IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
IAI.00932-07v1
75/12/5550    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakhamchik, A.
Right arrow Articles by Rowe-Magnus, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakhamchik, A.
Right arrow Articles by Rowe-Magnus, D. A.
Infection and Immunity, December 2007, p. 5550-5558, Vol. 75, No. 12
0019-9567/07/$08.00+0     doi:10.1128/IAI.00932-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Identification of a Wzy Polymerase Required for Group IV Capsular Polysaccharide and Lipopolysaccharide Biosynthesis in Vibrio vulnificus{triangledown}

Alina Nakhamchik,1 Caroline Wilde,1 and Dean A. Rowe-Magnus1,2*

Division of Clinical Integrative Biology, Sunnybrook Health Sciences Centre, 2075 Bayview Avenue, S1-26A, Toronto, Ontario, Canada M4N 3N5,1 Department of Laboratory Medicine and Pathobiology, Faculty of Medicine, University of Toronto, Toronto, Canada2

Received 9 July 2007/ Returned for modification 15 August 2007/ Accepted 27 September 2007


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The estuarine bacterium Vibrio vulnificus is a human and animal pathogen. The expression of capsular polysaccharide (CPS) is essential for virulence. We used a new mini-Tn10 delivery vector, pNKTXI-SceI, to generate a mutant library and identify genes essential for CPS biosynthesis. Twenty-one acapsular mutants were isolated, and the disrupted gene in one mutant, coding for a polysaccharide polymerase (wzy), is described here. A wecA gene initiating glycosyltransferase was among the genes identified in the region flanking the wzy gene. This, together with the known structure of the CPS, supports a group IV capsule designation for the locus; however, its overall organization mirrored that of group I capsules. This new arrangement may be linked to our finding that the CPS region appears to have been recently acquired by horizontal transfer. Alcian Blue staining and immunoblotting with antisera against the wild-type strain indicated that the wzy::Tn10 mutant failed to produce CPS and was attenuated relative to the wild type in a septicemic mouse model. Interestingly, immunoblotting revealed that the mutant was also defective in lipopolysaccharide (LPS) production. However, the core-plus-one O-antigen pattern typical of wzy mutations was apparent. CPS production, LPS production, and virulence were restored following complementation with the wild-type wzy gene. Hence, Wzy participates in both CPS and LPS biosynthesis and is required for virulence in strain 27562. To our knowledge, this is the first functional demonstration of a Wzy polysaccharide polymerase in V. vulnificus and is the first to show a link between LPS and CPS biosynthesis.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The estuarine bacterium Vibrio vulnificus is an opportunistic pathogen of humans and animals (8, 9, 37, 54). Infection occurs via wound contamination or ingestion of raw oysters. The fatality rate of susceptible patients with primary septicemia is greater than 50%, and death often occurs within hours of hospital admission (30, 59, 65). V. vulnificus alone is responsible for 95% of all seafood-related deaths in the United States, and it carries the highest death rate of any food-borne disease agent (56).

