This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Forest, C.
Right arrow Articles by Daigle, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Forest, C.
Right arrow Articles by Daigle, F.

 Previous Article  |  Next Article 

Infection and Immunity, November 2007, p. 5264-5271, Vol. 75, No. 11
0019-9567/07/$08.00+0     doi:10.1128/IAI.00674-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Contribution of the stg Fimbrial Operon of Salmonella enterica Serovar Typhi during Interaction with Human Cells{triangledown}

Chantal Forest,1 Sébastien P. Faucher,1 Katherine Poirier,1 Sébastien Houle,2 Charles M. Dozois,2 and France Daigle1*

Department of Microbiology and Immunology, University of Montreal, C.P. 6128 Succursale Centre-Ville, Montréal, Québec, Canada H3C 3J7,1 INRS-Institut Armand-Frappier, 531 boul. des Prairies, Laval, Québec, Canada H7V 1B72

Received 15 May 2007/ Returned for modification 29 June 2007/ Accepted 7 August 2007


arrow
ABSTRACT
 
Salmonella serovars contain a wide variety of putative fimbrial systems that may contribute to colonization of specific niches. Salmonella enterica serovar Typhi is the etiologic agent of typhoid fever and is a pathogen specific to humans. In a previous study, we identified a gene, STY3920 (stgC), encoding the predicted usher of the stg fimbrial operon, that was expressed by serovar Typhi during infection of human macrophages. The stg genes are located in the glmS-pstS intergenic region in serovar Typhi and certain Escherichia coli strains, but they are absent in other S. enterica serovars. We cloned the stg fimbrial operon into a nonfimbriate E. coli K-12 strain and into S. enterica serovar Typhimurium. We demonstrated that the stg fimbrial operon contributed to increased adherence to human epithelial cells. Transcriptional fusion assays with serovar Typhi suggested that stg is preferentially expressed in minimal medium. Deletion of stg reduced adherence of serovar Typhi to epithelial cells. However, deletion of stg increased uptake of serovar Typhi by human macrophages, and overexpression of stg in serovar Typhi and serovar Typhimurium strains reduced phagocytosis by human macrophages. These strains survived inside macrophages as well as the wild-type parent. Although the stgC gene contains a premature stop codon that disrupts the expected open reading frame encoding the usher and is therefore considered a pseudogene, our results show that the stg operon may encode a functional fimbria. Thus, this serovar Typhi-specific fimbrial operon contributes to interactions with host cells, and further characterization is important for understanding the role of the stg fimbrial cluster in typhoid fever pathogenesis.


arrow
INTRODUCTION
 
The genus Salmonella is composed of two species, Salmonella bongori and Salmonella enterica. S. enterica comprises more than 2,400 serovars (11) and has been divided into seven subspecies (19). Subspecies I contains S. enterica serovars Typhi and Typhimurium and most of the other serovars that cause diseases in humans and other warm-blooded animals. Some serovars, such as serovar Typhimurium, cause disease in a variety of animals, whereas other serovars, such as serovar Typhi, cause disease in only one or a few species. Serovar Typhi is a human-specific pathogen and the etiologic agent of typhoid fever, a systemic disease, whereas serovar Typhimurium causes localized gastroenteritis in most cases of human infection. In spite of a high degree of genome homology (>90%) between serovars Typhi and Typhimurium (22, 29), the difference in the types of diseases that these serovars cause in humans, systemic and localized, respectively, suggests that one difference between these pathovars might be in the way that these closely related pathogens interact with host cells. Each of these serovars might produce or secrete distinct molecules that contribute to differences in tissue tropism. The genomes of Salmonella serovars Typhi and Typhimurium were completed and compared previously (22, 29). The serovar Typhi strain CT18 genome contains 601 genes located in 82 unique genomic regions that are absent from the serovar Typhimurium strain LT-2 genome (29). Thus, it is likely that serovar Typhi possesses unique genetic information that may be important for systemic spread and survival in the human host. The largest unique region in serovar Typhi is 134 kb long and was designated Salmonella pathogenicity island 7 (SPI-7). SPI-7 harbors the viaB locus encoding the Vi antigen, which is used in the current conjugated vaccine (17). Vi is a polysaccharide capsule involved in preventing interleukin-8 production, thus reducing neutrophil influx in the intestine (31, 33). The pil genes coding for type IV pili facilitate bacterial entry into human epithelial cells and are also located on SPI-7 (43).

After ingestion, serovar Typhi is transported to the intestinal lumen, where it adheres to and invades the small intestine. Bacteria are taken up by mononuclear cells in the intestinal lymphoid tissue, drain into the general circulation, and spread to the spleen and liver. After replication, a large number of bacteria are released into the bloodstream, which coincides with the onset of typhoid fever symptoms. In chronic carriers, bacteria can persist in the mesenteric lymph nodes, bone marrow, spleen, and gall bladder for the life of the patient. Many virulence factors may be needed and expressed during the course of infection.

Adhesion to host cells and mucosal surfaces is often considered an essential step because it allows bacteria to initiate colonization. Fimbriae or pili and other surface molecules mediate adherence via specific receptors on host cell surfaces. Genes encoding a wide variety of putative fimbriae are present in Salmonella serovars, but only a few Salmonella fimbriae have been characterized so far. These putative fimbriae may confer different binding specificities required at different steps of the infection and may be involved in host adaptation by conferring the ability to bind to specific host cells. The genome sequence of serovar Typhi contains 13 putative operons corresponding to fimbrial gene sequences, designated bcf, csg (agf), fim, saf, sef, sta, stb, stc, std, ste, stg, sth, and tcf, as well as pil coding for the type IV pili (29). Five of these operons, sef, sta, ste, stg, and tcf, and the type IV pili were not detected in serovar Typhimurium (29). In a previous study, we determined that STY3920 (stgC), a gene encoding the usher of the putative stg fimbrial operon, is absent in serovar Typhimurium and is expressed by serovar Typhi during infection of human macrophages (6). stgC contains a premature stop codon that disrupts the predicted open reading frame (ORF) encoding the usher, and it is therefore considered a pseudogene. As similar fimbrial clusters in Escherichia coli also contain genes with premature stop codons and have functional roles (7, 14, 26, 37), we hypothesized that the stg operon may encode functional fimbriae that contribute to the interaction of serovar Typhi with human cells. In this study, we cloned and characterized the stg fimbrial operon and demonstrated its role in adhesion to epithelial cells and phagocytosis by macrophages.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, media, and growth conditions. Bacterial strains and plasmids used in this study are listed in Table 1. Bacteria were routinely grown in Luria-Bertani (LB) broth at 37°C, unless indicated otherwise. When required, antibiotics, amino acids, or supplements were added at the following concentrations: kanamycin, ampicillin, and diaminopimelic acid (DAP), 50 µg/ml; chloramphenicol, 34 µg/ml; and tryptophan, cysteine, and arginine, 22 µg/ml. Transformation of bacterial strains was routinely done by using the calcium/manganese-based or electroporation method as described previously (27).


