IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
IAI.00334-07v1
75/11/5118    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wen, S.
Right arrow Articles by Pan-Hammarström, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wen, S.
Right arrow Articles by Pan-Hammarström, Q.

 Previous Article  |  Next Article 

Infection and Immunity, November 2007, p. 5118-5126, Vol. 75, No. 11
0019-9567/07/$08.00+0     doi:10.1128/IAI.00334-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Expression of Helicobacter pylori Virulence Factors and Associated Expression Profiles of Inflammatory Genes in the Human Gastric Mucosa{triangledown}

Sicheng Wen,1 Dominique Velin,2 Christian P. Felley,2 Likun Du,1 Pierre Michetti,2 and Qiang Pan-Hammarström1*

Division of Clinical Immunology, Department of Laboratory Medicine, F79, Karolinska University Hospital Huddinge, Karolinska Institutet, SE-141 86, Stockholm, Sweden,1 Department of Gastroenterology and Hepatology, Centre Hospitalier Universitaire Vaudois and University of Lausanne, Lausanne, Switzerland2

Received 2 March 2007/ Returned for modification 22 April 2007/ Accepted 8 August 2007


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Helicobacter pylori virulence factors have been suggested to be important in determining the outcome of infection. The H. pylori adhesion protein BabA2 is thought to play a crucial role in bacterial colonization and in induction of severe gastric inflammation, particularly in combination with expression of CagA and VacA. However, the influence of these virulence factors on the pathogenesis of H. pylori infection is still poorly understood. To address this question, the inflammatory gene expression profiles for two groups of patients infected with triple-negative strains (lacking expression of cagA, babA2, and vacAs1 but expressing vacAs2) and triple-positive strains (expressing cagA, vacAs1, and babA2 but lacking expression of vacAs2) were investigated. The gene expression patterns in the antrum gastric mucosa from patients infected with different H. pylori strains were very similar, and no differentially expressed genes could be identified by pairwise comparisons. Our data thus suggest that there is a lack of correlation between the host inflammatory responses in the gastric mucosa and expression of the babA2, cagA, and vacAs1 genes.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Helicobacter pylori infection is widespread in humans; it is present in 20 to 50% of the population in developed countries and 80% of the population in developing countries (43). Most infected individuals display only asymptomatic gastritis, whereas a small proportion develop severe disease, including peptic ulceration and gastric malignancy. Although the factors that determine the outcome of the infection are not well understood, bacterial virulence factors have been suggested to play important roles.

One of the major virulence factors of H. pylori is the vacuolating cytotoxin (VacA), which causes cytoplasmic vacuolization in gastric epithelial cells (41). Another well-characterized virulence factor is the cytotoxin-associated antigen (CagA), which is encoded by one of the genes located in the cag pathogenicity island (PAI) (8). Strains expressing vacAs1 and/or cagA are present at a higher frequency in patients with duodenal ulcers, atrophic gastritis, and gastric carcinoma (2, 5, 13, 17, 23) and are referred to as type I strains. In contrast, type II strains, which lack the cagA gene, present a nontoxic form of VacA and are considered less virulent (37, 46). The blood group antigen binding adhesin (BabA), encoded by the babA2 gene, has previously been shown to mediate adherence of H. pylori to the Lewis b blood group antigen on human gastric epithelial cells (6, 7, 19). The attachment may facilitate H. pylori colonization and efficient delivery of virulence factors such as VacA or CagA to the host cells, resulting in severe gastric inflammation. It has indeed been shown that strains with babA2, particularly when it is present together with cagA and vacAs1 (referred to as triple-positive strains here), are more often associated with duodenal ulcers and adenocarcinoma than the strains without babA2 (15). Moreover, triple-positive strains are detected more frequently in patients with severe histological alterations (35, 36, 55). These results suggest that BabA may play an important role in the pathophysiology of H. pylori infection.

However, a number of previous studies have not shown a correlation between the babA2, cagA, and vacA genotypes and peptic ulcers in populations from different regions (16, 25, 28, 29, 31, 51, 52, 54). Furthermore, although the prevalence of type I and triple-positive genotypes is high in Caucasian patients with gastritis (71 and 43%, respectively) (15), only a small proportion of these individuals develop a severe disease. Our previous study also suggested that there was no significant correlation between the presence of babA2 or cagA and the gene expression pattern in the gastric mucosa, although due to the limited number of samples available no detailed analysis of cagA, babA2, and vacAs1 triple-positive samples could be performed (45). To further investigate the effect of these virulence factors on the induction of host immune responses, the inflammatory gene profile in the gastric mucosa in a large cohort of patients infected by triple-negative and triple-positive H. pylori strains was characterized.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Study subjects. Gastric biopsies were collected from individuals who underwent gastroscopy due to dyspepsia, upper abdominal pain, or a routine check before gastric bypass surgery (obesity patients). Patients with malignancy, immunosuppression, metabolic disorders, or gastrointestinal hemorrhage and patients receiving aspirin or other nonsteroidal anti-inflammatory drugs were excluded from the study. The patients were all central European residents, and all belonged to the Caucasian population except for one recent immigrant from Asia. Multiple endoscopic biopsies were obtained from the antrum for parallel assessment of gene expression and histology. The presence of H. pylori infection was determined by histology and/or a positive rapid urease test performed on the biopsy sample. The expression of H. pylori virulence factors was detected by reverse transcription (RT)-PCR (as described below). Of the individuals studied, eight (mean age, 55.1 years) were not infected, six (mean age, 36.7 years) were infected with triple-negative H. pylori strains, and the remaining ten (mean age, 43.5 years) were infected with triple-positive strains. There was no significant difference in age between the H. pylori-infected and noninfected groups (P = 0.089). Three triple-negative and five triple-positive samples had been analyzed by using the same cDNA array previously (45). These samples were tested again in parallel with the newly collected samples in the current study, using the same batch of arrays. The Institution Review Boards at the University Hospital, Lausanne, Switzerland, and the Karolinska Institute, Stockholm, Sweden, approved the study, and informed consent was obtained from all patients.

