Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tuchscherr, L. P. N. Articles by Sordelli, D. O. Search for Related Content PubMed PubMed Citation Articles by Tuchscherr, L. P. N. Articles by Sordelli, D. O.

 Previous Article  |  Next Article 

Infection and Immunity, November 2007, p. 5483-5488, Vol. 75, No. 11
0019-9567/07/$08.00+0     doi:10.1128/IAI.00747-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Characterization of a New Variant of IS257 That Has Displaced the Capsule Genes within Bovine Isolates of Staphylococcus aureus

L. P. N. Tuchscherr,¹ M. I. Gomez,^1, F. R. Buzzola,¹ L. F. Calvinho,² J. C. Lee,³ and D. O. Sordelli^1*

Department of Microbiology, School of Medicine, University of Buenos Aires, Buenos Aires, Argentina,¹ Estación Experimental INTA Rafaela, Santa Fe, Argentina,² Channing Laboratory, Department of Medicine, Brigham & Women's Hospital, Harvard Medical School, Boston, Massachusetts³

Received 1 June 2007/ Returned for modification 15 August 2007/ Accepted 29 August 2007

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Many bovine Staphylococcus aureus isolates from Argentina are nontypeable (NT), i.e., they do not produce serotype 5 or 8 capsular polysaccharides (CPs). Some of these NT strains have a deletion of the cap5(8) gene cluster mediated by a variant of IS257, now designated IScap. IScap showed 93% amino acid identity to S. aureus ORF49 but only 85% identity to IS431 from S. aureus N315 and 88% identity to an IS257-like element from bovine strain RF122. Thirty-six (53%) of 68 bovine isolates, drawn from a previously described S. aureus strain collection, carried some variant of IS257, including IScap. Of these 36 IS⁺ isolates, 6 were CP5⁺, 1 was CP8⁺, and 29 were NT. Forty-four of the 68 isolates were NT, and 24 of these 44 NT isolates (55%) exhibited IScap-mediated deletion of the cap5(8) gene cluster. IScap was not found among 20 human NT S. aureus isolates bearing the cap5HIJK genes, which suggests that IScap-mediated deletion of the capsule locus is restricted to bovine strains of S. aureus. We were unable to identify a precursor strain in which IScap flanked the cap5(8) capsule locus, nor were we able to select for deletion of the cap5(8) locus in vitro. Our results support the hypothesis that deletion of the cap5 locus occurred in the distant past and that the relative abundance of these NT strains may be a result of their ability to persist in subclinical mastitis infection in cows.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Capsular polysaccharides of types 5 (CP5) and 8 (CP8) are produced by 75 to 80% of Staphylococcus aureus isolates from humans and play a significant role in the pathogenesis of staphylococcal infections (9, 13, 18). Isolates of S. aureus that fail to produce CP5 or CP8 are defined as nontypeable (NT) and can be isolated from 20 to 25% of human infections (1, 16, 21, 23). In contrast, the prevalence of NT strains among S. aureus strains isolated from bovines with mastitis varies considerably and is highly influenced by the geographic source of the strain (7, 20, 23, 25). In Argentina, 86% of 195 bovine S. aureus isolates were reported to be NT (24). Our previous studies indicated that NT S. aureus isolates from humans carry either the cap5 or cap8 genetic locus and that most NT strains have point mutations in the cap5(8) promoter or in one of the 11 genes essential for capsule production (5). Other strains have mutations in genes that regulate capsule expression, such as agr or arlRS (5). NT strains of S. aureus from bovine mastitis in Argentina fail to produce capsular polysaccharides because they have point mutations in cap5(8) genes indispensable for capsule expression or because the cap5(8) locus is deleted. The cap5(8) locus was replaced by an IS element with 93% identity to IS257 in 13 of 21 epidemiologically unrelated NT bovine isolates (5). IS257 is a member of the IS6 family that was first found in Escherichia coli (2). Elements of the IS6 family with identical sequences have been found in several bacterial species (4), which suggests broad horizontal dissemination. IS257 (also known as IS431) has been found in diverse genetic contexts in staphylococci, variously associated with genes mediating resistance to methicillin, aminoglycosides, tetracycline, trimethoprim, or mupirocin (6). The present study was designed to characterize a new variant of IS257 that was found in bovine S. aureus isolates from Argentina that lacked the capsule locus.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Definitions. For the sake of clarity, the following definitions are used throughout the text. IS257 is the insertion element with 98% (DNA) and 94% (protein) sequence identity to IS431 described for S. aureus strain N315 (12). IScap is the IS257-like element (GenBank accession no. EF177828) that replaced the cap5(8) locus in S. aureus bovine strain MBC204 (5). IScap sometimes replaced the cap5(8) locus [internal, IScap(i)], but at other times an IS element with 98% identity to IScap(i) was found external to the intact cap5(8) locus; it was named IScap(e). When the insertion elements were identified by amplification using primers common to both IS257 and IScap, the amplicon was called the "IS element." NCR is the noncoding region. cap5⁺ or cap8⁺ indicates that a given S. aureus strain yielded an amplicon with serotype-specific cap5H to -J or cap8H to -K primers, respectively. None of the NT S. aureus isolates that were cap5⁺ or cap8⁺ carried IScap within the cap5(8) gene region.