The expression of capsular polysaccharide (CPS) is essential for virulence in V. vulnificus (37). The CPS mediates resistance of bacteria to complement-mediated bacteriolysis and phagocytosis, and translucent, nonencapsulated variants are avirulent (48, 68, 70). Capsule assembly in Escherichia coli is the paradigm for capsular assembly in other bacteria (63, 64). Group I and IV capsule biosynthesis parallels lipopolysaccharide (LPS) biosynthesis systems (60). LPS, the major surface molecule of gram-negative bacteria, consists of three distinct structural domains: the O antigen, the core, and lipid A (57, 62). Lipid A linked to the core oligosaccharide is assembled on the inner leaflet of the inner membrane and then translocated to the outer leaflet. The O antigen, which is synthesized via the O-antigen polymerase (Wzy)-dependent pathway, is made up of repeat units containing three to five sugar residues (45). Variations in the composition, sequence, and linkage of the sugars in O antigens give rise to tremendous structural diversity. The O-antigen repeat units are assembled on a lipid carrier, undecaprenol phosphate (und-PP), on the inner side of the inner membrane. Wzx, the O-unit flippase, translocates the individual und-PP repeat units to the periplasm. The und-PP-linked O units are polymerized on the periplasmic face of the inner membrane by the action of Wzy, an integral membrane protein that transfers the nascent polymer from its und-PP carrier to the nonreducing end of the new und-PP-linked O repeat to increase the chain length by one repeat unit. The polymerized O antigen is then ligated to the core oligosaccharide by the integral membrane protein WaaL. The complete LPS is translocated to the external leaflet of the outer membrane. In both group I and group IV CPS biosynthesis, Wzx- and Wzy-dependent systems are used to translocate and synthesize the forming polymer following glycosyltransferase-mediated attachment of monosaccharides to the und-PP carrier. The products of the wza, wzb, and wzc genes are required for the surface expression of group I CPS (23, 24, 46). Wza, Wzb, and Wzc are translocation proteins that export CPS to the outer surface (41, 45). Wza forms a multimeric channel complex in the outer membrane for polymer export (16, 22), Wzc is an inner membrane tyrosine autokinase, and Wzb is its cognate phosphatase (69).

The initiating glycosyltransferase is a distinguishing factor between group I and group IV capsule biosynthesis pathways (63). In group I capsule biosynthesis, WbaP is the initiating transferase that transfers a Gal-1-P or Glc-1-P to und-PP, while WecA catalyzes the initial transfer of GlcNAc-1-P to und-PP in group IV capsule biosynthesis. Carbohydrate composition analysis has shown that V. vulnificus possesses multiple capsular types (10), and CPS biosynthesis genes homologous to both group I (12, 66) and group IV (51) CPS operons have been identified in V. vulnificus.

The genetic loci for group I and IV CPS production are allelic to many LPS biosynthetic loci, and multiple enzymes may be shared between these pathways. However, little is known regarding the contribution of V. vulnificus CPS biosynthesis genes to the synthesis of LPS, primarily due to limitations in detecting V. vulnificus LPS by standard silver staining techniques (2, 5, 6). Here, we used transposon mutagenesis and immunodetection to identify genes involved in both CPS and LPS biosynthesis in the clinical isolate ATCC 27562. We cloned and sequenced a 9.3-kb CPS biosynthesis cluster containing eight genes from one acapsular mutant. This region contained a wzy polymerase, a wzx flippase, a wecA initiating glycosyltransferase, and three additional glycosyltransferase genes, supporting a group IV capsule designation for this locus. The marked decreases in the G+C contents of the genes within this region compared to the average G+C content of the organism suggest its recent acquisition by horizontal gene transfer. Agglutination assays and immunoblotting with antisera raised against strain 27562 revealed high-molecular-weight CPS and an O-antigen ladder characteristic of smooth LPS in the wild-type strain. The wzy::Tn10 mutant failed to produce CPS and LPS and was attenuated relative to the wild-type strain in the iron-overloaded septicemic mouse model. Complementation with the wild-type wzy gene restored CPS production, LPS production, and virulence to the mutant. Hence, Wzy participates in both CPS and LPS biosynthesis and is required for virulence in strain 27562.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial strains and media. E. coli S17.1{lambda}pir (44) was used as the donor strain for conjugation of the pNKTXI-SceI plasmid into V. vulnificus. A rifampin (Rf)-resistant derivative of the encapsulated V. vulnificus clinical strain 27562 obtained from the Collection de l'Institut Pasteur was used as the recipient. Both strains were grown on LB media (Sigma). Antibiotics were used at the following concentrations as indicated: ampicillin (Ap), 100 µg/ml; Rf, 100 µg/ml; kanamycin (Km), 25 µg/ml for E. coli and 160 µg/ml for V. vulnificus. IPTG (isopropyl-ß-D-thiogalactopyranoside) was added to a final concentration of 1 mM.