RNA extraction. Total RNA was extracted from antrum biopsies using an RNeasy mini kit (QIAGEN, Hilden, Germany). To remove trace amounts of genomic DNA, the preparations were treated with RNase-free DNase I (QIAGEN). The RNA samples were quantified by measuring the absorbance at 260 and 280 nm, and the integrity was assessed by agarose gel electrophoresis.

Expression of H. pylori virulence factors. The expression of H. pylori-specific genes was detected by RT-PCR. Primer sequences for the 16S rRNA, RNA polymerase beta subunit (rpoB), cagA, vacAs1, vacAs2, and babA2 genes and PCR amplification conditions have been described previously (24, 45). The primers used for amplification of recombinase A (recA) and sialic acid binding adhesin (sabA) genes were designed based on the published H. pylori genomic sequences (accession no. NC-000921 and AE001439). The primer sequences are as follows: RecA-713F, 5'GCATATCGGTAATAGGGCTAA; RecA-1012R, 5'CTTCTAAAGGCTCATCGGGTAA; SabA-278F, 5'TACAACAGCACCACCCAA; and SabA-1136R, 5'CATCTTTAGCCACGCTTAA. Three micrograms of total RNA was used for cDNA synthesis with a random hexadeoxynucleotide primer [pd(N)6] using a cDNA synthesis kit (Amersham Biosciences AB, Uppsala, Sweden). Amplification was performed using 40 cycles, each consisting of 94°C for 30 s, 55°C (16S rRNA), 56°C (recA and rpoB), 58°C (sabA), or 60°C (cagA, vacA1, vacA2, and babA2) for 30 s, and 72°C for 30 s. Go Taq (Promega) was used in all the RT-PCR assays. The PCR products were analyzed on a 2% agarose gel stained with ethidium bromide, and their identities were confirmed by cloning and sequencing of selected samples.

The sensitivities of the RT-PCR assays were determined using RNA prepared from a mixture containing a known number of bacteria (H. pylori strain J99 [cagA+ vacAs1+ babA2+]) and 107 human peripheral blood lymphocytes. The order of sensitivities for detection of the H. pylori-specific genes was 16S rRNA > vacAs1/s2 > recA > babA2 > rpoB > sabA > cagA, and the detection limits were estimated to be 4, 10, 460, 1,352, 4,600, 5,400, and 10,000 bacteria/200 ng total RNA (equivalent to the amount of RNA used for each PCR), respectively.

cDNA array. Human cytokine expression arrays (version 2.0; Sigma-Genosys, Texas), which consist of 847 different cloned cDNAs representing a comprehensive collection of cytokines, chemokines, and other immunomodulatory factors and their receptors, were used for the study. Nine positive control "housekeeping" genes and six negative controls were included in the arrays.

cDNA probe preparation and membrane hybridization were performed as recommended in the kit manuals (Sigma-Genosys), as described previously (45). The cDNA microarrays were scanned using a Fuji Bio-image BAS2000 analyzer (Fuji Photo Film Co Ltd., Japan). The images and quantitative data for gene expression levels were analyzed using the Fuji Image Reader FLA-3000/3000G software. After the quantitative data had been recorded, each spot was also manually examined to avoid artifacts.

Data analysis. The strategy used for data analysis has been described previously (45). Briefly, three standards were applied. First, if the intensity of the gene was at least 2 standard deviations above the background value, the signal was considered to be a genuine signal. Second, only relative changes equal to or greater than twofold levels of gene expression were considered to represent up- or down-regulation. In addition, if the signal intensity of a gene was changed from negative (below the signal threshold) to positive, the gene was considered up-regulated, and if the signal intensity of a gene was changed from positive to negative, the gene was considered down-regulated. Finally, the absolute difference in signal intensity between two samples had to be more than 2 standard deviations above the background value. The complete array data are available from GEO (series record number GSE6143).

The normalized gene expression levels for different sample groups were also compared by the Mann-Whitney test using the SPSS software (SPSS Inc., Chicago, IL). A P value less than 0.05 was considered statistically significant. Hierarchical clustering was performed using the CLUSTER program (14), and the results were displayed using TREEVIEW (http://genome-www4.stanford.edu/MicroArray/SMD/restech.html).