Bacterial strains. Sixty-eight S. aureus strains (Table 1) from the milk of cows with subclinical mastitis, drawn from a collection of 195 strains isolated between 1989 and 1997 from 17 separate locations in Argentina (24), were investigated. These 68 strains are representative of the different genotypes found in Argentina, are epidemiologically unrelated (3, 24), are susceptible to methicillin, and were selected because they differed from other strains in the collection in at least one of the following respects: (i) different pulsotype and/or ribotype, (ii) isolation date differing by more than one year, or (iii) different geographical site of isolation. This subset of strains is not representative of the distribution of S. aureus capsule serotypes in Argentina (24), but it does include all the different genotypes and subtypes found in the country (3). In addition, 20 NT cap5⁺ S. aureus strains from patients with chronic osteoarticular disease were included in the experiments. These strains were obtained from three hospitals in Argentina (Hospital de Clínicas José San Martin, Buenos Aires; Instituto de Investigaciones Médicas Alfredo Lanari, Buenos Aires; and Hospital José María Cullen, Santa Fe). Eleven of the NT strains were susceptible to methicillin, and nine strains were resistant. The capsule serotype of the strains was determined by colony immunoblotting or by immunodiffusion assays with antibodies specific for CP5 or CP8 (25). Strains lacking the cap5(8) locus were confirmed to be S. aureus by PCR amplification of a 108-bp S. aureus-specific fragment with primers Sa442-1 and Sa442-2 (15) (Table 2). The 68 S. aureus strains investigated comprised 14 serotype 5, 10 serotype 8, and 44 NT strains (Table 1). Prototype S. aureus strains included S. aureus Reynolds and Becker, which produce CP5 and CP8, respectively, and do not carry IS257 or IScap. Strain MBC204 carries IScap in place of the cap5(8) locus and was described previously (5). The genome of S. aureus strains N315 (11) and RF122 (GenBank accession no. AJ938182) has been sequenced. Bovine strains RA9 (CP5⁺, IScap⁺) and RA18 (CP5⁺, IScap negative), isolated in 2005 from cows in Rafaela, Santa Fe, were utilized for in vitro enrichment experiments. Staphylococci were stored either in 10% skim milk at –80°C or in brain heart infusion medium (Difco) with 20% glycerol at –20°C. S. aureus strains were grown at 37°C in tryptic soy broth (Difco) for genomic DNA preparations or in Columbia broth (Difco) containing 2% NaCl (CSB) for all other experiments.

View this table: [in this window] [in a new window]

TABLE 1. Characteristics of 68 epidemiologically unrelated S. aureus strains isolated from bovines

View this table: [in this window] [in a new window]

TABLE 2. Primers used in this study

DNA manipulations. Genomic DNA was extracted and purified from S. aureus strains using a standard procedure (19). The presence of the IS element was detected by amplification of specific sequences by PCR using primers IS-1 and IS-4. Likewise, the cap5 genes were detected with primers cap5H-f and cap5J-r, and the cap8-specific genes were amplified with cap8H-f and cap8K-r (Table 2; Fig. 1). Amplicons were sequenced using an ABI PRISM 373 DNA sequencer (Applied Biosystems).