View this table:
[in this window]
[in a new window]

  		TABLE 1. Bacterial strains and plasmids used in this study

Cloning of the stg fimbrial operon. The stg operon was amplified from genomic DNA of strain ISP1820 using the Elongase enzyme mixture (Invitrogen) with primer StgA-F (5'CGGGATCCGAGATGAGAATAACGGAATA-3') containing a BamHI restriction site (underlined) and primer StgD-R (5'GCTCTAGACATTGATATGACTTATTTTG-3') containing an XbaI restriction site (underlined). The 5-kb PCR product was purified and cloned into vector pCR2.1 using a TOPOXL PCR cloning kit (Invitrogen), resulting in plasmid pSIF018. The XbaI-HindIII fragment was subcloned into low-copy-number vector pWSK29 at the same restriction sites, resulting in plasmid pSIF026. The different constructs were transformed into the nonfimbriate E. coli K-12 {Delta}fim mutant strain ORN172 (42) or into S. enterica serovar Typhimurium and Typhi strains.

Adherence to human epithelial cells. The ability of E. coli strain ORN172 containing the stg operon (pSIF018) or only the vector (pCR2.1) to adhere to human epithelial cells (INT-407) was assessed. A total of 2.5 x 105 cells grown in minimal essential medium (Wysent) supplemented with 10% heat-inactivated fetal calf serum (Wysent) and 25 mM HEPES (Wysent) were seeded in 24-well tissue culture plates 24 h before the adherence assays. One hour before infection, cells were washed three times with prewarmed phosphate-buffered saline (PBS) (pH 7.4), and fresh complete medium was added to each well. Bacteria were grown overnight on LB medium plates and were resuspended in PBS to an optical density at 600 nm (OD600) of 1.5 (~1.5 x 109 CFU/ml). Approximately 2.5 x 107 CFU was added to each well (multiplicity of infection [MOI], 100). The 24-well plates were then centrifuged at 1,000 x g for 5 min to synchronize infection, incubated at 37°C in 5% CO2 for 90 min, and rinsed three times with PBS. PBS-0.1% deoxycholic acid sodium salt was added to each well, and samples were diluted and spread on LB medium plates for enumeration by viable colony counting. The results were expressed as the percentage of the initial inoculum. Statistical differences were assessed using Student's t test.

A similar protocol was used to test adherence of Salmonella and/or the isogenic stg mutant strains to INT-407 cells, except that bacteria were grown overnight without shaking in LB medium containing 0.3 M NaCl and an MOI of 20 was used. When indicated below, an additional 90-min incubation with 100 µg/ml gentamicin to kill extracellular bacteria was performed in order to assess the invasion level.

Generation of a single-copy stgA-lacZ transcriptional fusion and ß-galactosidase assay. The stgA promoter region was amplified using the Elongase enzyme mixture (Invitrogen) and the following primers: StgA-F and StgA-R (5'AACTGCAGCCAGCAAATGCCGTTTTGTT3'). The PCR product was cloned into vector pCR2.1 using a TOPOXL PCR cloning kit (Invitrogen), resulting in plasmid pSIF016. A 530-bp fragment digested with XbaI and SpeI was purified and ligated to pFUSE digested with XbaI (2), resulting in plasmid pSIF020. Plasmid pSIF020 was confirmed to contain the stgA promoter in the correct orientation for lacZ fusion. To generate a single copy of the PstgA-lacZ fusion in serovar Typhi, pSIF020 was transferred by conjugation and integrated into the genome by homologous recombination as described previously (2, 3). A strain carrying a single integrated copy of PstgA-lacZ in ISP1820 was designated DEF068. The expression of stg was evaluated by ß-galactosidase assays of the reporter strain DEF068 grown in different conditions. ß-Galactosidase activity was measured using o-nitrophenyl-ß-D-galactopyranoside as described previously (23).

Construction of a serovar Typhi strain with an stg deletion. A suicide vector for deletion of the stg fimbrial operon (STY3918 to STY3922) was constructed as follows. A 530-bp fragment of the 5' end of stgA was generated by PCR using primers StgA-F and StgA-R, and a 482-bp fragment of the 3' end of stgD was generated by PCR using primers StgD-F (5'AACTGCAGGCCGCAGAGCTGTGAAAATG3') and StgD-R. These two fragments were ligated and cloned into the XbaI and BamHI sites of pMEG-375 (15). A resulting suicide vector containing the stgA'-stgD' fragment (pSIF004) was used for allelic replacement of the stg region. The pSIF004 suicide vector was conjugated from E. coli MGN-617 to serovar Typhi strain ISP1820 by overnight plate mating on LB medium with DAP. Transconjugants were selected by growth on LB medium plates containing chloramphenicol without DAP. Selection for double-crossover allele replacement was performed by sacB counterselection on LB agar plates without NaCl containing 5% sucrose (16). Isogenic strain DEF004 has a deletion of the stg region resulting from a double crossover, as determined by the absence of resistance to ampicillin and chloramphenicol encoded on the suicide vector, and the expected stg deletion, as confirmed by PCR (data not shown).