Real-time PCR. First-strand cDNA synthesis was performed with a NotI-d(T)18 primer using a cDNA synthesis kit (Amersham Biosciences) and 2 µg of total RNA. The primers employed in this study were SCYB10-F (5'-CAG AAT CGA AGG CCA TCA AGA-3'), SCYB10-R (5'-GGA AGC ACT GCA TCG ATT TTG-3'), IGFBP2-F (5'-CAG AAA ACG GAG AGT GCT TGG-3'), and IGFBP2-R (5'-AAG AAG GAG CAG GTG TGG CAT-3'). Primers for amplification of the ß-actin, epithelium-derived neutrophil-activating peptide 78 (ENA-78), interleukin-8 (IL-8), complement factor 3 (C3), lactotransferrin, and Toll-like receptor 6 (TLR6) genes have been described previously (32, 45). Amplification was performed using a quantitative PCR core kit for SYBR green I (MedProbe, Oslo, Norway) and the ABI PRISM 7000 sequence detection system (PE Applied Biosystems, California). The following typical profile times used were for 40 cycles: an initial step at 95°C for 10 min, followed by 95°C for 15 s and 60°C for 1 min. The relative expression level was calculated as described previously (45).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of H. pylori virulence factors. Expression of the H. pylori virulence factor genes cagA, vacAs1/s2, and babA2 was detected directly in the gastric biopsies using RT-PCR. Four additional H. pylori-specific genes, the 16S rRNA, racA, rpoB, and sabA genes, were included as controls. The 16S rRNA and racA genes were detected in all the samples belonging to the H. pylori-positive group, thus confirming the histological results (Table 1). rpoB and sabA, which seem to be expressed at a much lower level, were detected in a majority of the samples belonging to the H. pylori-positive group (Table 1). cagA, vacAs1/s2, and babA2 were subsequently detected in selected H. pylori-positive samples. Of the 32 samples studied, 6 were infected by triple-negative strains (lacking expression of cagA, babA2, and vacAs1 but expressing vacAs2), and 10 samples were infected by triple-positive strains (expressing cagA, babA2, and vacAs1 but lacking expression of vacAs2) (Table 1). The remaining samples (data not shown) were H. pylori negative (n = 8) or infected by strains that are babA2+ vacAs2+ (n = 3), babA2+ vacAs1+ (n = 1), vacAs1+ (n = 2), vacAs2+ (n = 1), or babA2+ cagA+ vacAs1+ vacAs2+ (n = 1; potentially a mixed infection). The corresponding genotypes (cagA, vacAs1/s2, and babA2) of these strains were confirmed by the same set of PCR assays with genomic DNA obtained from the paired biopsies from selected patients.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Detection of H. pylori virulence factors by RT-PCR

 
Gene expression profile in antrum gastric mucosa. We subsequently focused on analysis of the gene expression pattern in two groups of patients with H. pylori infections, the triple-positive and triple-negative groups, where sufficient numbers of samples were available. The antrum biopsies from these patients and eight H. pylori-negative individuals were tested in parallel on an inflammatory cDNA microarray.

To characterize the overall pattern of gene expression and to group the samples, a hierarchical clustering algorithm was applied. The result is presented in Fig. 1A. Along the vertical axis, the genes analyzed are arranged as ordered by the clustering algorithm, where the genes with the most similar patterns of expression are placed adjacent to each other. Along the horizontal axis, the samples are arranged such that those with the most similar patterns of expression across all genes are placed adjacent to each other. Two main gene expression profiles could be identified based on the cluster analysis (Fig. 1B). Group I included seven of the eight H. pylori-negative samples, whereas group II contained one negative sample and all the H. pylori-positive samples. In group II, no subgroups could be assigned based on the H. pylori genotypes.


Figure 1
View larger version (54K):
[in this window]
[in a new window]

 
FIG. 1. Cluster diagram of gene expression in gastric biopsies. Each column represents one biopsy, and each row represents a single gene. The raw data from the array experiments were first normalized by using housekeeping genes and then log transformed before the cluster analysis. The mean level of gene expression in each array experiment was calculated, and the expression level of each gene relative to the mean level is shown. Green squares represent lower-than-mean levels of gene expression in the individual biopsy samples, black squares represent genes with mean levels of expression, and red squares represent higher-than-mean levels of gene expression. The color saturation reflects the magnitude of the log ratio. (A) Overview of gene expression in all the samples. (B) Expanded view of the gene clusters that were regulated by the H. pylori infection. Number signs indicate genes that were differentially expressed in the H. pylori-positive and -negative samples, using the stringent criteria described in the text. Dollar signs indicate genes overlapping with "signatures of H. pylori infection" identified by the cluster analysis described in our previous report (45). Abbreviations: ICAM-1, intracellular adhesion molecule 1; TGF-b1, transforming growth factor, ß1; MMP-7, matrix metalloproteinase 7; MMP-9, matrix metalloproteinase 9; ICAM-3, intracellular adhesion molecule 3. For explanation of other abbreviations, see the text and Table 2, footnote a.

 
Several clusters of genes were differentially expressed in biopsies from patients with H. pylori infection and biopsies from uninfected controls (Fig. 1B). The genes included genes encoding members of the IL-1R/TLR family (TLR1, TLR3, TLR4, TLR5, TLR6, and RP105 [a radioprotective 105-kDa protein]), cytokine and cytokine receptors (IL-1 RL2, IL-2 R{gamma}, IL-10 R{alpha}, IL-13 R{alpha}2, IL-16, IL-18 receptor accessory protein, gamma interferon [IFN-{gamma}] R1, IFN-{gamma} R2, and granulocyte-macrophage colony-stimulating factor Rß), complement and complement receptor (CD21 and C3), adhesion molecules (intracellular adhesion molecule 1, intracellular adhesion molecule 3, and vascular cell adhesion molecule 1), integrins (intergrin-{alpha}L, integrin-{alpha}X, integrin-ß2, and integrin-ß7), chemokines and chemokine receptors (ENA-78, contactin 1, macrophage inflammatory protein 1-beta [MIP-1ß], and MIP-3ß), a cell signaling molecule (protein kinase C, beta 1), proteinases (matrix metalloproteinase 9 and ADAM12 [a disintegrin and metalloproteinase]), and some factors that are important for B- or T-cell activation (B7-H1, GL50/B7-H1, and signal lymphocytic activation molecule). These genes largely overlap with the "H. pylori infection signature" identified by the cluster analysis in our previous report (45). The overlapping genes are indicated in Fig. 1B. Differential expression of a few additional genes, including the genes encoding IL-13 R{alpha}2, IFN-{gamma} R2, integrin-ß7, MIP-1ß, and MIP-3ß, was found in the current study.