View larger version (8K): [in this window] [in a new window]

FIG. 1. Schematic representation of the cap5(8) locus (A) and the structure of the locus from a strain in which IScap(i) displaced the cap5(8) genes except for the last 63 bp of cap5(8)P (B). The cap5(8) locus is composed of 16 genes (capA to capP) flanked by the housekeeping genes adhE (upstream) and aldA (downstream) (genes are not drawn to scale). The positions of primers listed in Table 1 are shown by arrowheads.

In vitro NT S. aureus enrichment. CP5 antiserum was obtained by immunization of rabbits with killed encapsulated S. aureus and absorption of the serum with acapsular mutants, as described previously (14). Strains RA9 and RA18 were incubated overnight at 37°C in CSB. The bacteria were harvested by centrifugation and washed with 0.01 M phosphate buffer-0.15 M NaCl. The pellet was suspended in 800 µl of CP5 antiserum or normal rabbit serum (control), incubated for 4 h at 4°C, and then centrifuged at 12,000 x g for 10 min. Ten microliters of the supernatant was then added to 10 ml of fresh CSB and incubated overnight at 37°C. A sample from each overnight broth culture was diluted and plated to assess CP5 production by the colony immunoblot method (25). Culture plates with 30 to 150 colonies were evaluated, and colonies that appeared NT in the immunoblot assay were confirmed as NT by immunodiffusion of capsule extracts (25). The cycle of S. aureus incubation with CP5 antiserum (or normal serum) was repeated until NT colonies were recovered from the assay or after 10 cycles of enrichment with negative results, whichever came first.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Presence of IS element in bovine S. aureus isolates. To determine the prevalence of the IS element (IS257 or IScap), PCR was performed on genomic DNA from each isolate using primers IS-1 and IS-4, which amplify both IS257 (IS431) (6) and IScap (defined later by sequence analysis). In silico (http://insilico.ehu.es/) analysis indicated that these primers would also permit amplification of the IS element carried by bovine strain RF122 (GenBank accession no. AJ938182), defined here as ISRF122, and ORF49 (an IS257-like transposase located within a S. aureus plasmid carrying EDIN-C [exfoliative toxin B]) (27). Thirty-six (53%) of our 68 isolates (including capsule-positive and NT strains) yielded an amplicon with primers IS-1 and IS-4. Of these 36 IS⁺ isolates, six were CP5⁺, one was CP8⁺, and 29 were NT. IS257 has been shown to contribute to staphylococcal genetic flexibility, enhancing the rate of genetic rearrangements (22). Recombination events and horizontal transfer of IS elements have played major roles in the evolution of bacterial species (12), resulting in dynamic genomes in which DNA is introduced into and deleted from the chromosome (17). Loss of the cap gene cluster in bovine S. aureus provides an example of such genomic changes.

Analysis of the IS element in NT S. aureus. Of the 29 NT isolates that carried the IS element, only 5 carried the cap5 genes. The remaining 24 NT strains exhibited positive amplification of the IS element but no amplification of the cap5- or cap8-specific genes (Table 1). To assess whether the absence of the cap5(8) locus was a result of an IScap-mediated deletion, confirmatory PCRs were performed using primers (adhE-f and aldA-r) that anneal to genes flanking the cap5(8) locus. Genomic DNA from all 24 NT, cap5(8)-negative, IS element-positive strains yielded a 4-kb amplicon similar to that obtained from prototypic strains MBC204 and MBC214, which have IScap replacing the cap5(8) locus (5). In order to further characterize the 4-kb fragment, PCR amplifications were performed using primers adhE-f and IS-3 (950-bp predicted product) and IS-2 and NCR-r (910-bp predicted product). All 24 NT strains, as well as MBC204, yielded the expected products. The 4-kb amplicons from 11 of the 24 strains were sequenced; each amplicon showed 100% identity to that of S. aureus MBC204. These findings suggest that the IS element in these 24 NT, cap5(8)–negative, IS element-positive strains was placed at a site (between adhE and the NCR upstream of aldA) consistent with deletion of the cap5(8) genes.