PCR, sequencing, and phylogenetic analysis. PCR was performed with 50-µl volumes, using Platinum Pfx DNA polymerase (Invitrogen) according to the manufacturer's instructions. PCR products were TA cloned into the pCR2.1 vector (Invitrogen) and sequenced at The Centre for Applied Genomics (TCAG) at the Hospital for Sick Children (Toronto, Canada). Alignments were generated with the CLUSTALX (55) software program (version 1.8), and dendrograms were compiled by using the neighbor-joining method (computed from 1,000 independent trials) of CLUSTALW. Phylogenetic trees were generated with TREEVIEW (40).

Construction of pNKTXISce-I. The plasmid pNKBOR (49) contains a mini-Tn10 transposon (34) but lacks an origin of transfer necessary for conjugation to V. vulnificus 27562. Thus, the pNKTXISce-I fusion vector was created through ligation of EcoRI-digested pNKBOR to MfeI-digested pTXISce-IA (Fig. 1). We created the pTXISce-IA vector by introducing an I-SceI site into the multiple cloning site of pTX1A (38).


Figure 1
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 1. pNKTXI-SceI mini-Tn10 delivery vector. The pNKTXI-SceI vector was obtained by ligating EcoRI-digested pNKBOR to MfeI-digested pTXISce1A. The vector contains an Ap resistance marker (Apr), the Tn10 transposase, an oriTRP4 origin of transfer, a trfA-dependent origin of replication (oriVtrfA) outside of the minitransposon region, and a {pi}-dependent R6K{gamma}oripir origin of replication within the minitransposon. The minitransposon also carries a Km resistance marker (Kmr). IR, inverted repeats recognized by Tn10.

 
Conjugations. The pNKTXI-SceI plasmid was transformed into the E. coli mobilizing strain S17.1{lambda}pir and moved to V. vulnificus as follows. Donor and recipient cultures were grown overnight in LB and LB-Rf, respectively. The next day, bacteria were diluted 100 times in fresh media and grown to an optical density at 600 nm (OD600) of 0.7. One milliliter of each was then spun down and washed in LB, followed by incubation at 37°C for 1 h. Cultures were then pelleted, combined, and conjugated overnight without antibiotic selection on LB plates. The following day, cells were resuspended in 5 ml of LB. One milliliter of the resuspension was centrifuged at 10,000 rpm for 2 min, and the pellet was resuspended in 100 µl of LB. Exconjugants with transposon insertions were selected on LB-Rf-Km plates.

Southern analysis. Southern analysis was performed to verify single insertions of the Tn10 transposon into the genome of V. vulnificus, using the Km resistance marker from the pNKTXI-SceI plasmid as a probe. Genomic DNA was extracted from 21 mutants by using the DNAzol reagent, following the protocol provided by the manufacturer (Invitrogen), and digested with EcoRI. Following electrophoresis on a 1% agarose gel, the DNA was transferred to an N+ nylon membrane (Amersham). The membranes were probed using a Gene Images random primer labeling module (Amersham), following the manufacturer's protocol. Prehybridization, hybridization, and subsequent washes were performed at 55°C. Signal was detected using BioMax MS film (Kodak).

Determination of transposon insertion sites. Translucent V. vulnificus colonies were grown overnight on LB-Km plates. Bacteria were scraped from the plate, and genomic DNA was extracted using the DNAzol reagent. The DNA was cut using EcoRI, self-ligated, and transformed into DH5{alpha}{lambda}pir. Transformants were selected on LB-Km plates. Plasmids were purified using a Sigma GenElute plasmid mini prep kit and sequenced using the primer pirseq (ACACTTAACGGCTGACATGG), designed to obtain sequence going outwards from the R6K origin of replication within the transposon region on the pNKTXI-SceI plasmid. Complete plasmid sequence was obtained by primer walking, and open reading frames (ORFs) were identified using ORFfinder. Putative functions for the disrupted genes were assigned by BLAST analysis (http://www.ncbi.nlm.nih.gov/BLAST/). Transmembrane helix predictions for the Wzy sequences were obtained using the TMpred online program (http://www.ch.embnet.org/software/TMPRED_form.html).