Identification of differentially expressed genes. To further identify the genes that were differentially expressed in the H. pylori-positive and H. pylori-negative samples, pairwise analyses were subsequently performed using stringent criteria (see Materials and Methods). Each of the 16 H. pylori-positive samples was compared with each of the eight H. pylori-negative samples, resulting in 128 pairwise comparisons. If the signal intensity was higher than that in the H. pylori-negative samples (i.e., showed at least a twofold increase or a change from being undetectable to detectable) in more than 102 of the 128 (80%) comparisons, the gene was considered up-regulated. Conversely, if the expression was lower than that in the H. pylori-negative samples, the gene was considered down-regulated. As shown in Table 2, 37 genes were up-regulated in the H. pylori-infected samples, and these genes were highlighted in the expanded view of the gene cluster that was affected by the H. pylori infection (Fig. 1B) (P < 0.01). Twenty-three of the 37 genes identified in the current study overlapped with the genes described in our previous report (45), using the same criteria.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Differentially expressed genes in H. pylori-infected gastric mucosa

 
To identify the potential effects of BabA2, CagA, and VacA on gene expression in the gastric mucosa, each of the six triple-negative samples was subsequently compared with each of the eight H. pylori-negative samples, using the same stringent criteria described above. As shown in Table 2, 38 genes were up-regulated in the triple-negative samples (P < 0.01). The 10 triple-positive samples were subsequently compared with the H. pylori-negative samples, using the same method. Thirty-nine genes were up-regulated and one gene was down-regulated in the triple-positive samples (Table 2) (P < 0.01). Almost all the genes that were up-regulated in the triple-negative samples (36 of the 38 genes) overlapped with the genes that were differentially expressed in the triple-positive samples (Fig. 2). Moreover, these 36 genes overlapped completely with the 37 genes that were differentially expressed in the H. pylori-positive samples compared to the H. pylori-negative samples. This finding shows that the gene expression profiles for triple-negative and triple-positive samples are similar and corroborates our cluster analysis, where the samples were positioned on the same branch. The five genes that were not shared by the two groups (the genes encoding platelet factor 4, CD21, CD3{varepsilon}, the regulator of Fas-induced apoptosis [TOSO], and TNFRSF17) may theoretically be related to expression of the H. pylori virulence factors CagA, VacAs1, and BabA2 (Fig. 2). However, when the triple-negative and triple-positive groups were directly compared using the pairwise comparison analysis, the expression of these five genes was not significantly different for the groups. No differentially expressed gene was found, even with a less stringent standard (a 1.5-fold change in at least 75% [45 of 60] of the comparisons).


Figure 2
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 2. Pairwise analyses of gene expression in triple-negative or triple-positive samples compared with H. pylori-negative samples. The number of up-regulated genes for each comparison is shown by the overlapping circles.

 
Real-time PCR analysis of expression of selected genes. To confirm the expression data from the array hybridization, some of genes, whose expression was altered by the H. pylori infection, were analyzed by quantitative real-time RT-PCR. The up-regulation of the ENA-78, C3, lactotransferrin, and TLR6 genes was confirmed by real-time RT-PCR in our H. pylori-infected, triple-negative and triple-positive samples compared to noninfected samples (Table 3). The down-regulation of the gene encoding IGF binding protein 2 in H. pylori-infected samples could, however, not be confirmed by real-time RT-PCR (0.9-fold) (Table 3). The real-time PCR assay showed that there was a 1.9-fold increase in ENA-78 gene expression in the triple-positive samples compared to the triple-negative samples. The difference, however, was not statistically significant (P = 0.32).


View this table:
[in this window]
[in a new window]

 
TABLE 3. Real-time PCR analysis of gene expression

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the current study, the gene expression "signature" of H. pylori-infected samples broadly overlapped with the "H. pylori infection signature" in our previous report (45). A number of TLRs and their signal pathway-related factors, such as lipopolysaccharide-binding protein and RP105 (related to the proliferation response of B cells to lipopolysaccharide), were induced by H. pylori infection, suggesting that an innate immune response is evoked. Furthermore, the differentially expressed genes included the genes encoding selected chemokines and adhesion molecules that are involved in the recruitment of different inflammatory cells and may thus contribute to the activity and chronicity of gastritis.

Adherence is an important contributor to bacterial virulence, and BabA is one of the most well-studied H. pylori adhesins (1, 19). The intimate attachment of H. pylori to the gastric mucosa activates the type IV secretion system, which results in the translocation of the CagA protein into the host cells and triggers inflammation (30, 38). One study has shown that there is a significant correlation between the presence of strains carrying babA2, cagA, and vacAs1 and the development of ulcers and gastric carcinoma (15), although this has not been confirmed by other studies (16, 25, 28, 29, 31, 51, 52, 54). Triple-positive strains are also associated with a degree of granulocyte infiltration and IL-8 expression in the gastric mucosa higher than the degree in strains lacking babA2, suggesting that BabA is contributing to the severity of the inflammation (35, 36).

However, our data show that the inflammatory gene expression profiles in the gastric mucosa are similar, regardless of the presence of the babA2 gene. The effect of BabA-mediated adherence of H. pylori on the host immune response thus seems to be less important than hitherto suggested. A possible explanation may be that detection of babA2 gene expression by RT-PCR might not reflect the "true" adherence properties of bacteria (31). The diversity of the babA2 gene may result in variation in the Lewis b binding capacity among different strains (18, 34), and an in vitro Lewis b adhesion assay might therefore be required. However, except in one individual, triple-positive 3, in which the strain was isolated and its Lewis b binding ability was confirmed, we were not able to obtain clinical isolates from the individuals infected with triple-positive strains and therefore could not evaluate their Lewis b binding abilities. It should also be noted that lack of expression of the babA2 gene may not correlate to the genotype of the bacteria, as the expression of the gene can be completely inhibited by changes in the number of CT dinucleotide repeats in the 5' region during infection (9, 42). Furthermore, recombination between homologues or duplicated genes often occurs, which may result in switching off babA2 expression in order to adapt to the environment during infection (1, 42).