Bacterial survival in human macrophages. The human monocyte cell lines THP-1 (= ATCC TIB-202) and U937 (= ATCC CRL 1593) were maintained in RPMI 1640 (Invitrogen) containing 10% fetal calf serum, 25 mM HEPES, 2 mM L-glutamine, 1% minimal essential medium nonessential amino acids (Wisent), and 1 mM sodium pyruvate (Sigma). Stock cultures of these cells were maintained as monocyte-like, nonadherent cells at 37°C in an atmosphere containing 5% CO2. Before infection, cells were differentiated by addition of 10–7 M phorbol 12-myristate 13-acetate (Sigma) for 24 to 72 h. For macrophage infection assays, cells were seeded at a concentration of 5 x 105 cells per well in 24-well tissue culture dishes. Bacteria grown overnight at 37°C in static conditions were added to a cell monolayer at an MOI of 10 and centrifuged for 5 min at 1,000 x g to synchronize phagocytosis. After incubation for 20 min at 37°C (zero time), the infected cells were washed three times with prewarmed PBS and incubated with supplemented medium as described above containing 100 µg/ml of gentamicin to kill extracellular bacteria. The infected monolayers were either lysed from the tissue culture dishes by addition of 0.1% deoxycholic acid sodium salt in PBS or incubated further. After lysis the number of surviving bacteria was determined by bacterial plate counting (CFU). The level of phagocytosis was expressed as a percentage of the initial inoculum. The survival rate was expressed as a percentage determined by comparing the number of intracellular bacteria with the number at the previous time.

Statistical differences were assessed using Student's t test. Where indicated, the macrophages were incubated 1 h prior to infection with 1 µg/ml of cytochalasin D (Sigma) to inhibit bacterial uptake as described previously (32). The level of cytochalasin D was maintained throughout the infection.


arrow
RESULTS
 
stg fimbrial operon. The stg fimbrial cluster has a G+C content of 49% and is a member of a distinct group of related fimbrial genes that are located in the glmS-pstS intergenic region (21, 39). In the sequenced genomes of S. enterica (including unfinished genomes) this fimbrial gene cluster has been identified only in serovar Typhi. Moreover, stg sequences were not detected by comparative genomic hybridization in the genomes of 140 strains belonging to many serovars of subspecies I (30; M. McClelland, personal communication). The previously described distribution of stg determined by Southern blotting may therefore represent cross-hybridization with other less homologous fimbrial genes (39). However, a putative fimbrial gene inserted in the glmS-pstS region in S. bongori belongs to the Stg group, and its product exhibits the highest level of identity to the predicted stg fimbrial gene products of serovar Typhi (Table 2). The genes encoding a number of fimbrial systems in pathogenic E. coli are also inserted in the glmS-pstS region and belong to the Stg group; these systems include the Stg (21), LpfO113 (5), and Lpf2 (O-island 154) (38) systems. In addition, Lpf and related fimbriae encoded in the yhjX-yhjW region in Salmonella and E. coli (36, 37) exhibit some identity to the predicted stg gene products of serovar Typhi, but less identity than other fimbriae belonging to the Stg group (Table 2). The serovar Typhi stg fimbrial cluster contains five ORFs designated stgABCC'D as stgC is a predicted pseudogene and contains a premature stop codon. The stgC ORF may code for a 170-amino-acid (aa) protein, and a second ORF designated stgC' may code for a 605-aa protein. The stgC stop codon is present in the stgC sequence of serovar Typhi strain ISP1820 (data not shown), as well as in the sequenced genomes of serovar Typhi strains TY2 and CT18 (4, 29).


View this table:
[in this window]
[in a new window]

  		TABLE 2. Comparison of the stg fimbrial gene products of Salmonella serovar Typhi with other fimbrial systemsa

Adhesion of E. coli containing the stg operon. To examine the capacity of the stg fimbrial cluster to mediate adherence to INT-407 cells, the stg operon was cloned in different vectors and transformed into E. coli strain ORN172. ORN172 is an E. coli K-12 noninvasive strain with a deletion in the fim operon that does not express type 1 fimbriae and is commonly used to study adherence conferred by recombinant fimbrial systems (42). E. coli ORN172 cells containing the vector alone (pCR2.1) adhered poorly between the cells or without pattern on the cell surface and were often isolated (Fig. 1A). However, ORN172 cells containing stg (pSIF018) adhered in aggregates or clusters on the cell surface (Fig. 1B). The introduction of stg into E. coli conferred a significantly higher level of adhesion to epithelial cells, which was threefold higher than that of the strain harboring the vector alone (Fig. 1C). A higher level of adhesion was also observed when a low-copy-number vector (pSIF026) was used (data not shown).


Figure 1
View larger version (39K):
[in this window]
[in a new window]

  		FIG. 1. Adherence and expression of the stg fimbrial operon by E. coli and S. enterica serovar Typhimurium. (A and B) Adherence of E. coli strain ORN172 to human epithelial cells (INT-407) containing the vector (pCR2.1) (DEF045) (A) or the stg genes (pSIF018) (DEF049) (B). Slides were stained with 5% Giemsa stain. Bacteria are indicated by arrows. (C) Percentage of the initial inoculum associated with epithelial cells after 90 min of incubation for E. coli and serovar Typhimurium carrying the stg operon (DEF047) or the control vector (DEF048). All assays were conducted in duplicate and repeated independently at least three times. The results are expressed as the means ± standard errors of the replicate experiments. An asterisk indicates that there is a significant difference between the strain containing the control vector and the strain containing the stg operon (P < 0.005).