IScap sequence analysis. We sequenced the IS element from 19 of the 29 NT S. aureus isolates (Table 1) that carried it [5 cap5⁺ isolates plus 14 cap5(8)-negative isolates]. A comparison of the DNA sequence of the IScap inverted repeat (TGGTTCTGTTGCAAAGTTAGAAA) with those of other inverted repeats of the IS6 family (IS257, IS431, ORF49, and ISRF122) revealed that each shared a 14-bp core (underlined above). IScap had the longest perfect repeat (23 bp), whereas IS431 had a repeat of only 14 bp. The IS element amplified from strains exhibiting the cap5(8) deletion was named IScap(i).

The IS element found in cap5(8)⁺ strains was named IScap(e) to differentiate it from IScap(i). IScap(i) and IScap(e) showed 98% DNA identity. The IScap G+C content was 33%, identical to that of the S. aureus genomes of strains N315 and Mu50 (11) and almost identical to that of the bovine strain RF122 genome (32.8%), IS257 (34%), and IS431 (33.7%). IScap(i) exhibited 93% identity to ORF49 (27), 88% identity to ISRF122, and 85% identity to IS431 from S. aureus N315 (11). The transposase gene was also amplified and sequenced from five NT strains that were cap5⁺ and two CP5⁺ strains (Table 1). The IScap(e) sequences from these strains were identical to each other, and their products showed 98% amino acid identity to that of IScap(i), 93% identity to that of ORF49, 88% identity to that of ISRF122, and 85% identity to that of IS431 (from S. aureus N315). The product of the transposase gene within IScap(e) differed in two amino acid residues from that for IScap(i) (Fig. 2). A single C-to-T base-pair difference resulted in a conservative (H to Y) substitution at amino acid position 74 within the N2 region. An A-to-G base-pair difference resulted in an N-to-D substitution at amino acid position 86. Both of these substitutions occurred outside of the amino acid triad (DDE motif) shaping the catalytic site, so these changes may not affect the enzymatic function of the transposase.

View larger version (32K): [in this window] [in a new window]

FIG. 2. Sequence alignment of the IS257-related elements. Shaded letters indicate the conserved domains of the IS6 family: N2, N3, and C1. The DDE motif is indicated in boldface with a larger font size. IScap(i) represents the element that displaced the cap5(8) locus, whereas IScap(e) represents the element found external to the cap5(8) locus in both CP5 and NT cap5+ S. aureus. Accession numbers are as follows: for IS257, X13290; for IS431, M18437; for ORF49, AAC61974; for ISRF122, YP416775. IS257(CP8) denotes the IS257 sequence external to the cap locus found in S. aureus MBC212 (CP8-expressing strain).

As noted above, we were able to amplify an IS element from only a single serotype 8 S. aureus strain (MBC212). The deduced amino acid sequence encoded by its transposase gene was 93% identical to that for IS431 (N315), 91% identical to that for ISRF122, 86% identical to that for ORF49, and only 83% identical to that for IScap(i). IS element sequences identical to those found in MBC212 were also obtained from three epidemiologically unrelated CP8⁺ S. aureus isolates obtained in 2005 from the Rafaela, Santa Fe, district in Argentina (Table 1). The phylogenetic relatedness of the transposase genes from the IS257 variants is depicted in Fig. 3. IScap(i) and IScap(e) are nearly identical to each other and are closely related to ORF49. The IS element in the serotype 8 strain MBC212 is similar to IS257 and IS431 and more closely related to the IS element from bovine strain RF122 than to IScap. The common S. aureus ancestor for isolates exhibiting an IScap-mediated deletion likely carried the cap5 locus, since (i) IScap(i) was found only in strains with the cap cluster deletion; (ii) IScap(e) was found in strains bearing the cap5 but not the cap8 specific genes; and (iii) the IS element detected in strains bearing the cap8 genes was nearly identical to IS257/IS431.