Construction of pTRC99AoriTRP4 expression vector. A NotI site was introduced into the backbone of the expression vector pTRC99A (20) by inverse PCR using the primers pTRC99aNot3 (AAAAGCGGCCGCTTCTCCTTACGCATCTGTGC) and pTRC99aNot4 (AAAAGCGGCCGCAATACCGCATCAGGCGCTC) (underlining indicates the restriction enzyme site). The RP4 origin of transfer was amplified with primers oriT1Not (CTGCGGCCGCCTTTTCCGCTGCATAACCCTG) and oriT2Not (CTGCGGCCGCCGGCCAGCCTCGCAGAGC), using the plasmid pSW23oriT (21) as a template. Both PCR products were cut with NotI, ligated together, and transformed into DH5{alpha} to create pTRC99AoriT.

Complementation of the wzy::Tn10 mutant. The sequence of the putative wzy gene was amplified from genomic DNA of the 27562 parent strain with primers WzyBamHI (CGGGATCCTCATAAGGGTATGCGTTTGTTA) and WzyFBspHI (GGGTTTTCATGATTACATACAACGTTAGATTAA). The wzy gene was cloned into the NcoI and BamHI sites of pTRC99A:oriT. The construct was conjugated to the V. vulnificus wzy::Tn10 mutant as described above, and gene expression was induced with IPTG.

Antiserum production. A 2-liter flask containing 200 ml of LB was inoculated with 1 ml of seed culture suspension (ca. 1 x 109 CFU) of strain 27562, and the bacteria were grown at 30°C for 7 to 8 h with shaking. The bacteria were collected by centrifugation, washed twice with phosphate-buffered saline (PBS; NaCl [130 mM], Na2HPO4 [5 mM], KH2PO4 [1.5 mM]), and resuspended in 50 ml of PBS. The number of CFU per ml of suspension (usually ca. 5 x1010 CFU/ml) was determined by plate counts. The bacteria in 10-ml portions of the suspension were killed by exposure to 0.8% (vol/vol) formalin for 1 day at ca. 25°C and then at 4°C for another 24 h. The bacteria were washed three times in PBS, and the vaccines were stored at 4°C. Complete inactivation was confirmed by testing the growth of suspensions on LB plates at 37°C for 3 days. One-milliliter portions were diluted with sterile PBS to ca. 5 x 109 CFU/ml. Adult New Zealand White rabbits were immunized intravenously with 1 ml of formalin-killed bacteria without adjuvant. Five injections were given on days 1 (0.25 ml), 2 (0.5 ml), 3 (1.0 ml), 4 (1.0 ml), and 11 (1.0 ml). One week after the last immunization, 10 to 20 ml of blood was collected from the marginal ear vein of each rabbit and tested for the presence of antibodies by using the slide agglutination test described below. Following a positive test result, two more boosts of 1.0 ml at 1-week intervals were administered. One week after the second boost, animals were exsanguinated to collect the antisera. The blood was allowed to clot, and the sera were separated and stored at –30°C.

Slide agglutination tests. Overnight cultures of V. vulnificus wild-type, wzy::Tn10, and wzy::Tn10C cells were diluted to an OD600 of 1. Twenty-microliter aliquots of each were applied in duplicate onto microscope slides. One aliquot was mixed with 20 µl of rabbit antisera raised against formalin-killed whole cells of the V. vulnificus parent strain. The other aliquot was mixed with sera obtained from the baseline bleed and served as the negative control. Agglutination results were scored after incubation of the mixtures at room temperature for 5 min. A distinct and immediately occurring agglutination was registered as positive, while weak or no agglutination after 5 min was considered a negative test result.