Adhesion of serovar Typhimurium containing the stg operon. As the stg fimbrial operon is absent in serovar Typhimurium, we used this serovar to establish whether stg could contribute to adherence to INT-407 cells by a heterogeneous Salmonella serovar. Serovar Typhimurium strain {chi}3339 harboring stg (pSIF018) exhibited a significantly higher level of adhesion to INT-407 cells, which was 30-fold higher than that of the strain harboring the vector alone (pCR2.1) (Fig. 1C). As salmonellae are able to invade epithelial cells, the level of invasion was also determined by a gentamicin protection assay. An invasion level similar to that exhibited by the wild-type parent harboring only the vector was observed (data not shown).

stg expression in serovar Typhi. To study the expression of the stg fimbrial operon in the native serovar Typhi strain, an stgA::lacZ fusion was inserted into the chromosome of strain ISP1820, generating strain DEF068. Strain DEF068 was used to determine the influence of a number of in vitro growth conditions on stg expression. The expression of the promoter fusion was determined for bacteria grown in LB medium from early log phase to stationary phase. ß-Galactosidase expression increased from early to stationary phase, following overnight growth in LB medium (Fig. 2). The ß-galactosidase expression following growth on LB agar was nearly twofold higher (54 U) than the expression following overnight growth in LB broth (29 U) (Fig. 2). The highest levels of ß-galactosidase expression were observed following overnight growth in minimal medium (M9-glucose) (76 U) (Fig. 2). Expression in conditions that mimic those encountered during invasion and infection of host cells was also studied. The effect of the sodium chloride concentration in the medium was evaluated, as this concentration represents a condition that can influence cell invasion by Salmonella (1, 8). The effect of iron availability and pH on stg expression was also evaluated. Changes in these conditions did not result in any significant changes in ß-galactosidase expression (data not shown).


Figure 2
View larger version (10K):
[in this window]
[in a new window]

  		FIG. 2. stg expression in serovar Typhi: ß-galactosidase activity expressed from the PstgA::lacZ fusion in serovar Typhi (DEF068) in different growth conditions. Bacteria were grown in LB medium with agitation to early log phase (OD600, 0.3), mid-log phase (OD600, 0.6), late log phase (OD600, 0.9), and stationary phase (overnight), on LB agar, and in M9-glucose broth (M9 min broth) (overnight). The error bars indicate standard deviations.

stg contributes to adherence of serovar Typhi to epithelial cells. We assessed whether stg contributes to adherence of serovar Typhi to INT-407 cells by constructing an isogenic {Delta}stgABCC'D mutant by allelic exchange. The mutated strain, DEF004, exhibited a significantly lower level of adherence (80% of the wild-type strain adherence) (Fig. 3A). A level of adherence significantly higher than that of the wild-type strain was observed when the stg mutant was complemented with the stg genes on a low-copy-number vector (pSIF026) (Fig. 3A). In spite of the lower level of adherence of the mutant, its level of invasion was higher than that of the wild-type parent, but not significantly higher (Fig. 3A).


Figure 3
View larger version (24K):
[in this window]
[in a new window]

  		FIG. 3. Role of stg in the interaction of serovar Typhi with human cells: capacity of the wild-type strain, the stg mutant (DEF004), and the complemented strain (DEF066) to adhere to and invade INT-407 cells (A) or to survive within THP-1 macrophage-like cells (B). All assays were conducted in duplicate and repeated independently at least three times. The results are expressed as the means ± standard errors of the replicate experiments. Significant differences (P < 0.005) in adherence or phagocytosis between the mutant and the wild-type strain of serovar Typhi are indicated by asterisks. The values for percent recovery were normalized to the wild-type control value, which was defined as 100% at each time point.

Loss of stg results in increased phagocytosis of serovar Typhi by macrophages. As survival in macrophages plays an essential role in systemic infection by Salmonella, we characterized the interaction of the isogenic stg mutant with human macrophages. The wild-type strain and the mutant were used to infect human macrophage-like cells, and the numbers of bacteria present after phagocytosis at 2 and 24 h postinfection were determined. The mutant showed a significantly higher level of phagocytosis than the wild-type strain (Fig. 3B). The levels of bacterial survival at 2 or 24 h postinfection were similar for both the stg mutant and the wild-type strain (Fig. 3B). Complementation of the stg mutant with stg on a low-copy-number vector (pSIF026) restored the wild-type phagocytosis phenotype (Fig. 3B).

Role of stg in macrophage interactions. As bacterial uptake of the stg mutant by macrophages was altered, we wanted to evaluate the effect of stg overexpression on phagocytosis. The uptake of both serovar Typhi strain ISP1820 and serovar Typhimurium strain {chi}3339 harboring stg (pSIF018) on a multicopy vector was significantly lower than the uptake of the bacterial strain harboring the vector alone (pCR2.1) (Fig. 4). This lower level of phagocytosis was also observed using macrophage-like U937 cells (data not shown). Then, in order to differentiate between the initial levels of bacteria associated with or internalized by macrophages, we used an inhibitor of cytoskeletal function, cytochalasin D, to block bacterial uptake. In the presence of cytochalasin D, less then 2% of the initial inoculum was associated with macrophages. The percentages of serovar Typhi that were associated with macrophages were similar when stg was present at a high copy number and when the wild-type harboring the vector alone was used (Fig. 5). In addition, the stg mutant also showed a level of association with macrophages similar to that of the wild-type strain when bacterial uptake was inhibited by cytochalasin D (Fig. 5). Since the levels of association with macrophages were similar in cytochalasin D-treated cells regardless of the presence of stg, these results indicate that the stg fimbrial system contributes to a reduction in internalization of serovar Typhi by macrophages.


Figure 4
View larger version (22K):
[in this window]
[in a new window]

  		FIG. 4. Effect of overexpression of stg on phagocytosis. Serovar Typhimurium carrying the stg cluster (DEF047) or the control vector (DEF048) and serovar Typhi carrying the stg cluster (DEF033) or the control vector (DEF064) were incubated with THP-1 macrophage-like cells. The percentage of the initial inoculum associated with cells after 120 min of incubation is indicated. All assays were conducted in duplicate and repeated independently at least three times. The results are expressed as the means ± standard errors of the replicate experiments. An asterisk indicates that there is a significant difference in phagocytosis between the wild-type strain containing the vector alone and the strain with the stg operon (P < 0.05).