In our study, triple-negative and triple-positive H. pylori strains strongly induced expression of ENA-78, a member of the C-X-C chemokine family, whereas IL-8, another C-X-C chemokine previously shown to be up-regulated by H. pylori infection (10, 40), was undetectable in our microarrays. However, using real-time PCR, we could detect increased expression of IL-8 in triple-negative (7.4-fold) and triple-positive (9.5-fold) H. pylori-infected samples compared to noninfected samples. These data thus seem to contradict previous reports, which showed that IL-8 and ENA-78 were more highly expressed in triple-positive samples (36) and more dominant in cagA-positive or vacAs1-positive samples than in cagA-negative or vacAs1-negative samples (40, 50).

The cagA gene is a marker for the cag PAI. However, only 84% of the cagA-positive strains carry an entire cag PAI, suggesting that the cagA gene may not be the best marker for the presence of the cag PAI (20). Several studies have shown that most of the 31 genes of the cag PAI are required for induction of IL-8 secretion, whereas the cagA gene itself is not required (8, 11, 39). Therefore, if the cagA-negative strains possess a cag PAI, they could induce expression of IL-8. Conversely, if the cagA-positive strains lack some crucial genes within the cag PAI, the induction of IL-8 could be weakened. This may explain why expression of IL-8 was up-regulated in all the infected samples while there was no difference between the two subgroups. In addition, it was previously reported that a novel virulence factor-encoding gene, oipA (outer inflammatory protein), may be important for clinical presentation, gastric inflammation, and mucosal IL-8 production, as oipA "on" status, rather than expression of the cagA, babA2, and vacAs1 genes, was significantly associated with a high level of mucosal IL-8 expression (47, 53). However, a recent study showed that the status of oipA is not related to IL-8 expression in vitro, and the different results in the studies may be due to the use of different H. pylori strains (12).

Although many studies have shown that the presence of either cagA or vacAs1 or both is associated with a more severe inflammatory response and more pronounced pathological changes (2, 33, 35, 44, 55), there have also been a number of reports suggesting that the expression levels of some cytokines, such as IL-7, IL-10, IL-16, and tumor necrosis factor alpha (TNF-{alpha}), are independent of the presence of cagA or vacAs1 (3, 21, 22, 40, 48, 49). Moreover, it has also been shown that expression of IFN-{gamma}, TNF-{alpha}, and IL-12R ß2 was similar in biopsies from patients carrying triple-negative and biopsies from patients carrying triple-positive strains, although the latter showed a higher level of bacterial colonization and granulocyte infiltration (36). More than 90% of the strains present in East Asia are cagA vacAs1 positive, and a high prevalence of babA2 or triple-positive genotypes has been found in Western patients with gastritis (15). Yet only a small proportion of these individuals develop a severe disease. This suggests that the expression of the cagA, babA2, and vacAs1 genes is not sufficient to induce a severe gastroduodenal disease. Furthermore, the polymorphisms in genes encoding some cytokines (IL-1ß, IL-1 receptor antagonist, TNF-{alpha}, and IFN-{gamma}) have been correlated with H. pylori-associated gastric adenocarcinoma and peptic ulcers (4), suggesting that host factors and environmental factors (26, 27), such as smoking and diet, need to be considered in addition to the bacterial virulence factors.

In summary, our current data support the hypothesis that the virulence factors of H. pylori, BabA, CagA, and VacA, are not associated with a selective gene expression pattern in the infected human gastric mucosa. The importance of BabA for induction of gastric inflammation and immune responses needs to be investigated further, and a method to detect BabA-mediated adherence of the infecting strain is also needed.


    ACKNOWLEDGMENTS
 
We thank Maribelle Herranz-Garcia for her excellent help with collecting the gastric biopsies.

This work was supported by the Swedish Research Council (Q.P.-H.) and the Swiss National Science Foundation (grant 109846 to P.M.).


    FOOTNOTES
 
* Corresponding author. Mailing address: Division of Clinical Immunology, Department of Laboratory Medicine, F79, Karolinska University Hospital Huddinge, SE-141 86, Stockholm, Sweden. Phone: 46 8 52483592. Fax: 46 8 52483588. E-mail: Qiang.Pan-Hammarstrom{at}ki.se Back