View larger version (9K): [in this window] [in a new window]

FIG. 3. Neighbor-joining phylogenetic tree of IS257 variants based on transposase gene sequences. Numbers at nodes indicate bootstrap values derived from 1,000 replications. The deduced amino acid sequence for IScap(i) was obtained from 13 NT strains. The sequence for IScap(e) was obtained from five NT cap5+ strains and two CP5+ S. aureus isolates, and the IS257CP8 (MBC212) sequence was obtained from serotype 8 strain MBC212. The IS257 and IS431 sequences were obtained from the GenBank (see the legend to Fig. 2).

Search for a precursor to the IScap-mediated deletion of the cap5(8) locus. Deletion of the cap5 genes among bovine S. aureus isolates may have resulted from homologous recombination between copies of IScap flanking the capsule operon (5). This hypothesis presumes that a precursor S. aureus strain exists that carries an intact cap5(8) locus and a minimum of two copies of IScap: one upstream of cap5(8)A and the other within cap5(8)P (a gene that is not essential for capsule production (10). To identify such a precursor, we performed Southern blot analysis (24) on all of the encapsulated S. aureus isolates (14 CP5⁺ isolates and 10 CP8⁺ isolates) in our strain collection, using as a probe an internal fragment of IScap from S. aureus strain MBC204 (amplified with primers IS-2 and IS-3). Fourteen of the S. aureus isolates did not hybridize with IS257, eight strains carried a single copy of the IS element, and only two strains (MB094 and MB113; both CP5⁺) carried two copies of the IS element (Table 1).

To determine whether the IS elements flanked the cap5 locus in strains MB094 and MB113, we analyzed the flanking DNA by using PCRs. Using primers adhE-f and capA-r, we amplified a 627-bp adhE-capA DNA fragment from both strains. The size of the amplicon was identical to that obtained from the CP5⁺ S. aureus strain Reynolds, which indicates that the IS element was not inserted between adhE and cap5(8)A. Similarly, amplification of the region between the 3' end of cap5(8)O and the NCR upstream of aldA yielded an 1,888-bp amplicon from strains MB094, MB113, and Reynolds. Identical results were obtained from 13 additional bovine S. aureus strains, including 6 NT isolates bearing the cap5 locus and 7 CP5⁺ S. aureus strains (Table 1). These 13 strains, plus MB094 and MB113, represent all of the isolates within our strain collection that carry the cap5 locus and at least one copy of the IS element. Thus, we were not able to find within our collection a precursor strain that might explain the deletion of the cap5(8) locus in 24/44 (55%) of our NT strains. S. aureus strains from Argentina isolated from bovine mastitis prior to 1989 were not available to us. Nonetheless, the clone bearing the IScap-mediated deletion has persisted among clinical isolates for at least 8 years (1989 to 1997).

Absence of IScap(i) in S. aureus isolates from humans. Positive amplification of the IS element with primers IS-1 and IS-4 was obtained for all 20 human strains investigated. The DNA sequence of the amplicons from all 20 strains predicted a transposase with 98 to 100% identity to that of IS431 (N315), 91% identity to that of ISRF122, 86% identity to that of ORF49, and only 83% identity to that of IScap(i). Therefore, IScap appears to be unique to bovine strains of S. aureus, and differences between IScap and IS257 or IS431 may reflect the documented host specificity of bovine S. aureus isolates (8).

In vitro selection for loss of CP5 production. We investigated whether IScap-mediated loss of the cap5 genes might occur spontaneously in vitro or by depletion of encapsulated organisms by incubation with CP5-specific antibodies. No NT colonies were detected up to the eighth enrichment cycle. Two of 400 colonies arising from the 9th passage of strain RA9 were CP5 negative. By the tenth cycle of in vitro enrichment, we obtained 15 CP5-negative colonies (of 200 total colonies), but PCR analysis with primers adhE-f and aldA-r revealed that none of these colonies yielded a 4-kb amplicon, consistent with deletion of the cap5 locus. The enrichment experiment was repeated using strain RA18 (a CP5⁺ S. aureus strain carrying no IS257-like element), and 12 of 200 colonies tested after 10 enrichment cycles were CP5 negative. No NT colonies were detected after 10 cycles when S. aureus was incubated with normal rabbit serum. These results indicate that antibodies to the capsule can be used to select in vitro for capsular polysaccharide-negative mutants but that this process is independent of the presence of IS257 or IScap.