Figure 5
View larger version (19K):
[in this window]
[in a new window]

  		FIG. 5. Role of stg fimbrial operon in bacterial association with macrophages. Bacterial uptake was inhibited with cytochalasin D, and the numbers of bacteria with stg (DEF033) and without stg (DEF004) associated with macrophages were compared. All assays were conducted in duplicate and repeated independently at least three times. The values for percent recovery were normalized to the wild-type control value, which was defined as 100% at each time point. The results are expressed as the means ± standard errors of the replicate experiments.


arrow
DISCUSSION
 
Bacterial adhesion to host cells is often considered an essential step for colonization. Adhesion is mediated via surface molecules, including fimbriae or pili. Many gene clusters corresponding to fimbrial systems are present in the genomes of S. enterica. However, only a few systems have been characterized, and only the fim cluster coding for type 1 fimbriae was detected after in vitro growth of serovar Typhimurium at 37°C in static broth (13). A combination of fimbrial systems may be responsible for the differences in binding and host specificities observed for different Salmonella serovars. Serovar Typhi is restricted to humans and harbors 13 putative fimbrial systems and a type IV pilus (29). We have previously found that stg is transcribed by serovar Typhi within macrophages (6). In S. enterica, the stg fimbrial cluster located in the glmS-pstS region is present only in serovar Typhi (30).

The stg gene cluster was suggested to be nonfunctional since the predicted ORF for the putative usher gene stgC contains an internal stop codon and is classified as a pseudogene (29, 39). Mutations in genes encoding assembly proteins, such as the usher, result in the absence of fimbriae from the bacterial surface (18). The fimbrial usher protein family consists of a group of large proteins (800 to 900 aa) present in the outer membranes of gram-negative bacteria (40). The usher acts in the assembly process together with a periplasmic fimbrial chaperone protein. Phylogenetic analyses suggest that the chaperone and the usher, in general, evolved in parallel from their evolutionary precursor proteins (40). In bacteria expressing numerous fimbriae, each fimbrial system typically encodes a specific periplasmic chaperone protein and outer membrane usher protein (24, 34). However, fimbrial expression may be possible using complementary fimbrial proteins from other clusters. This is likely to occur with the LP fimbria-encoding lpf1 cluster of E. coli O157:H7. This cluster contains a stop codon in the predicted usher-encoding gene which results in two ORFs, lpf1C (368 aa predicted) and lpf1C' (443 aa predicted) (37). The cloned lpf1 gene cluster produced detectable fimbriae, and these fimbriae contributed to microcolony formation, demonstrating that this system was therefore functional (37). The aims of our study were to characterize the stg fimbrial cluster and determine if this fimbrial cluster was functional despite the presence of a predicted pseudogene which comprises two ORFs, stgC (170 aa predicted) and stgC' (605 aa predicted), that may act as the usher gene. To circumvent the effect of the premature stop codon in the StgC usher gene, it is possible that other fimbrial ushers present in the cell may function for Stg; otherwise, the truncated StgC usher may be functional (24).

An increased level of association to epithelial cells was observed when the stg fimbrial cluster was cloned into a nonfimbriated E. coli strain (Fig. 1). We were unable to visualize any filamentous structures by transmission electron microscopy with negative staining. Other related fimbriae were also difficult to visualize and/or detect (26, 37, 38). Thus far, no studies have detected these fimbriae using wild-type strains, and fimbrial proteins or structures were detected only using an afimbrial recombinant E. coli strain and either multicopy or inducible vectors (21, 26, 37, 38). We were also unable to detect StgA when stg genes were cloned on a multicopy vector in E. coli or in Salmonella by Western blotting using an anti-StgA from E. coli (21). One explanation for the lack of fimbrial structures despite an adhesion phenotype may be that some export and partial assembly of the Stg protein occurs, which results in an adhesin that is not filamentous. Stg and related fimbriae exhibit a low level of transcription in vitro (26, 35, 37). This may also explain why these fimbriae are not readily detected in vitro. In serovar Typhi, using an stgA-lacZ single-copy fusion, a low level of stg expression was also detected in different growth conditions. The highest levels of stg expression were obtained when bacteria were grown in minimal medium or on solid medium (Fig. 2), and they were not influenced by the presence of salts or iron. The low level of fimbrial gene expression observed during in vitro growth of serovar Typhi is similar to results obtained with serovar Typhimurium (13). In serovar Typhimurium, which contains 13 fimbrial operons (22), only type 1 fimbriae were expressed in vitro at 37°C. Similarly, the majority (11/15) of fimbrial clusters in E. coli O157:H7 were not expressed under the majority of the conditions tested in vitro (20). It is currently not known why expression of many fimbrial systems is suppressed in vitro.

While they are an advantage to the bacterium for colonization of the host, fimbrial proteins at the bacterial surface may become a disadvantage, as they are easily exposed targets for the host immune system. Hence, tight regulation of fimbrial expression may be necessary during host infection. The induction of expression of fimbrial antigens during infection of mice with serovar Typhimurium was previously shown by seroconversion against most fimbriae (12). In typhoid fever patients, antibodies to three fimbrial systems, Tcf, Stb, and Csg, were detected (10). Nevertheless, we have previously detected the stgC' transcript during infection of macrophages (6). The optimal conditions for expression of Stg may not have been found yet, and we need to further investigate its regulation, but our results are consistent with the hypothesis that the stg fimbrial operon may be important for the initial interaction with host cells.

When the stg operon was deleted from serovar Typhi, a lower level of bacterial association with INT-407 cells was observed (Fig. 3A). Further, a higher level of bacterial association with epithelial cells was observed when the stg mutant was complemented by the stg fimbrial cluster. In addition, an increased level of association with epithelial cells was observed when the stg gene cluster was introduced into E. coli and S. enterica serovar Typhimurium, in which stg is absent (Fig. 1C). These results implicate the stg fimbrial operon in host cell interaction. The stg operon and the type IV pili are the only serovar Typhi determinants identified so far that confer adherence to human epithelial cells (43). Redundancy of virulence determinants is not uncommon. Wild-type virulent serovar Typhi strains lacking SPI-7, which harbor type IV pili, have been isolated (25), suggesting that the stg fimbrial operon may confer adhesion to host cells in {Delta}pil strains. The stg fimbrial cluster may represent an additional system for host intestinal colonization. Many functions have been associated with fimbriae related to Stg. In avian pathogenic E. coli, Stg contributes to the colonization of avian respiratory tissues (21). In E. coli O157:H7, long-term persistence in sheep and pigs was associated with the presence of Lpf1 and Lpf2 (14), which also influenced intestinal tissue tropism (7). In rabbit enteropathogenic E. coli, LpfR141 is involved in initial colonization (26).