{triangledown} Published ahead of print on 20 August 2007. Back

Editor: A. Camilli


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Aspholm-Hurtig, M., G. Dailide, M. Lahmann, A. Kalia, D. Ilver, N. Roche, S. Vikstrom, R. Sjostrom, S. Linden, A. Backstrom, C. Lundberg, A. Arnqvist, J. Mahdavi, U. J. Nilsson, B. Velapatino, R. H. Gilman, M. Gerhard, T. Alarcon, M. Lopez-Brea, T. Nakazawa, J. G. Fox, P. Correa, M. G. Dominguez-Bello, G. I. Perez-Perez, M. J. Blaser, S. Normark, I. Carlstedt, S. Oscarson, S. Teneberg, D. E. Berg, and T. Boren. 2004. Functional adaptation of BabA, the H. pylori ABO blood group antigen binding adhesin. Science 305:519-522.[Abstract/Free Full Text]
2. Atherton, J. C., R. M. Peek, Jr., K. T. Tham, T. L. Cover, and M. J. Blaser. 1997. Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterology 112:92-99.[CrossRef][Medline]
3. Audibert, C., B. Janvier, B. Grignon, L. Salaun, C. Burucoa, J. C. Lecron, and J. L. Fauchere. 2000. Correlation between IL-8 induction, cagA status and vacA genotypes in 153 French Helicobacter pylori isolates. Res. Microbiol. 151:191-200.[Medline]
4. Basso, D., and M. Plebani. 2004. H. pylori infection: bacterial virulence factors and cytokine gene polymorphisms as determinants of infection outcome. Crit. Rev. Clin. Lab. Sci. 41:313-337.[CrossRef][Medline]
5. Blaser, M. J., G. I. Perez-Perez, H. Kleanthous, T. L. Cover, R. M. Peek, P. H. Chyou, G. N. Stemmermann, and A. Nomura. 1995. Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Res. 55:2111-2115.[Abstract/Free Full Text]
6. Boren, T., P. Falk, K. A. Roth, G. Larson, and S. Normark. 1993. Attachment of Helicobacter pylori to human gastric epithelium mediated by blood group antigens. Science 262:1892-1895.[Abstract/Free Full Text]
7. Boren, T., S. Normark, and P. Falk. 1994. Helicobacter pylori: molecular basis for host recognition and bacterial adherence. Trends Microbiol. 2:221-228.[CrossRef][Medline]
8. Censini, S., C. Lange, Z. Xiang, J. E. Crabtree, P. Ghiara, M. Borodovsky, R. Rappuoli, and A. Covacci. 1996. cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors. Proc. Natl. Acad. Sci. USA 93:14648-14653.[Abstract/Free Full Text]
9. Colbeck, J. C., L. M. Hansen, J. M. Fong, and J. V. Solnick. 2006. Genotypic profile of the outer membrane proteins BabA and BabB in clinical isolates of Helicobacter pylori. Infect. Immun. 74:4375-4378.[Abstract/Free Full Text]
10. Crabtree, J. E., A. Covacci, S. M. Farmery, Z. Xiang, D. S. Tompkins, S. Perry, I. J. Lindley, and R. Rappuoli. 1995. Helicobacter pylori induced interleukin-8 expression in gastric epithelial cells is associated with CagA positive phenotype. J. Clin. Pathol. 48:41-45.[Abstract/Free Full Text]
11. Crabtree, J. E., Z. Xiang, I. J. Lindley, D. S. Tompkins, R. Rappuoli, and A. Covacci. 1995. Induction of interleukin-8 secretion from gastric epithelial cells by a cagA negative isogenic mutant of Helicobacter pylori. J. Clin. Pathol. 48:967-969.[Abstract/Free Full Text]
12. Dossumbekova, A., C. Prinz, J. Mages, R. Lang, J. G. Kusters, A. H. Van Vliet, W. Reindl, S. Backert, D. Saur, R. M. Schmid, and R. Rad. 2006. Helicobacter pylori HopH (OipA) and bacterial pathogenicity: genetic and functional genomic analysis of hopH gene polymorphisms. J. Infect. Dis. 194:1346-1355.[CrossRef][Medline]
13. Eck, M., B. Schmausser, R. Haas, A. Greiner, S. Czub, and H. K. Muller-Hermelink. 1997. MALT-type lymphoma of the stomach is associated with Helicobacter pylori strains expressing the CagA protein. Gastroenterology 112:1482-1486.[CrossRef][Medline]
14. Eisen, M. B., P. T. Spellman, P. O. Brown, and D. Botstein. 1998. Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95:14863-14868.[Abstract/Free Full Text]
15. Gerhard, M., N. Lehn, N. Neumayer, T. Boren, R. Rad, W. Schepp, S. Miehlke, M. Classen, and C. Prinz. 1999. Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin. Proc. Natl. Acad. Sci. USA 96:12778-12783.[Abstract/Free Full Text]
16. Graham, D. Y., R. M. Genta, D. P. Graham, and J. E. Crabtree. 1996. Serum CagA antibodies in asymptomatic subjects and patients with peptic ulcer: lack of correlation of IgG antibody in patients with peptic ulcer or asymptomatic Helicobacter pylori gastritis. J. Clin. Pathol. 49:829-832.[Abstract/Free Full Text]
17. Hamlet, A., A. C. Thoreson, O. Nilsson, A. M. Svennerholm, and L. Olbe. 1999. Duodenal Helicobacter pylori infection differs in cagA genotype between asymptomatic subjects and patients with duodenal ulcers. Gastroenterology 116:259-268.[CrossRef][Medline]
18. Hennig, E. E., R. Mernaugh, J. Edl, P. Cao, and T. L. Cover. 2004. Heterogeneity among Helicobacter pylori strains in expression of the outer membrane protein BabA. Infect. Immun. 72:3429-3435.[Abstract/Free Full Text]