We showed with an animal model of murine mastitis that a mutant S. aureus strain lacking capsule expression persisted in higher numbers in the infected mammary gland than isogenic CP5- or CP8-producing strains (26). The capsular polysaccharide-negative S. aureus mutant was also internalized in vitro within bovine epithelial cells in greater numbers than the encapsulated strains. The acquisition of IScap by S. aureus strains in Argentina and concomitant loss of the cap5(8) locus may have conferred an evolutionary advantage to these NT isolates by allowing them to chronically infect the mammary gland and invade mammary epithelial cells. In summary, our results support the hypothesis that an IScap-mediated deletion of the capsule locus occurred in bovine S. aureus strains from Argentina and that these strains have persisted in cows for at least 8 years. Our genetic evidence suggests that the IScap-bearing NT strain originally carried the cap5 locus.

 
This study was supported by grants from the NIH Fogarty Foundation (FIRCA 1-R03-TW006264) and the NIAID (RO1 AI29040) to J.C.L, the Agencia Nacional de Promoción de la Ciencia y la Tecnología, Argentina (ANPCYT PICT 05-10648 and 05-32577), and the Secretaría de Ciencia y Técnica, Universidad de Buenos Aires, Buenos Aires, Argentina (UBACyT M-009).

We thank Elida Gentilini for providing strains for this study and Lorena Medina for her dedicated technical assistance.

 
* Corresponding author. Mailing address: Department of Microbiology, School of Medicine, University of Buenos Aires, Paraguay 2155 P-12, C1121ABG Buenos Aires, Argentina. Phone: 5411 5950 9618. Fax: 5411 4964 2554. E-mail: sordelli{at}fmed.uba.ar

Published ahead of print on 4 September 2007.

Editor: V. J. DiRita

Present address: Department of Pediatrics, Division of Infectious Diseases, Columbia University, New York, NY 10032.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 