Although loss of stg genes reduced the adherence of serovar Typhi to epithelial cells, a higher level of phagocytosis was observed with the stg mutant (Fig. 3B). Further, a lower level of phagocytosis was observed when stg was overexpressed in serovar Typhi, as well as in serovar Typhimurium (Fig. 4). The higher level of phagocytosis in the absence of the stg genes may have been caused by increased exposure of different bacterial surface proteins that are more readily recognized by macrophages, thus enhancing macrophage association. To rule out this possibility, bacterial association with macrophages was assessed in the presence of cytochalasin D, an inhibitor of actin polymerization, which mediates uptake of bacteria. The numbers of bacteria associated with cytochalasin D-treated macrophages were similar for the wild-type strain, the stg mutant strain, and a strain overexpressing stg (Fig. 5). Thus, the higher level of phagocytosis observed with the mutant was not the result of increased exposure of other proteins on the bacterial surface that may have increased association with phagocytes. Similarly, the lower level of phagocytosis observed when the stg fimbrial cluster was overexpressed was not due to a decrease in the association with macrophages but was likely due to a specific reduction in phagocytic activity. By contrast, type IV pili increased entry of serovar Typhi in macrophages (28). This suggests that Stg and type IV pili use different interaction mechanisms with host cells. The level of invasion of INT-407 cells and the intracellular survival in human macrophages of strains with stg or the mutant were similar to the results for the wild-type strain even when bacterial uptake by macrophages was inhibited (Fig. 3 and 5). This favors the hypothesis that the presence of the stg genes may be involved primarily in initial contact with host cells. It is possible that the stg fimbrial operon may promote inhibition of phagocytosis in order to evade inflammatory cells of the intestine so that the bacteria can invade deeper tissue.

The data presented in this paper demonstrate that the stg gene cluster of serovar Typhi expresses a functional and serovar-specific adhesin. The stg gene cluster potentially contributes to the initial stages of typhoid fever pathogenesis by mediating adherence of serovar Typhi to host epithelial cells and by inhibiting phagocytosis. It is important to understand this inhibition mechanism, to characterize the regulation, expression, and production of Stg in vivo, and to determine if Stg possesses a specific host cell receptor that may be a potential target for the prevention of typhoid fever.


arrow
ACKNOWLEDGMENTS
 
We thank M. McClelland and S. Porwollik (Sidney Kimmel Cancer Center, San Diego, CA) for sharing data on stg distribution among Salmonella strains.

This research was supported by the Canadian Natural Sciences and Engineering Research Council (NSERC). C.M.D. was supported by a Canada Research Chair. C.F. obtained a summer studentship from Pfizer. C.F. and S.P.F. were supported by a scholarship from NSERC, and K.P. was supported by a scholarship from the Fonds de la Recherche en Santé du Québec.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, University of Montreal, C.P. 6128 Succursale Centre-Ville, Montréal, Québec, Canada H3C 3J7. Phone: (514) 343-7396. Fax: (514) 343-5701. E-mail: france.daigle{at}umontreal.ca Back