19. Ilver, D., A. Arnqvist, J. Ogren, I. M. Frick, D. Kersulyte, E. T. Incecik, D. E. Berg, A. Covacci, L. Engstrand, and T. Boren. 1998. Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging. Science 279:373-377.[Abstract/Free Full Text]
20. Jenks, P. J., F. Megraud, and A. Labigne. 1998. Clinical outcome after infection with Helicobacter pylori does not appear to be reliably predicted by the presence of any of the genes of the cag pathogenicity island. Gut 43:752-758.[Abstract/Free Full Text]
21. Kim, J. M., J. S. Kim, H. C. Jung, I. S. Song, and C. Y. Kim. 2000. Virulence factors of Helicobacter pylori in Korean isolates do not influence proinflammatory cytokine gene expression and apoptosis in human gastric epithelial cells, nor do these factors influence the clinical outcome. J. Gastroenterol. 35:898-906.[CrossRef][Medline]
22. Kranzer, K., L. Sollner, M. Aigner, N. Lehn, L. Deml, M. Rehli, and W. Schneider-Brachert. 2005. Impact of Helicobacter pylori virulence factors and compounds on activation and maturation of human dendritic cells. Infect. Immun. 73:4180-4189.[Abstract/Free Full Text]
23. Kuipers, E. J., G. I. Perez-Perez, S. G. Meuwissen, and M. J. Blaser. 1995. Helicobacter pylori and atrophic gastritis: importance of the cagA status. J. Natl. Cancer Inst. 87:1777-1780.[Abstract/Free Full Text]
24. Lim, C. Y., K. H. Lee, M. J. Cho, M. W. Chang, S. Y. Kim, N. H. Myong, W. K. Lee, K. H. Rhee, and Y. H. Kook. 2003. Detection of Helicobacter pylori in gastric mucosa of patients with gastroduodenal diseases by PCR-restriction analysis using the RNA polymerase gene (rpoB). J. Clin. Microbiol. 41:3387-3391.[Abstract/Free Full Text]
25. Loeb, M., P. Jayaratne, N. Jones, A. Sihoe, and P. Sherman. 1998. Lack of correlation between vacuolating cytotoxin activity, cagA gene in Helicobacter pylori, and peptic ulcer disease in children. Eur. J. Clin. Microbiol. Infect. Dis. 17:653-656.[Medline]
26. Lunet, N., and H. Barros. 2003. Helicobacter pylori infection and gastric cancer: facing the enigmas. Int. J. Cancer. 106:953-960.[CrossRef][Medline]
27. Machida-Montani, A., S. Sasazuki, M. Inoue, S. Natsukawa, K. Shaura, Y. Koizumi, Y. Kasuga, T. Hanaoka, and S. Tsugane. 2004. Association of Helicobacter pylori infection and environmental factors in non-cardia gastric cancer in Japan. Gastric Cancer 7:46-53.[CrossRef][Medline]
28. Mattar, R., A. F. dos Santos, J. N. Eisig, T. N. Rodrigues, F. M. Silva, R. M. Lupinacci, K. Iriya, and F. J. Carrilho. 2005. No correlation of babA2 with vacA and cagA genotypes of Helicobacter pylori and grading of gastritis from peptic ulcer disease patients in Brazil. Helicobacter 10:601-608.[CrossRef][Medline]
29. Mizushima, T., T. Sugiyama, Y. Komatsu, J. Ishizuka, M. Kato, and M. Asaka. 2001. Clinical relevance of the babA2 genotype of Helicobacter pylori in Japanese clinical isolates. J. Clin. Microbiol. 39:2463-2465.[Abstract/Free Full Text]
30. Odenbreit, S., J. Puls, B. Sedlmaier, E. Gerland, W. Fischer, and R. Haas. 2000. Translocation of Helicobacter pylori CagA into gastric epithelial cells by type IV secretion. Science 287:1497-1500.[Abstract/Free Full Text]
31. Olfat, F. O., Q. Zheng, M. Oleastro, P. Voland, T. Boren, R. Karttunen, L. Engstrand, R. Rad, C. Prinz, and M. Gerhard. 2005. Correlation of the Helicobacter pylori adherence factor BabA with duodenal ulcer disease in four European countries. FEMS Immunol. Med. Microbiol. 44:151-156.[CrossRef][Medline]
32. Pan-Hammarstrom, Q., S. Wen, and L. Hammarstrom. 2006. Cytokine gene expression profiles in human lymphocytes induced by a formula of traditional Chinese medicine, vigconic VI-28. J. Interferon Cytokine Res. 26:628-636.[CrossRef][Medline]
33. Peek, R. M., Jr., S. F. Moss, K. T. Tham, G. I. Perez-Perez, S. Wang, G. G. Miller, J. C. Atherton, P. R. Holt, and M. J. Blaser. 1997. Helicobacter pylori cagA+ strains and dissociation of gastric epithelial cell proliferation from apoptosis. J. Natl. Cancer Inst. 89:863-868.[Abstract/Free Full Text]
34. Pride, D. T., R. J. Meinersmann, and M. J. Blaser. 2001. Allelic variation within Helicobacter pylori babA and babB. Infect. Immun. 69:1160-1171.[Abstract/Free Full Text]
35. Prinz, C., M. Schoniger, R. Rad, I. Becker, E. Keiditsch, S. Wagenpfeil, M. Classen, T. Rosch, W. Schepp, and M. Gerhard. 2001. Key importance of the Helicobacter pylori adherence factor blood group antigen binding adhesin during chronic gastric inflammation. Cancer Res. 61:1903-1909.[Abstract/Free Full Text]
36. Rad, R., M. Gerhard, R. Lang, M. Schoniger, T. Rosch, W. Schepp, I. Becker, H. Wagner, and C. Prinz. 2002. The Helicobacter pylori blood group antigen-binding adhesin facilitates bacterial colonization and augments a nonspecific immune response. J. Immunol. 168:3033-3041.[Abstract/Free Full Text]
37. Rudi, J., C. Kolb, M. Maiwald, D. Kuck, A. Sieg, P. R. Galle, and W. Stremmel. 1998. Diversity of Helicobacter pylori vacA and cagA genes and relationship to VacA and CagA protein expression, cytotoxin production, and associated diseases. J. Clin. Microbiol. 36:944-948.[Abstract/Free Full Text]