1
1. Arbeit, R. D., W. W. Karakawa, W. F. Vann, and J. B. Robbins. 1984. Predominance of two newly described capsular polysaccharide types among clinical isolates of Staphylococcus aureus. Diagn. Microbiol. Infect. Dis. 2:85-91.[CrossRef][Medline]
2
2. Berg, D. E., J. Davies, B. Allet, and J. D. Rochaix. 1975. Transposition of R factor genes to bacteriophage lambda. Proc. Natl. Acad. Sci. USA 72:3628-3632.[Abstract/Free Full Text]
3
3. Buzzola, F. R., L. Quelle, M. I. Gómez, M. Catalano, L. Steele-Moore, D. Berg, E. Gentilini, G. Denamiel, and D. O. Sordelli. 2001. Genotypic analysis of Staphylococcus aureus from milk of dairy cows with mastitis in Argentina. Epidemiol. Infect. 126:445-452.[CrossRef][Medline]
4
4. Chandler, M., and J. Mahillon. 2002. Insertion sequences revisited, p. 305-366. In N. L. Graig, R. Craigie, M. Gellert, and A. M. Lambowitz (ed.), Mobile DNA II. ASM Press, Washington, DC.
5
5. Cocchiaro, J. L., M. I. Gómez, A. Risley, R. Solinga, D. O. Sordelli, and J. C. Lee. 2006. Molecular characterization of the capsule locus from nontypeable Staphylococcus aureus. Mol. Microbiol. 59:948-960.[CrossRef][Medline]
6
6. Firth, N., and R. A. Skurray. 2006. Genetics: accessory elements and genetic exchange, p. 413-426. In V. A. Fischetti, R. P. Novick, J. J. Ferretti, D. A. Portnoy, and J. I. Rood (ed.), Gram-positive pathogens, 2nd ed. ASM Press, Washington, DC.
7
7. Han, H. R., S. Pak, and A. Guidry. 2000. Prevalence of capsular polysaccharide (CP) types of Staphylococcus aureus isolated from mastitic milk and protection of S. aureus infection in mice with CP vaccine. J. Vet. Med. Sci. 62:1331-1333.[CrossRef][Medline]
8
8. Herron, L. L., R. Chakravarty, C. Dwan, J. R. Fitzgerald, J. M. Musser, E. Retzel, and V. Kapur. 2002. Genome sequence survey identifies unique sequences and key virulence genes with unusual rates of amino acid substitution in bovine Staphylococcus aureus. Infect. Immun. 70:3978-3981.[Abstract/Free Full Text]
9
9. Karakawa, W. W., and W. F. Vann. 1982. Capsular polysaccharides of Staphylococcus aureus. Semin. Infect. Dis. 2:285-293.
10
10. Kiser, K. B., N. Bhasin, L. Deng, and J. C. Lee. 1999. Staphylococcus aureus cap5P encodes a UDP-N-acetylglucosamine 2-epimerase with functional redundancy. J. Bacteriol. 181:4818-4824.[Abstract/Free Full Text]
11
11. Kuroda, M., T. Ohta, I. Uchiyama, T. Baba, H. Yuzawa, I. Kobayashi, L. Cui, A. Oguchi, K. Aoki, Y. Nagai, J. Lian, T. Ito, M. Kanamori, H. Matsumaru, A. Maruyama, H. Murakami, A. Hosoyama, Y. Mizutani-Ui, N. K. Takahashi, T. Sawano, R. Inoue, C. Kaito, K. Sekimizu, H. Hirakawa, S. Kuhara, S. Goto, J. Yabuzaki, M. Kanehisa, A. Yamashita, K. Oshima, K. Furuya, C. Yoshino, T. Shiba, M. Hattori, N. Ogasawara, H. Hayashi, and K. Hiramatsu. 2001. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet 357:1225-1240.[CrossRef][Medline]
12
12. Lawrence, J. G., H. Ochman, and D. L. Hartl. 1992. The evolution of insertion sequences within enteric bacteria. Genetics 131:9-20.[Abstract]
13
13. Lee, C. Y., and J. C. Lee. 2006. Staphylococcal capsule, p. 456-463. In V. A. Fischetti, R. P. Novick, J. J. Ferretti, D. A. Portnoy, and J. I. Rood (ed.), Gram-positive pathogens, 2nd ed. ASM Press, Washington, DC.
14
14. Lee, J. C., M.-J. Liu, J. Parsonnet, and R. D. Arbeit. 1990. Expression of type 8 capsular polysaccharide and production of toxic shock syndrome toxin 1 are associated among vaginal isolates of Staphylococcus aureus. J. Clin. Microbiol. 28:2612-2615.[Abstract/Free Full Text]
15
15. Martineau, F., F. J. Picard, P. H. Roy, M. Ouellette, and M. G. Bergeron. 1998. Species-specific and ubiquitous-DNA based assays for rapid identification of Staphylococcus aureus. J. Clin. Microbiol. 36:618-623.[Abstract/Free Full Text]
16
16. Na'was, T., A. Hawwari, E. Hendrix, J. Hebden, R. Edelman, M. Martin, W. Campbell, R. Naso, R. Schwalbe, and A. I. Fattom. 1998. Phenotypic and genotypic characterization of nosocomial Staphylococcus aureus isolates from trauma patients. J. Clin. Microbiol. 36:414-420.[Abstract/Free Full Text]
17
17. Ochman, H., J. G. Lawrence, and E. A. Groisman. 2000. Lateral gene transfer and the nature of bacterial innovation. Nature 405:299-304.[CrossRef][Medline]
18
18. O'Riordan, K., and J. C. Lee. 2004. Staphylococcus aureus capsular polysaccharide. Clin. Microbiol. Rev. 17:218-234.[Abstract/Free Full Text]
19
19. Pitcher, D. G., N. A. Saunders, and R. J. Owen. 1989. Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett. Appl. Microbiol. 8:151-156.
20
20. Poutrel, B., A. Boutonnier, L. Sutra, and J. M. Fournier. 1988. Prevalence of capsular polysaccharide types 5 and 8 among Staphylococcus aureus isolates from cow, goat, and ewe milk. J. Clin. Microbiol. 26:38-40.[Abstract/Free Full Text]
21
21. Shinefield, H., S. Black, A. Fattom, G. Horwith, S. Rasgon, J. Ordonez, H. Yeoh, D. Law, J. B. Robbins, R. Schneerson, L. Muenz, S. Fuller, J. Johnson, B. Fireman, H. Alcorn, and R. Naso. 2002. Use of a Staphylococcus aureus conjugate vaccine in patients receiving hemodialysis. N. Engl. J. Med. 346:491-496.[Abstract/Free Full Text]
22
22. Simpson, A. E., R. A. Skurray, and N. Firth. 2000. An IS257-derived hybrid promoter directs transcription of a tetA(K) tetracycline resistance gene in Staphylococcus aureus chromosomal mec region. J. Bacteriol. 182:3345-3352.[Abstract/Free Full Text]
23
23. Sompolinsky, D., Z. Samura, W. W. Karakawa, W. F. Vann, R. Schneerson, and Z. Malik. 1985. Encapsulation and capsular types in isolates of Staphylococcus aureus from different sources and relationship to phage types. J. Clin. Microbiol. 22:828-834.[Abstract/Free Full Text]
24
24. Sordelli, D. O., F. R. Buzzola, M. I. Gómez, L. Steele-Moore, D. Berg, E. Gentilini, M. Catalano, A. J. Reitz, T. Tollersrud, G. Denamiel, P. Jeric, and J. C. Lee. 2000. Capsule expression by bovine isolates of Staphylococcus aureus from Argentina: genetic and epidemiologic analyses. J. Clin. Microbiol. 38:846-850.[Abstract/Free Full Text]
25
25. Tollersrud, T., K. Kenny, A. J. Reitz, Jr., and J. C. Lee. 2000. Genetic and serologic evaluation of capsule production by bovine mammary isolates of Staphylococcus aureus and other Staphylococcus spp. from Europe and the United States. J. Clin. Microbiol. 38:2998-3003.[Abstract/Free Full Text]
26
26. Tuchscherr, L. P. N., F. R. Buzzola, L. Alvarez, R. Caccuri, J. C. Lee, and D. O. Sordelli. 2005. Capsule-negative Staphylococcus aureus induces chronic experimental mastitis in mice. Infect. Immun. 73:7932-7937.[Abstract/Free Full Text]
27
27. Yamaguchi, T., T. Hayashi, H. Takami, M. Ohnishi, T. Murata, K. Nakayama, K. Asakawa, M. Ohara, H. Komatsuzawa, and M. Sugai. 2001. Complete nucleotide sequence of a Staphylococcus aureus exfoliative toxin B plasmid and identification of a novel ADP-ribosyltransferase, EDIN-C. Infect. Immun. 69:7760-7771.[Abstract/Free Full Text]

---

Infection and Immunity, November 2007, p. 5483-5488, Vol. 75, No. 11
0019-9567/07/$08.00+0     doi:10.1128/IAI.00747-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Lattar, S. M., Tuchscherr, L. P. N., Caccuri, R. L., Centron, D., Becker, K., Alonso, C. A., Barberis, C., Miranda, G., Buzzola, F. R., von Eiff, C., Sordelli, D. O. (2009). Capsule Expression and Genotypic Differences among Staphylococcus aureus Isolates from Patients with Chronic or Acute Osteomyelitis. Infect. Immun. 77: 1968-1975 [Abstract] [Full Text]  
• Tuchscherr, L. P. N., Buzzola, F. R., Alvarez, L. P., Lee, J. C., Sordelli, D. O. (2008). Antibodies to Capsular Polysaccharide and Clumping Factor A Prevent Mastitis and the Emergence of Unencapsulated and Small-Colony Variants of Staphylococcus aureus in Mice. Infect. Immun. 76: 5738-5744 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tuchscherr, L. P. N. Articles by Sordelli, D. O. Search for Related Content PubMed PubMed Citation Articles by Tuchscherr, L. P. N. Articles by Sordelli, D. O.