{triangledown} Published ahead of print on 20 August 2007. Back

Editor: V. J. DiRita


arrow
REFERENCES
 
    1
  1. Bajaj, V., R. L. Lucas, C. Hwang, and C. A. Lee. 1996. Co-ordinate regulation of Salmonella typhimurium invasion genes by environmental and regulatory factors is mediated by control of hilA expression. Mol. Microbiol. 22:703-714.[CrossRef][Medline]
    2. 2
  2. Baumler, A. J., R. M. Tsolis, A. W. van der Velden, I. Stojiljkovic, S. Anic, and F. Heffron. 1996. Identification of a new iron regulated locus of Salmonella typhi. Gene 183:207-213.[CrossRef][Medline]
    3. 3
  3. Daigle, F., J. E. Graham, and R. Curtiss III. 2001. Identification of Salmonella typhi genes expressed within macrophages by selective capture of transcribed sequences (SCOTS). Mol. Microbiol. 41:1211-1222.[CrossRef][Medline]
    4. 4
  4. Deng, W., S. R. Liou, G. Plunkett III, G. F. Mayhew, D. J. Rose, V. Burland, V. Kodoyianni, D. C. Schwartz, and F. R. Blattner. 2003. Comparative genomics of Salmonella enterica serovar Typhi strains Ty2 and CT18. J. Bacteriol. 185:2330-2337.[Abstract/Free Full Text]
    5. 5
  5. Doughty, S., J. Sloan, V. Bennett-Wood, M. Robertson, R. M. Robins-Browne, and E. L. Hartland. 2002. Identification of a novel fimbrial gene cluster related to long polar fimbriae in locus of enterocyte effacement-negative strains of enterohemorrhagic Escherichia coli. Infect. Immun. 70:6761-6769.[Abstract/Free Full Text]
    6. 6
  6. Faucher, S. P., R. Curtiss III, and F. Daigle. 2005. Selective capture of Salmonella enterica serovar Typhi genes expressed in macrophages that are absent from the Salmonella enterica serovar Typhimurium genome. Infect. Immun. 73:5217-5221.[Abstract/Free Full Text]
    7. 7
  7. Fitzhenry, R., S. Dahan, A. G. Torres, Y. Chong, R. Heuschkel, S. H. Murch, M. Thomson, J. B. Kaper, G. Frankel, and A. D. Phillips. 2006. Long polar fimbriae and tissue tropism in Escherichia coli O157:H7. Microbes Infect. 8:1741-1749.[CrossRef][Medline]
    8. 8
  8. Galan, J. E., and R. Curtiss III. 1990. Expression of Salmonella typhimurium genes required for invasion is regulated by changes in DNA supercoiling. Infect. Immun. 58:1879-1885.[Abstract/Free Full Text]
    9. 9
  9. Gulig, P. A., and R. Curtiss III. 1987. Plasmid-associated virulence of Salmonella typhimurium. Infect. Immun. 55:2891-2901.[Abstract/Free Full Text]
    10. 10
  10. Harris, J. B., A. Baresch-Bernal, S. M. Rollins, A. Alam, R. C. LaRocque, M. Bikowski, A. F. Peppercorn, M. Handfield, J. D. Hillman, F. Qadri, S. B. Calderwood, E. Hohmann, R. F. Breiman, W. A. Brooks, and E. T. Ryan. 2006. Identification of in vivo-induced bacterial protein antigens during human infection with Salmonella enterica serovar Typhi. Infect. Immun. 74:5161-5168.[Abstract/Free Full Text]
    11. 11
  11. Hook, E. W. 1985. Salmonella species (including typhoid fever), p. 1256-1269. In G. L. Mandell, R. G. Douglas, and J. E. Bennett (ed.), Principles and practices in infectious diseases. Wiley and Sons, New York, NY.
    12. 12
  12. Humphries, A., S. Deridder, and A. J. Baumler. 2005. Salmonella enterica serotype Typhimurium fimbrial proteins serve as antigens during infection of mice. Infect. Immun. 73:5329-5338.[Abstract/Free Full Text]
    13. 13
  13. Humphries, A. D., M. Raffatellu, S. Winter, E. H. Weening, R. A. Kingsley, R. Droleskey, S. Zhang, J. Figueiredo, S. Khare, J. Nunes, L. G. Adams, R. M. Tsolis, and A. J. Baumler. 2003. The use of flow cytometry to detect expression of subunits encoded by 11 Salmonella enterica serotype Typhimurium fimbrial operons. Mol. Microbiol. 48:1357-1376.[CrossRef][Medline]
    14. 14
  14. Jordan, D. M., N. Cornick, A. G. Torres, E. A. Dean-Nystrom, J. B. Kaper, and H. W. Moon. 2004. Long polar fimbriae contribute to colonization by Escherichia coli O157:H7 in vivo. Infect. Immun. 72:6168-6171.[Abstract/Free Full Text]
    15. 15
  15. Kaniga, K., M. S. Compton, R. Curtiss III, and P. Sundaram. 1998. Molecular and functional characterization of Salmonella enterica serovar Typhimurium poxA gene: effect on attenuation of virulence and protection. Infect. Immun. 66:5599-5606.[Abstract/Free Full Text]
    16. 16
  16. Kaniga, K., I. Delor, and G. Cornelis. 1991. A wide host range suicide vector for improving reverse genetics in gram negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica. Gene 109:137-141.[CrossRef][Medline]
    17. 17
  17. Klugman, K. P., I. T. Gilbertson, H. J. Koornhof, J. B. Robbins, R. Schneerson, D. Schulz, M. Cadoz, and J. Armand. 1987. Protective activity of Vi capsular polysaccharide vaccine against typhoid fever. Lancet ii:1165-1169.
    18. 18
  18. Kuehn, M. J., F. Jacob-Dubuisson, K. Dodson, L. Slonim, R. Striker, and S. J. Hultgren. 1994. Genetic, biochemical, and structural studies of biogenesis of adhesive pili in bacteria. Methods Enzymol. 236:282-306.[Medline]
    19. 19
  19. LeMinor, L., and M. Y. Popoff. 1987. Designation of Salmonella enterica sp. nov., nom. rev., as the type and only species of the genus Salmonella. Int. J. Syst. Bacteriol. 37:465-468.[Abstract/Free Full Text]
    20. 20
  20. Low, A. S., F. Dziva, A. G. Torres, J. L. Martinez, T. Rosser, S. Naylor, K. Spears, N. Holden, A. Mahajan, J. Findlay, J. Sales, D. G. Smith, J. C. Low, M. P. Stevens, and D. L. Gally. 2006. Cloning, expression, and characterization of fimbrial operon F9 from enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 74:2233-2244.[Abstract/Free Full Text]
    21. 21
  21. Lymberopoulos, M. H., S. Houle, F. Daigle, S. Leveille, A. Bree, M. Moulin-Schouleur, J. R. Johnson, and C. M. Dozois. 2006. Characterization of Stg fimbriae from an avian pathogenic Escherichia coli O78:K80 strain and assessment of their contribution to colonization of the chicken respiratory tract. J. Bacteriol. 188:6449-6459.[Abstract/Free Full Text]
    22. 22
  22. McClelland, M., K. E. Sanderson, J. Spieth, S. W. Clifton, P. Latreille, L. Courtney, S. Porwollik, J. Ali, M. Dante, F. Du, S. Hou, D. Layman, S. Leonard, C. Nguyen, K. Scott, A. Holmes, N. Grewal, E. Mulvaney, E. Ryan, H. Sun, L. Florea, W. Miller, T. Stoneking, M. Nhan, R. Waterston, and R. K. Wilson. 2001. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413:852-856.[CrossRef][Medline]