38. Segal, E. D., C. Lange, A. Covacci, L. S. Tompkins, and S. Falkow. 1997. Induction of host signal transduction pathways by Helicobacter pylori. Proc. Natl. Acad. Sci. USA 94:7595-7599.[Abstract/Free Full Text]
39. Sharma, S. A., M. K. Tummuru, G. G. Miller, and M. J. Blaser. 1995. Interleukin-8 response of gastric epithelial cell lines to Helicobacter pylori stimulation in vitro. Infect. Immun. 63:1681-1687.[Abstract]
40. Shimoyama, T., S. M. Everett, M. F. Dixon, A. T. Axon, and J. E. Crabtree. 1998. Chemokine mRNA expression in gastric mucosa is associated with Helicobacter pylori cagA positivity and severity of gastritis. J. Clin. Pathol. 51:765-770.[Abstract]
41. Smoot, D. T., J. H. Resau, M. H. Earlington, M. Simpson, and T. L. Cover. 1996. Effects of Helicobacter pylori vacuolating cytotoxin on primary cultures of human gastric epithelial cells. Gut 39:795-799.[Abstract/Free Full Text]
42. Solnick, J. V., L. M. Hansen, N. R. Salama, J. K. Boonjakuakul, and M. Syvanen. 2004. Modification of Helicobacter pylori outer membrane protein expression during experimental infection of rhesus macaques. Proc. Natl. Acad. Sci. USA 101:2106-2111.[Abstract/Free Full Text]
43. Suerbaum, S., and P. Michetti. 2002. Helicobacter pylori infection. N. Engl. J. Med. 347:1175-1186.[Free Full Text]
44. Weel, J. F., R. W. van der Hulst, Y. Gerrits, P. Roorda, M. Feller, J. Dankert, G. N. Tytgat, and A. van der Ende. 1996. The interrelationship between cytotoxin-associated gene A, vacuolating cytotoxin, and Helicobacter pylori-related diseases. J. Infect. Dis. 173:1171-1175.[Medline]
45. Wen, S., C. P. Felley, H. Bouzourene, M. Reimers, P. Michetti, and Q. Pan-Hammarstrom. 2004. Inflammatory gene profiles in gastric mucosa during Helicobacter pylori infection in humans. J. Immunol. 172:2595-2606.[Abstract/Free Full Text]
46. Xiang, Z., S. Censini, P. F. Bayeli, J. L. Telford, N. Figura, R. Rappuoli, and A. Covacci. 1995. Analysis of expression of CagA and VacA virulence factors in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that CagA is not necessary for expression of the vacuolating cytotoxin. Infect. Immun. 63:94-98.[Abstract]
47. Yamaoka, Y., S. Kikuchi, H. M. el-Zimaity, O. Gutierrez, M. S. Osato, and D. Y. Graham. 2002. Importance of Helicobacter pylori oipA in clinical presentation, gastric inflammation, and mucosal interleukin 8 production. Gastroenterology 123:414-424.[CrossRef][Medline]
48. Yamaoka, Y., M. Kita, T. Kodama, N. Sawai, and J. Imanishi. 1996. Helicobacter pylori cagA gene and expression of cytokine messenger RNA in gastric mucosa. Gastroenterology 110:1744-1752.[CrossRef][Medline]
49. Yamaoka, Y., M. Kita, T. Kodama, N. Sawai, K. Kashima, and J. Imanishi. 1997. Induction of various cytokines and development of severe mucosal inflammation by cagA gene positive Helicobacter pylori strains. Gut 41:442-451.[Abstract/Free Full Text]
50. Yamaoka, Y., M. Kita, T. Kodama, N. Sawai, T. Tanahashi, K. Kashima, and J. Imanishi. 1998. Chemokines in the gastric mucosa in Helicobacter pylori infection. Gut 42:609-617.[Abstract/Free Full Text]
51. Yamaoka, Y., T. Kodama, O. Gutierrez, J. G. Kim, K. Kashima, and D. Y. Graham. 1999. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J. Clin. Microbiol. 37:2274-2279.[Abstract/Free Full Text]
52. Yamaoka, Y., T. Kodama, M. Kita, J. Imanishi, K. Kashima, and D. Y. Graham. 1998. Relationship of vacA genotypes of Helicobacter pylori to cagA status, cytotoxin production, and clinical outcome. Helicobacter 3:241-253.[CrossRef][Medline]
53. Yamaoka, Y., D. H. Kwon, and D. Y. Graham. 2000. A Mr 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori. Proc. Natl. Acad. Sci. USA 97:7533-7538.[Abstract/Free Full Text]
54. Yamaoka, Y., J. Souchek, S. Odenbreit, R. Haas, A. Arnqvist, T. Boren, T. Kodama, M. S. Osato, O. Gutierrez, J. G. Kim, and D. Y. Graham. 2002. Discrimination between cases of duodenal ulcer and gastritis on the basis of putative virulence factors of Helicobacter pylori. J. Clin. Microbiol. 40:2244-2246.[Abstract/Free Full Text]
55. Zambon, C. F., F. Navaglia, D. Basso, M. Rugge, and M. Plebani. 2003. Helicobacter pylori babA2, cagA, and s1 vacA genes work synergistically in causing intestinal metaplasia. J. Clin. Pathol. 56:287-291.[Abstract/Free Full Text]


Infection and Immunity, November 2007, p. 5118-5126, Vol. 75, No. 11
0019-9567/07/$08.00+0     doi:10.1128/IAI.00334-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
IAI.00334-07v1
75/11/5118    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wen, S.
Right arrow Articles by Pan-Hammarström, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wen, S.
Right arrow Articles by Pan-Hammarström, Q.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals