of the inhibition zones was measured.

Infection of mice. BALB/c mice (10 per group) were infected by intragastric delivery of wild-type B. abortus 2308, its isogenic cgh mutant, or the complemented mutant (all at 1 x 10⁸ CFU) suspended in 300 µl of 10% sodium bicarbonate by use of a plastic feeding tube introduced through the mouth. Other mice (10 per group) were infected through the intraperitoneal route with 1.4 x 10⁸ CFU of the wild-type strain, the cgh mutant, or the complemented mutant. Five mice from each group were sacrificed at 10 and 20 days postinfection (p.i.), and spleens were removed. Dilutions of spleen homogenates were plated in duplicate on TSA for CFU counting. Data were expressed as log₁₀ CFU per spleen. Differences between groups were analyzed with the Mann-Whitney U test (Prism 4.0; GraphPad Software, Inc.).

Oral immunization of mice with CGH and oral challenge with virulent B. abortus. BALB/c mice (10 animals per group) were immunized intragastrically with (i) 100 µg of recombinant CGH mixed with 5 µg of cholera toxin (CT) in 500 µl of PBS, (ii) cholera toxin alone, or (iii) PBS. Animals received three consecutive weekly immunizations. Twenty days after the last immunization, mice were challenged intragastrically with 1 x 10⁸ CFU of B. abortus 2308. Animals were euthanized at 21 days postchallenge, and spleen CFU counts were determined as described above. The CFU data were normalized by log transformation, and differences between groups were analyzed by analysis of variance and Dunnett's posttest (Prism 4.0; GraphPad Software, Inc.).

Fecal extracts. Fecal extracts were prepared as follows. Five fecal pellets were collected from each mouse (housed in separate cages) and were mixed with 0.5 ml of extraction buffer (30 mM disodium EDTA, pH 7.6, 100 µg/ml soybean trypsin inhibitor, and 10 mg/ml bovine serum albumin in PBS). Pellets were homogenized and centrifuged at 4°C, and supernatants were stored at –20°C until immunoglobulin A (IgA) and IgG measurements were performed.

Measurement of anti-CGH antibodies. Specific anti-CGH antibodies were measured in serum samples and fecal extracts by indirect enzyme-linked immunosorbent assay (ELISA) using polystyrene plates coated with CGH (0.5 µg per well). Sera were dispensed in the appropriate dilution, while fecal extracts were used undiluted. Plates were incubated for 1 h (IgG) or overnight (IgA). Bound antibodies were revealed by incubation with specific conjugates (horseradish peroxidase labeled) against mouse IgA or IgG followed by a chromogenic solution (o-phenylenediamine-H₂O₂).

Assessment of the cellular immune response to CGH. The anti-CGH cellular immune response of immunized mice was assessed in vitro using splenocytes and cells derived from mesenteric lymph nodes. Spleens were cut into small pieces, homogenized in RPMI 1640, and filtered. Splenocytes were washed with RPMI and resuspended in complete culture medium (RPMI 1640, 10% fetal calf serum, 2 mM L-glutamine, 25 mM HEPES, 100 U/ml penicillin, 100 µg/ml streptomycin). Cells from mesenteric lymph nodes were obtained by crushing the nodes against a sterile steel mesh in a petri dish filled with 3 ml of RPMI. Cells were washed and resuspended in complete culture medium.

Splenocytes or lymph node cells were placed at 4 x 10⁶ cell/ml in polypropylene tubes and were stimulated with antigen (CGH, 0.1 µg/ml) or mitogen (concanavalin A, 5 µg/ml) or were left unstimulated. After incubation for 48 h at 37°C in a 5% CO₂ atmosphere, cells were centrifuged at 450 x g at 4°C, and culture supernatants were collected and kept at –70°C until cytokine measurements. Levels of gamma interferon, interleukin-2 (IL-2), IL-5, and IL-10 were measured in culture supernatants by use of commercial sandwich ELISA kits (OptEIA; Pharmingen).

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
B. abortus CGH is homologous to other bile salt hydrolases. As revealed by BLAST searches, the CGH from B. abortus 2308 is identical to those found in B. abortus 9-941 and B. melitensis 16M. In the CGH from B. suis, the Ala at position 149 is replaced by a Thr. In addition, BLAST revealed significant homologies with CGHs from Bacillus cereus (40% identity), Vibrio fischeri (37%), Bacteroides fragilis (36%), Clostridium perfringens (34%), Lactobacillus plantarum (30%), Bifidobacterium bifidum (31%), Listeria monocytogenes (29%), and many others.

CLUSTALW multiple sequence alignments of annotated CGHs revealed that the first 36 amino acids in the CGH sequences from B. abortus 9-941 and B. melitensis are absent in those of B. suis and B. abortus 2308 (see Fig. S1 in the supplemental material). SignalP analyses revealed that this sequence corresponds to a signal peptide with a probable cleavage site between Ala36 and Cys37. A review of the annotated genomes revealed that CGHs from B. suis and B. abortus 2308 also include this signal sequence, which was omitted in the annotation of these proteins (see Fig. S1 in the supplemental material). According to SignalP analyses, the CGHs from Bordetella pertussis, Francisella tularensis, Rhodopseudomonas palustris, and Bacteroides thetaiotaomicron contain signal peptides with probable cleavage sites between Ala and Cys residues homologous to those found for Brucella CGH (see Fig. S1 in the supplemental material).

In a previous study, the amino acid residues involved in the active site of the conjugated bile acid hydrolase from Clostridium perfringens were identified by X-ray crystallography and were shown to be conserved in the CGH sequences from other bacteria (13). As revealed by the multiple alignment performed in the present study (see Fig. S1 in the supplemental material), four of these six residues (Cys37, Arg53, Asn213, and Arg266) are conserved in the CGH sequences from B. abortus, B. suis, and B. melitensis, while a conservative change (Glu instead of Asp) is observed at position 56.

B. abortus CGH deconjugates bile salts. B. abortus CGH was successfully expressed in inclusion bodies in E. coli BL21(DE3). To test the enzymatic activity of the recombinant CGH, the protein was incubated with sodium glycocholate and the released glycine was measured by the ninhydrin reaction. As shown in Fig. 1, the amount of released glycine was significantly higher in the presence of CGH than in the absence of the enzyme (virtually no glycine was released spontaneously). This enzymatic activity was reduced by a half when the enzyme was preincubated with a mouse serum against CGH but was unaltered in the presence of normal mouse serum (Fig. 1). The enzyme was active at pH values ranging from 6 to 9, but activity was somewhat higher at pH values 7 and 8 (not shown).

View larger version (13K): [in this window] [in a new window]

FIG. 1. In vitro cleavage of glycocholate by recombinant CGH. Released glycine was measured with the ninhydrin reaction. The same procedure was performed in the presence of mouse anti-CGH serum and normal mouse serum and in the absence of enzyme (to control for the spontaneous release of glycine).

CGH confers on B. abortus resistance to bile salts. To determine whether CGH contributes to B. abortus resistance to bile salts, a cgh deletion mutant was derived from B. abortus 2308. While the parental B. abortus strain grew on tryptic soy agar supplemented with 3% bovine bile, the cgh mutant did not develop a visible growth (not shown). The complemented mutant was selected by its growth on agar containing bile, showing that the complementation restored the resistance to 3% bile observed in the wild-type strain. To obtain a quantitative measure of bile resistance, the wild-type strain of B. abortus, the isogenic cgh mutant, and the complemented mutant were grown in broth containing different concentrations of bile, and growth was assessed by plating on agar and CFU counting. As shown in Fig. 2, all three strains exhibited similar growth levels in TSB in the absence of bile. The growth of the wild-type strain was virtually unaffected in the presence of 5% bile but was notably reduced in 10% bile compared to that seen when growth took place in TSB alone. The growth of the cgh mutant was severely impaired by both 5% and 10% bile, and mean CFU counts were 5-fold and 12-fold lower, respectively, than those of the wild-type strain for the same culture conditions. Complementation restored the bile resistance of the mutant to levels similar to those observed for the wild-type strain (Fig. 2). Similar results were obtained in TSA cultures with discs embedded with bile. While the growths of the wild-type strain and the complemented mutant were unaffected under these conditions (no inhibition zones were observed), significant inhibition zones were observed for the cgh mutant around discs embedded with 5% and 10% bile (diameters, 20 ± 5 mm and 58 ± 6 mm, respectively). These results indicate that CGH confers on B. abortus the capacity to resist the antimicrobial action of bile salts.

View larger version (17K): [in this window] [in a new window]

FIG. 2. Growth of B. abortus 2308 (WT), its isogenic cgh mutant (cgh), and the complemented mutant in TSB containing different concentrations of bile. Data indicate the number of viable bacteria at 18 h of culture in each medium in triplicate experiments.

CGH deletion reduces B. abortus infectivity in mice. To test whether the reduced resistance of the cgh mutant to bile could affect its infectivity through the oral route, the mutant and its parental strain were administered intragastrically to mice, and CFU counts in spleens were determined at different times p.i. As shown in Fig. 3A, at all times p.i. the splenic infection was significantly lower (P = 0.0079, Mann-Whitney U test) in mice infected with the cgh mutant than in those infected with the wild-type strain. For comparison, mice were also infected intraperitoneally with both strains. As shown in Fig. 3B, splenic counts were also significantly lower (P = 0.0079) in mice infected with the cgh mutant. These results suggest that CGH may be involved in Brucella infection through both the oral route and the intraperitoneal route.

View larger version (8K): [in this window] [in a new window]

FIG. 3. Spleen colonization by B. abortus 2308 (WT), its isogenic cgh mutant (cgh), and the complemented mutant (comp) following oral (A) or intraperitoneal (B) infection of mice.**, significantly different medians (P = 0.0079, Mann-Whitney U test).

Oral immunization with CGH protects mice from oral challenge. Since CGH is involved in the intestinal phase of Brucella infection through the oral route, experiments were carried out to test whether local mucosal anti-CGH immune responses could protect mice from infection. Mice were immunized intragastrically with recombinant CGH mixed with CT and were challenged by the same route with live B. abortus 2308. Mice receiving CT alone or PBS served as controls. At baseline, anti-CGH antibody levels were similar in the three immunization groups. As shown in Fig. 4, levels of anti-CGH IgA in serum, feces, and saliva increased after immunization in the CGH+CT group, and the same was true for serum levels of specific IgG. In contrast, anti-CGH antibodies remained at baseline levels in mice injected with CT alone or PBS (not shown). Upon in vitro stimulation with recombinant CGH, splenocytes and lymph node cells from mice in the CGH+CT group, but not those from the CT group or the PBS group, produced IL-2 levels significantly higher than those seen for unstimulated cells (Fig. 5). No specific production of gamma interferon, IL-5, or IL-10 was observed in any group of mice.

View larger version (19K): [in this window] [in a new window]

FIG. 4. Antibody responses elicited in mice by oral immunization with CGH plus cholera toxin (adjuvant). Levels of specific anti-CGH antibodies were measured by ELISA in serum, saliva, and fecal extracts.

View larger version (6K): [in this window] [in a new window]

FIG. 5. Specific in vitro production of IL-2 by cells obtained from spleens and mesenteric lymph nodes of mice immunized with CGH plus cholera toxin. Cells were stimulated with recombinant CGH, and IL-2 levels were measured 48 h later in culture supernatants.

Mice were challenged 3 weeks after the last immunization. As shown in Table 1, CFU recovered from spleens 15 days after challenge were significantly lower (P < 0.01) in mice immunized with CGH+CT than in mice immunized with CT or PBS, yielding a level of protection of 1 log compared to the PBS group. These results, together with the attenuated oral infectivity of the CGH mutant, show that CGH is important for the success of B. abortus infection through the oral route.

View this table: [in this window] [in a new window]

TABLE 1. Partial protection conferred by oral immunization with recombinant CGH against oral challenge with B. abortus 2308 in mice

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Several bacteria that are naturally exposed to bile salts in the host express bile salt hydrolases that allow them to resist the antimicrobial action of these substances. As expected, most of these enzymes have been described and characterized for gut-dwelling bacteria, such as lactobacilli. However, the increasing number of sequenced bacterial genomes has revealed the existence of genes for such enzymes in bacteria that are not permanent gut dwellers. This is the case for Brucella spp., which can be acquired by ingestion but spread systemically. The bacterium must resist several noxious conditions in the gastrointestinal tract, cross the mucosal barriers, and reach the general circulation in order to disseminate. Since one of the adverse conditions faced by Brucella in the gut is the antimicrobial action of bile salts, the expression of a bile salt hydrolase, such as the CGH described here, would constitute an advantage for the pathogen. A cgh gene has been found for all the four Brucella species with published genomes, but no biochemical or functional characterization of the encoded enzyme has been performed.

We have found that the CGHs are virtually identical in all the four Brucella genomes available, although, as discussed below, some annotation differences have been detected. The enzyme has more than 50% amino acid similarity with well-described CGHs such as those from B. fragilis, C. perfringens, and L. plantarum. It is noteworthy that most of the amino acids previously identified as involved in the catalytic action of other CGHs (13) are conserved in the Brucella enzyme. Four of the six amino acids are identical, and a fifth one presents a conservative change (Glu instead of Asp at position 56). The sixth amino acid (position 119 in Brucella CGH) seems to be the less conserved among the different CGHs. Thus, the conservation in the Brucella CGH of most of the amino acids previously shown to be involved in CGH activity suggested that the protein would in fact display such enzymatic activity.

An intriguing apparent difference between the CGHs from B. abortus 2308 and B. suis and those from B. abortus 9-941 and B. melitensis was that the latter two enzymes contained a putative signal sequence while the former did not. When the annotation of the first two CGHs was checked against the corresponding genomes, it was evident that both enzymes also contain such a signal sequence, but it had been omitted during annotation in the Protein Data Bank, since an alternative starting Met (corresponding to position 35 in the CGH from B. abortus and B. melitensis) had been used. Therefore, the mature CGH would start at Cys37, which is homologous to the Cys2 found for most other CGHs. In addition, CLUSTAL alignment and SignalP analyses revealed that other CGHs, such as those from B. pertussis and F. tularensis, also contain signal sequences. Notably, among CGHs containing signal peptides, the cleavage site is conserved and results in proteins with a free Cys at their N termini. The biological reasons for the existence of bacterial CGHs containing signal sequences and others lacking such sequences are currently unknown. Further studies will be necessary to assess whether such a difference determines a differential distribution of the enzyme in different species.

The enzymatic activity of the Brucella CGH was revealed by different experiments. The protein was obtained in recombinant form, and its capacity to cleave glycocholate into glycine and cholate was assayed in vitro. This assay revealed that the protein displays CGH activity and that this activity is partially inhibited by specific anti-CGH antibodies. In agreement with these results, we found that a B. abortus mutant lacking the cgh gene has reduced resistance to bile salts and that this defect is reverted in the complemented mutant. Overall, these results confirmed that the Brucella CGH can cleave bile salts and that this enzymatic activity enhances Brucella survival in a bile-containing environment. Therefore, it can be speculated that CGH expression may help Brucella to withstand the antimicrobial action of bile in the gut when the bacterium enters the host through the oral route. To test this hypothesis, a CGH deletion mutant was derived from B. abortus 2308, and mice were infected by intragastric delivery with the mutant and the parental strains. The assay revealed that CGH deletion affects B. abortus infectivity by the oral route, since bacterial counts from spleen were significantly lower for mice infected with the mutant. Therefore, CGH would constitute a virulence factor for Brucella species. In the case of Listeria monocytogenes, which like Brucella can infect through the oral route and disseminate systemically, deletion of the bile salt hydrolase reduces bacterial survival in the gut and its capacity to colonize the liver (4).

Given its action on bile salts, the participation of CGH in the infection process is assumed to take place mostly in the gut. Therefore, we decided to assess whether a specific local mucosal immune response against CGH could reduce Brucella infection in mice upon intragastric challenge. Mice immunized intragastrically with recombinant CGH developed a specific mucosal immune response, as revealed by the presence of anti-CGH IgA in feces and saliva and the specific production of IL-2 by cells isolated from mesenteric lymph nodes. Upon intragastric challenge with virulent B. abortus, the bacterial count in spleen was reduced 10-fold in immunized mice from that for nonimmunized controls. These results confirmed the involvement of CGH in the invasion capacity of Brucella through the gut.

While several results from this study support a role for CGH in the capacity of Brucella to infect through the oral route, the results of the intraperitoneal infection experiments suggest that the enzyme may also be involved in Brucella infectivity through systemic routes. It is possible that CGH can exert enzymatic actions other than bile salt deconjugation, and such actions could be involved in the infection process at a systemic level. CGH belongs to the family of linear amide C-N hydrolases (Pfam 02275), which also includes penicillin acylases and acid ceramidases. Members of this family are N-terminal nucleophile hydrolases, and most, including CGH, contain an N-terminal nucleophilic cysteine. In summary, members of Pfam 00275 share the ability to cleave C-N bonds and share structural motifs, including the N-terminal nucleophilic cysteine. Therefore, it can be speculated that CGH may cleave C-N bonds on substrates other than bile salts, which may eventually be directly or indirectly involved in the infectivity of Brucella through systemic routes. We have performed preliminary studies which indicate that the cgh mutant has a reduced capacity of cellular invasion. At 4 h p.i. in the murine macrophage line J774, the mean intracellular CFU of the mutant were half of those of the wild-type strain. In contrast, the capacity of intracellular replication seemed to be preserved (not shown).

Overall, this study shows that the protein annotated as CGH in the genomes of different brucellae deconjugates bile salts and confers on these bacteria the ability to resist the antimicrobial action of these compounds. To our knowledge, this is the first protein described as a virulence factor of Brucella for oral infection. In addition, the enzyme also seems to be involved in processes relevant to infection through systemic routes. Studies are ongoing in our labs to try to elucidate the different mechanisms by which CGH confers on Brucella the ability to invade and survive in its mammalian hosts.

 
We thank Horacio Salomón and the staff of the Centro Nacional de Referencia del Sida, University of Buenos Aires, for their assistance with the use of the biosafety level 3 laboratory. We thank Susana Insua and Alejandro Dussio for technical assistance and Sergio Islas and Fabián Amaya (UNCPBA, Argentina) for animal care. We are grateful to Guillermo Giambartolomei for expert assistance with oral infections.

This work was supported by grant PICT99 05-06324 from the Agencia Nacional de Promoción Científica y Tecnológica, Argentina, and by a Small Grant from the International Society for Infectious Diseases (ISID). M.V.D. and M.I.M. were supported by a fellowship of the Consejo Nacional de Investigaciones Científicas y Tecnológicas (CONICET) from Argentina. S.M.E. was supported by CIC. C.A.F., J.C., D.J.C., and P.C.B. are members of the Research Career of CONICET. C.A.F. is also a member of the Facultad de Ciencias Exactas, Universidad Nacional de La Plata.

 
* Corresponding author. Mailing address: IDEHU, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junín 956 4to. Piso, 1113 Buenos Aires, Argentina. Phone: 54-11-4964-8259. Fax: 54-11-4964-0024. E-mail: pablobal{at}ffyb.uba.ar.

Published ahead of print on 6 November 2006.

Editor: D. L. Burns

Supplemental material for this article may be found at http://iai.asm.org/.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Chain, P. S. G., D. J. Comerci, M. E. Tolmasky, F. W. Larimer, S. A. Malfatti, L. M. Vergez, F. Agüero, M. L. Land, R. A. Ugalde, and E. García. 2005. Whole-genome analyses of speciation events in pathogenic brucellae. Infect. Immun. 73:8353-8361.[Abstract/Free Full Text]
2
2. DelVecchio, V. G., V. Kapatral, R. J. Redkar, G. Patra, C. Mujer, T. Los, N. Ivanova, I. Anderson, A. Bhattacharyya, A. Lykidis, G. Reznik, L. Jablonski, N. Larsen, M. D'Souza, A. Bernal, M. Mazur, E. Goltsman, E. Selkov, P. H. Elzer, S. Hagius, D. O'Callaghan, J. J. Letesson, R. Haselkorn, N. Kyrpides, and R. Overbeek. 2002. The genome sequence of the facultative intracellular pathogen Brucella melitensis. Proc. Natl. Acad. Sci. USA 99:443-448.[Abstract/Free Full Text]
3
3. De Smet, I., L. Van Hoorde, M. Vande Woestyne, H. Christiaens, and W. Verstraete. 1995. Significance of bile salt hydrolytic activities of lactobacilli. J Appl. Bacteriol. 79:292-301.[Medline]
4
4. Dussurget, O., D. Cabanes, P. Dehoux, M. Lecuit, C. Buchrieser, P. Glaser, P. Cossart, and the European Listeria Genome Consortium. 2002. Listeria monocytogenes bile salt hydrolase is a PrfA-regulated virulence factor involved in the intestinal and hepatic phases of listeriosis. Mol. Microbiol. 45:1095-1106.[CrossRef][Medline]
5
5. Gopal-Srivastava, R., and P. B. Hylemon. 1988. Purification and characterization of bile salt hydrolase from Clostridium perfringens. J. Lipid Res. 29:1079-1085.[Abstract]
6
6. Grill, J. P., C. Cayuela, J. M Antoine, and F. Schneider. 2000. Isolation and characterization of a Lactobacillus amylovorus mutant depleted in conjugated bile salt hydrolase activity: relation between activity and bile salt resistance. J. Appl. Microbiol. 89:553-563.[CrossRef][Medline]
7
7. Halling, S. M., B. D. Peterson-Burch, B. J. Bricker, R. L. Zuerner, Z. Qing, L. L. Li, V. Kapur, D. P. Alt, and S. C. Olsen. 2005. Completion of the genome sequence of Brucella abortus and comparison to the highly similar genomes of Brucella melitensis and Brucella suis. J. Bacteriol. 187:2715-2726.[Abstract/Free Full Text]
8
8. Hofmann, A. F., and L. Eckmann. 2006. How bile acids confer gut mucosal protection against bacteria. Proc. Natl. Acad. Sci. USA 103:4333-4334.[Free Full Text]
9
9. Kim, G. B., C. M. Miyamoto, E. A. Meighen, and B. H. Lee. 2004. Cloning and characterization of the bile salt hydrolase genes (bsh) from Bifidobacterium bifidum strains. Appl. Environ. Microbiol. 70:5603-5612.[Abstract/Free Full Text]
10
10. Lundeen, S. G., and D. C. Savage. 1990. Characterization and purification of bile salt hydrolase from Lactobacillus sp. strain 100-100. J. Bacteriol. 172:4171-4177.[Abstract/Free Full Text]
11
11. Nicoletti, P. L. 1989. Relationship between animal and human disease, p. 41-51. In E. J. Young and M. J. Corbel (ed.), Brucellosis: clinical and laboratory aspects, CRC Press, Boca Raton, FL.
12
12. Paulsen, I. T., R. Seshadri, K. E. Nelson, J. A. Eisen, J. F. Heidelberg, T. D. Read, R. J. Dodson, L. Umayam, L. M. Brinkac, M. J. Beanan, S. C. Daugherty, R. T. Deboy, A. S. Durkin, J. F. Kolonay, R. Madupu, W. C. Nelson, B. Ayodeji, M. Kraul, J. Shetty, J. Malek, S. E. Van Aken, S. Riedmuller, H. Tettelin, S. R. Gill, O. White, S. L. Salzberg, D. L. Hoover, L. E. Lindler, S. M. Halling, S. M. Boyle, and C. M. Fraser. 2002. The Brucella suis genome reveals fundamental similarities between animal and plant pathogens and symbionts. Proc. Natl. Acad. Sci. USA 99:13148-13153.[Abstract/Free Full Text]
13
13. Rossocha, M., R. Schultz-Heienbrok, H. von Moeller, J. P. Coleman, and W. Saenger. 2005. Conjugated bile acid hydrolase is a tetrameric N-terminal thiol hydrolase with specific recognition of its cholyl but not of its tauryl product. Biochemistry 44:5739-5748.[CrossRef][Medline]
14
14. Shindo, K., and K. Fukushima. 1976. Deconjugation of bile acids by human intestinal bacteria. Gastroenterol. Jpn. 11:167-174.[Medline]
15
15. Stellwag, E. J., and P. B. Hylemon. 1976. Purification and characterization of bile salt hydrolase from Bacteroides fragilis subsp. fragilis. Biochim. Biophys. Acta 452:165-176.[Medline]
16
16. Tanaka, H., H. Hashiba, J. Kok, and I. Mierau. 2000. Bile salt hydrolase of Bifidobacterium longum—biochemical and genetic characterization. Appl. Environ. Microbiol. 66:2502-2512.[Abstract/Free Full Text]
17
17. Wijaya, A., A. Hermann, H. Abriouel, I. Specht, N. M. Yousif, W. H. Holzapfel, and C. M. Franz. 2004. Cloning of the bile salt hydrolase (bsh) gene from Enterococcus faecium FAIR-E 345 and chromosomal location of bsh genes in food enterococci. J. Food Prot. 67:2772-2778.[Medline]

---

Infection and Immunity, January 2007, p. 299-305, Vol. 75, No. 1
0019-9567/07/$08.00+0     doi:10.1128/IAI.00952-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Paixao, T. A., Roux, C. M., den Hartigh, A. B., Sankaran-Walters, S., Dandekar, S., Santos, R. L., Tsolis, R. M. (2009). Establishment of Systemic Brucella melitensis Infection through the Digestive Tract Requires Urease, the Type IV Secretion System, and Lipopolysaccharide O Antigen. Infect. Immun. 77: 4197-4208 [Abstract] [Full Text]  
• Fang, F., Li, Y., Bumann, M., Raftis, E. J., Casey, P. G., Cooney, J. C., Walsh, M. A., O'Toole, P. W. (2009). Allelic Variation of Bile Salt Hydrolase Genes in Lactobacillus salivarius Does Not Determine Bile Resistance Levels. J. Bacteriol. 191: 5743-5757 [Abstract] [Full Text]  
• Martin, F. A., Posadas, D. M., Carrica, M. C., Cravero, S. L., O'Callaghan, D., Zorreguieta, A. (2009). Interplay between Two RND Systems Mediating Antimicrobial Resistance in Brucella suis. J. Bacteriol. 191: 2530-2540 [Abstract] [Full Text]  
• Pasquevich, K. A., Estein, S. M., Samartino, C. G., Zwerdling, A., Coria, L. M., Barrionuevo, P., Fossati, C. A., Giambartolomei, G. H., Cassataro, J. (2009). Immunization with Recombinant Brucella Species Outer Membrane Protein Omp16 or Omp19 in Adjuvant Induces Specific CD4+ and CD8+ T Cells as Well as Systemic and Oral Protection against Brucella abortus Infection. Infect. Immun. 77: 436-445 [Abstract] [Full Text]  
• Jones, B. V., Begley, M., Hill, C., Gahan, C. G. M., Marchesi, J. R. (2008). Functional and comparative metagenomic analysis of bile salt hydrolase activity in the human gut microbiome. Proc. Natl. Acad. Sci. USA 105: 13580-13585 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Delpino, M. V. Articles by Baldi, P. C. Search for Related Content PubMed PubMed Citation Articles by Delpino, M. V. Articles by Baldi, P. C.