    23. 23
  23. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
    24. 24
  24. Mol, O., and B. Oudega. 1996. Molecular and structural aspects of fimbriae biosynthesis and assembly in Escherichia coli. FEMS Microbiol. Rev. 19:25-52.[CrossRef][Medline]
    25. 25
  25. Nair, S., S. Alokam, S. Kothapalli, S. Porwollik, E. Proctor, C. Choy, M. McClelland, S. L. Liu, and K. E. Sanderson. 2004. Salmonella enterica serovar Typhi strains from which SPI7, a 134-kilobase island with genes for Vi exopolysaccharide and other functions, has been deleted. J. Bacteriol. 186:3214-3223.[Abstract/Free Full Text]
    26. 26
  26. Newton, H. J., J. Sloan, V. Bennett-Wood, L. M. Adams, R. M. Robins-Browne, and E. L. Hartland. 2004. Contribution of long polar fimbriae to the virulence of rabbit-specific enteropathogenic Escherichia coli. Infect. Immun. 72:1230-1239.[Abstract/Free Full Text]
    27. 27
  27. O'Callaghan, D., and A. Charbit. 1990. High efficiency transformation of Salmonella typhimurium and Salmonella typhi by electroporation. Mol. Gen. Genet. 223:156-158.[CrossRef][Medline]
    28. 28
  28. Pan, Q., X. L. Zhang, H. Y. Wu, P. W. He, F. Wang, M. S. Zhang, J. M. Hu, B. Xia, and J. Wu. 2005. Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar Typhi. Antimicrob. Agents Chemother. 49:4052-4060.[Abstract/Free Full Text]
    29. 29
  29. Parkhill, J., G. Dougan, K. D. James, N. R. Thomson, D. Pickard, J. Wain, C. Churcher, K. L. Mungall, S. D. Bentley, M. T. Holden, M. Sebaihia, S. Baker, D. Basham, K. Brooks, T. Chillingworth, P. Connerton, A. Cronin, P. Davis, R. M. Davies, L. Dowd, N. White, J. Farrar, T. Feltwell, N. Hamlin, A. Haque, T. T. Hien, S. Holroyd, K. Jagels, A. Krogh, T. S. Larsen, S. Leather, S. Moule, P. O'Gaora, C. Parry, M. Quail, K. Rutherford, M. Simmonds, J. Skelton, K. Stevens, S. Whitehead, and B. G. Barrell. 2001. Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 413:848-852.[CrossRef][Medline]
    30. 30
  30. Porwollik, S., E. F. Boyd, C. Choy, P. Cheng, L. Florea, E. Proctor, and M. McClelland. 2004. Characterization of Salmonella enterica subspecies I genovars by use of microarrays. J. Bacteriol. 186:5883-5898.[Abstract/Free Full Text]
    31. 31
  31. Raffatellu, M., D. Chessa, R. P. Wilson, R. Dusold, S. Rubino, and A. J. Baumler. 2005. The Vi capsular antigen of Salmonella enterica serotype Typhi reduces Toll-like receptor-dependent interleukin-8 expression in the intestinal mucosa. Infect. Immun. 73:3367-3374.[Abstract/Free Full Text]
    32. 32
  32. Rosenshine, I., S. Ruschkowski, and B. B. Finlay. 1994. Inhibitors of cytoskeletal function and signal transduction to study bacterial invasion. Methods Enzymol. 236:467-476.[Medline]
    33. 33
  33. Sharma, A., and A. Qadri. 2004. Vi polysaccharide of Salmonella typhi targets the prohibitin family of molecules in intestinal epithelial cells and suppresses early inflammatory responses. Proc. Natl. Acad. Sci. USA 101:17492-17497.[Abstract/Free Full Text]
    34. 34
  34. Smyth, C. J., M. B. Marron, J. M. Twohig, and S. G. Smith. 1996. Fimbrial adhesins: similarities and variations in structure and biogenesis. FEMS Immunol. Med. Microbiol. 16:127-139.[CrossRef][Medline]
    35. 35
  35. Tatsuno, I., R. Mundy, G. Frankel, Y. Chong, A. D. Phillips, A. G. Torres, and J. B. Kaper. 2006. The lpf gene cluster for long polar fimbriae is not involved in adherence of enteropathogenic Escherichia coli or virulence of Citrobacter rodentium. Infect. Immun. 74:265-272.[Abstract/Free Full Text]
    36. 36
  36. Toma, C., N. Higa, S. Iyoda, M. Rivas, and M. Iwanaga. 2006. The long polar fimbriae genes identified in Shiga toxin-producing Escherichia coli are present in other diarrheagenic E. coli and in the standard E. coli collection of reference (ECOR) strains. Res. Microbiol. 157:153-161.[Medline]
    37. 37
  37. Torres, A. G., J. A. Giron, N. T. Perna, V. Burland, F. R. Blattner, F. Avelino-Flores, and J. B. Kaper. 2002. Identification and characterization of lpfABCC'DE, a fimbrial operon of enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 70:5416-5427.[Abstract/Free Full Text]
    38. 38
  38. Torres, A. G., K. J. Kanack, C. B. Tutt, V. Popov, and J. B. Kaper. 2004. Characterization of the second long polar (LP) fimbriae of Escherichia coli O157:H7 and distribution of LP fimbriae in other pathogenic E. coli strains. FEMS Microbiol. Lett. 238:333-344.[Medline]
    39. 39
  39. Townsend, S. M., N. E. Kramer, R. Edwards, S. Baker, N. Hamlin, M. Simmonds, K. Stevens, S. Maloy, J. Parkhill, G. Dougan, and A. J. Baumler. 2001. Salmonella enterica serovar Typhi possesses a unique repertoire of fimbrial gene sequences. Infect. Immun. 69:2894-2901.[Abstract/Free Full Text]
    40. 40
  40. Van Rosmalen, M., and M. H. Saier, Jr. 1993. Structural and evolutionary relationships between two families of bacterial extracytoplasmic chaperone proteins which function cooperatively in fimbrial assembly. Res. Microbiol. 144:507-527.[Medline]
    41. 41
  41. Wang, R. F., and S. R. Kushner. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195-199.[CrossRef][Medline]
    42. 42
  42. Woodall, L. D., P. W. Russell, S. L. Harris, and P. E. Orndorff. 1993. Rapid, synchronous, and stable induction of type 1 piliation in Escherichia coli by using a chromosomal lacUV5 promoter. J. Bacteriol. 175:2770-2778.[Abstract/Free Full Text]
    43. 43
  43. Zhang, X. L., I. S. Tsui, C. M. Yip, A. W. Fung, D. K. Wong, X. Dai, Y. Yang, J. Hackett, and C. Morris. 2000. Salmonella enterica serovar Typhi uses type IVB pili to enter human intestinal epithelial cells. Infect. Immun. 68:3067-3073.[Abstract/Free Full Text]

Infection and Immunity, November 2007, p. 5264-5271, Vol. 75, No. 11
0019-9567/07/$08.00+0     doi:10.1128/IAI.00674-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Forest, C.
Right arrow Articles by Daigle, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Forest, C.
Right arrow Articles by Daigle, F.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»