CPS extraction and visualization. The CPS extraction procedure was essentially as described by Gunawardena et al. (29) with some modifications. Single bacterial colonies were inoculated into LB and grown for 18 h at 30°C. Cultures were diluted to an OD600 of 0.9, and 1 ml was plated and grown on LB plates for 18 h at 30°C. The cells were collected in 15 ml of LB, pelleted, and resuspended in an equal volume of PBS. Samples were shaken for 1 h at 200 rpm at 25°C. The OD600 was measured, and CFU counts were determined after each step to ensure that cell lysis was not occurring and that equal numbers of bacteria were used for CPS isolation. The bacteria were pelleted, and the supernatant was dialyzed against three changes of distilled water (2l for 12 h), followed by concentration through a 10-kDa Amicon Ultra-15 centrifugal filter device column. This was followed by sequential treatment of the retentate with DNase (50 µg/ml plus 1 mM MgCl2), RNase (100 µg/ml), and Pronase E (250 µg/ml) at 2-h intervals at 37°C. The retentate was spun at 100,000 x g for 18 h at 20°C and extracted twice with phenol chloroform, and the aqueous layer was dialyzed as described above. The retentate was concentrated using a 100-kDa-molecular-mass-cutoff Centriprep unit (Amicon) spun at 500 x g for 1 h. CPS samples were run on a 40% nondenaturing polyacrylamide gel electrophoresis (PAGE) gel or a 4% stacking/12.5% separating Tris-HCl-glycine sodium dodecyl sulfate (SDS)-PAGE gel, using the procedure described by Laemmli (36). CPS was visualized by immunostaining using antisera against formalin-killed whole cells of V. vulnificus 27562 and Alcian Blue staining of acidic polysaccharides as described by Pelkonen et al. (42, 43).

LPS extraction and visualization. Whole-cell lysates were prepared by following the method of Hitchcock and Brown (32) with several modifications. Five-milliliter cultures were grown overnight in appropriate antibiotics, and the OD600 was adjusted to 0.9. Five milliliters of each was centrifuged at 5,000 rpm for 10 min, and the cells were washed six times in PBS. The pellet was resuspended in 375 µl of HB buffer (1% SDS, 4% ß-mercaptoethanol, 10% glycerol, 1 M Tris-HCl, pH 6.8, 0.002% bromophenol blue) and boiled for 30 min. Proteinase K (1.5 µl; 20 mg/ml) was then added, and the reaction mixtures were incubated at 56°C overnight. The LPS samples were boiled for 15 min and run on a 4% stacking/12.5% separating Tris-glycine SDS-PAGE gel. LPS was visualized by immunoblotting.

LD50 determinations. Strains were inoculated from single colonies into LB and were cultured overnight at 30°C. The overnight culture was seeded at a 1:100 dilution into fresh media and incubated at 30°C until the bacteria reached an OD600 of 1.0. Bacteria were collected by centrifugation and washed once with PBS. Bacterial-cell concentrations were confirmed by plate counts. Five-week-old female CD-1 mice housed under pathogen-free conditions were pretreated with an intraperitoneal injection of iron dextran (250 µg of iron-dextran per g of body weight) 60 min before inoculation with the bacterial strains. Groups of mice (n = 5) were injected intraperitoneally with 0.1 ml of serial log dilutions (102 to 108 CFU) of each bacterial strain. Injection of PBS alone served as a control. Mice were observed for up to 24 h postinfection with the recording of deaths or moribund animals. The 50% lethal dose (LD50) was quantified using the simplified linear approximation method of Reed and Muench (47).

Nucleotide sequence accession number. The sequence determined for this study has been deposited in GenBank under accession number EU179506.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Transposon mutagenesis with the pNKTXISce-I mini-Tn10 delivery plasmid. To facilitate the generation of transposon mutants and the identification of the disrupted genes, we created the mini-Tn10 delivery plasmid pNKTXISce-I (Fig. 1). This vector was generated by fusing the plasmid backbones of pNKBOR and pTXISce-IA. pNKTXISce-I carries a Kmr marker and a {pi}-dependent origin of replication in its mini-Tn10 transposon, while a TrfA-dependent origin of replication is present in the vector backbone. Thus, this plasmid can be maintained and its copy number controlled in cells expressing either the {pi} (35, 39) or TrfA (26, 27) protein. The presence of an origin of replication in the mini-Tn10 transposon also allows for the isolation of the transposon insertion site and flanking DNA as Km-resistant clones in E. coli strains expressing the {pi} protein. It also carries an RP4 origin of conjugative transfer for conjugation of the plasmid to a wide range of bacteria and an I-SceI restriction enzyme site for plasmid verification and cloning of additional modules. The plasmid is fully defined, as the complete sequences of both parent plasmids are known, and the Tn10 insertions are stable.

Identification of a capsule biosynthesis locus in V. vulnificus 27562. Transposon mutagenesis was conducted as described in Materials and Methods. Acapsular mutants were selected from the conjugation experiments, and Southern analysis was used to verify that each mutant contained a single transposon insertion in its chromosome. The transposon insertion points were identified by sequencing and BLAST analysis. The disrupted gene in one mutant (Fig. 2) was identified as a putative polysaccharide polymerase (wzy). Subsequently, 9.3 kb of the region surrounding the insertion site was cloned, sequenced, and annotated (Fig. 3). Potential functions were assigned based on homology to previously described genes (Table 1) . The ORFs appeared to encode gene products common to CPS/O-antigen biosynthesis clusters, including four glycosyltransferases, a putative wzy polymerase, and a wzx flippase homologue. Of the eight ORFs identified, seven appeared to be transcribed in the same orientation. This organization is reminiscent of the operon-like structure common to CPS biosynthesis clusters in a variety of encapsulated bacterial species. The lone exception encoded a homologue of WecA, the initiating glycosyltransferase that in part defines group IV CPS biosynthesis loci (60).


Figure 2
View larger version (54K):
[in this window]
[in a new window]

 
FIG. 2. Restoration of CPS production in the wzy::Tn10 mutant by the wild-type wzy gene. (A) Wild-type strain 27562; (B) wzy::Tn10 mutant; (C) wzy::Tn10 mutant complemented with the wild-type wzy gene.

 

Figure 3
View larger version (7K):
[in this window]
[in a new window]

 
FIG. 3. V. vulnificus 27562 capsule polysaccharide biosynthesis cluster. Open arrows represent the locations and directions of transcription of the respective ORFs. Horizontally striped, spotted, black, and white arrows indicate nucleotide sugar biosynthesis, transferase, insertion sequence, and processing genes, respectively. The closed triangle denotes the transposon insertion site. Gene characteristics are summarized in Table 1.

 

View this table:
[in this window]
[in a new window]

 
TABLE 1. Putative functions of the V. vulnificus CPS proteins

 
The complete Wzy protein was analyzed using TMpred software. The result was compared with those of Wzy proteins from Escherichia coli (GenBank accession no. AAO37717.1), Yersinia enterocolitica (GenBank accession no. AAC60768), Shigella boydii (GenBank accession no. AAW29815), Salmonella enterica (GenBank accession no. CAA43077), and Bacillus cereus (GenBank accession no. AAS44289.1). Eleven inside-to-outside transmembrane helices were suggested for the putative V. vulnificus Wzy protein. This was in agreement with the 10 or 11 transmembrane helices predicted for the Wzy proteins of E. coli, Y. enterocolitica, S. boydii, Salmonella enterica, and B. cereus. Phylogenetic comparisons with previously described bacterial Wzy and WaaL enzymes (Fig. 4) also supported the designation of a Wzy polymerase function for the disrupted gene.


Figure 4
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 4. Phylogenetic relationship of bacterial Wzy and WaaL enzymes. An unrooted dendrogram based on representative Wzy and WaaL bacterial enzymes is shown. The organism abbreviations and GenBank accession numbers (in brackets) are as follows: Bce, Bacillus cereus (NP_981681); Sac, Syntrophus aciditrophicus (YP_460441); Sth, Streptococcus thermophilus LMG 18311 (YP_139549); Spn, Streptococcus pneumoniae (AAK20717); Cph, Clostridium phytofermentans ISDg (ZP_01352529); Cat, Croceibacter atlanticus HTCC2559 (ZP_00951257); Eca, Erwinia carotovora subsp. atroseptica SCRI1043 (YP_048289); Eco, Escherichia coli (AAO39700); Sbo, Shigella boydii (AAV41072); Sdy, Shigella dysenteriae (AAR97964); Lrh, Lactobacillus rhamnosus (AAW22494); Sen, Salmonella enterica (CAA43077); Pae, Pseudomonas aeruginosa PAO1 (AAG08384); Vch, Vibrio cholerae (AAL77359); Vvu, V. vulnificus; Kpn, Klebsiella pneumoniae (AAD37765); Xca, Xanthomonas campestris pv. vesicatoria strain 85-10 (YP_365325); Yen, Yersinia enterolitica (AAC60768). The two V. vulnificus Wzy polymerases are boxed, and the bootstrap values for each node are indicated.

 
Demonstration of a wzy-dependent CPS biosynthesis pathway in V. vulnificus. To verify that disruption of the wzy gene prevented CPS production, we conducted agglutination assays with the wild-type and mutant strains. Antisera against formalin-killed whole cells reacted strongly with the 27562 parent strain in slide agglutination tests, while no agglutination was observed with the wzy::Tn10 mutant. A positive agglutination reaction was obtained when the pTRC99aoriT expression vector carrying the wild-type wzy gene was introduced into the wzy::Tn10 mutant, while no agglutination was detected when the wzy::Tn10 mutant carried the empty pTRC99AoriT vector. CPS was extracted from the wild type, the wzy::Tn10 mutant, and the wzy::Tn10 mutant strain that was complemented with the wild-type wzy gene (wzy::Tn10C). The CPS was then separated by PAGE and visualized by Alcian Blue staining for acidic polysaccharides and immunoblotting (Fig. 5 and 6). Both detection methods revealed the presence of a high-molecular-weight polysaccharide and a prominent lower-molecular-weight product (designated the K band) in the wild-type strain, while no such material was observed in the wzy::Tn10 mutant. Complementation of the wzy::Tn10 mutant with the wild-type wzy gene restored production of the high-molecular-weight polysaccharide and the K band. These results confirmed the absence of CPS inferred from the translucent phenotype of the mutant and supported the involvement of the wzy gene in CPS production in V. vulnificus 27562.


Figure 5
View larger version (108K):
[in this window]
[in a new window]

 
FIG. 5. Alcian Blue stain of V. vulnificus CPS. CPS was extracted from wild-type (WT), wzy::Tn10 mutant (wzy polymerase knockout), and wzy::Tn10C (wzy::Tn10 complemented with pTRC99aoriT::wzy) cells and separated on a nondenaturing polyacrylamide gel. CPS was visualized by Alcian Blue staining.

 

Figure 6
View larger version (116K):
[in this window]
[in a new window]

 
FIG. 6. Immunoblot of V. vulnificus CPS. CPS was extracted from wild type (WT), wzy::Tn10 mutant (wzy polymerase knockout), and wzy::Tn10C (wzy::Tn10 complemented with pTRC99aoriT:wzy) cells and separated by denaturing SDS-PAGE. CPS was visualized using immunoblotting with antisera to WT formalin-killed whole cells.

 
Wzy is involved in LPS biosynthesis. To investigate whether the wzy CPS mutant was also defective in LPS production, LPS was extracted from the wild-type, the wzy::Tn10 mutant, and the wzy::Tn10C strains and separated by SDS-PAGE. Similar to previous reports (2, 5, 6), silver staining failed to detect the characteristic ladder pattern observed for smooth LPS profiles among the Enterobacteriaceae (data not shown). However, immunoblotting using antisera against the wild-type strain revealed a ladder pattern characteristic of smooth LPS. Two fast-migrating bands corresponding to the lipid A-core and the core-plus-one O-antigen structures were also observed (Fig. 7). Attempts to better resolve the fastest-migrating bands by using the Novex Tricine and 4 to 20% Bis-Tris gel systems were unsuccessful. The same prominent K band present in the CPS sample from wild-type bacteria was also evident in the LPS from this strain. Neither the ladder nor the K band was present in the LPS extract of the wzy::Tn10 mutant. Complementation with the wild-type wzy gene resulted in the reappearance of both the ladder and the K band in the LPS gels. An increase in the intensity of the banding pattern was observed following IPTG induction. In particular, the accumulation of higher-molecular-weight bands in the LPS ladder following IPTG induction supports a polymerization activity for the wzy gene. The empty vector did not result in the reappearance of the banding pattern. The results indicated that Wzy was involved in the production of both CPS and the O-antigen in V. vulnificus.


Figure 7
View larger version (112K):
[in this window]
[in a new window]

 
FIG. 7. Immunoblot of V. vulnificus LPS. LPS was extracted from wild-type (WT), wzy::Tn10 mutant (wzy polymerase knockout), and wzy::Tn10C (wzy::Tn10 complemented with pTRC99aoriT::wzy) cells. The LPS was separated on a denaturing SDS-PAGE gel and visualized by immunoblotting. Expression of the wzy gene was induced by the addition of IPTG from the media (+IPTG). The position of the K band band is shown. The black bar denotes the higher-molecular-weight O-antigen bands that accumulate upon induction of wzy.

 
The wzy::Tn10 mutant is attenuated in vivo. The LD50 of V. vulnificus is dramatically reduced in the presence of iron, and the iron-overloaded mouse model is widely used to demonstrate the enhanced in vivo virulence of V. vulnificus strains in the presence of excess serum iron (67). The LD50 values for the wild type and the wzy::Tn10 and wzy::Tn10C mutant strains were determined. The LD50 of the wild-type strain (ATCC 27562) was 2.4 x 104. Disruption of the wzy gene (wzy::Tn10) caused an increase in the LD50 to >4.2 x 107. Virulence was restored to the attenuated mutant following complementation with the wild-type gene (wzy::Tn10C; LD50, 1.4 x 104). Thus, the activity of the Wzy polymerase is required for virulence in V. vulnificus.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
CPS expression is essential for V. vulnificus virulence (68, 70). There are several studies identifying genes involved in the biosynthesis of CPS in V. vulnificus strains (12, 51, 66, 71); however, most of these studies provide only similarity-based assignments for the identified genes. This study endeavored to provide functional support for proteins involved in CPS biosynthesis in V. vulnificus. Acapsular transposon mutants were analyzed, and the disrupted gene in one of these mutants was shown to code for a polysaccharide polymerase (Wzy) based on the following observations: (i) although Wzy polymerases display limited sequence similarity and they share membrane topology features and motifs with WaaL ligases (45, 50), the core-plus-one O-antigen pattern typical of wzy mutations (1, 31) was apparent in our LPS immunoblots; (ii) the Wzy enzyme was partitioned within a phylogenetic clade composed of other Wzy enzymes; (iii) if it is assumed that polysaccharide polymerases and ligases lack substrate specificity (28), then it follows that increases in polymerase activity result in the accumulation of longer polysaccharide polymers being attached to the lipid A core, while increases in ligase activity result in the accumulation of shorter polysaccharide polymers being attached to the lipid A core. The increased O-antigen banding pattern, and in particular the accumulation of higher-molecular-weight bands in the LPS profile of the wzy::Tn10C strain, is consistent with a polymerase function for Wzy. The attenuated phenotype of the wzy::Tn10 mutant in the iron-overloaded septicemic mouse model demonstrated that Wzy was required for virulence. Immunoblotting revealed that the wzy::Tn10 mutant was also defective in LPS production. Complementation with the wild-type gene restored CPS production, LPS production, and virulence to the mutant. Hence, Wzy is a polysaccharide polymerase that participates in the production of both CPS and LPS in V. vulnificus 27562. To our knowledge, this is the first study to functionally demonstrate the activity of a Wzy CPS polymerase in V. vulnificus.

A new genetic organization for the group IV CPS locus of V. vulnificus 27562. Both group I and group IV CPS biosynthesis loci code for Wzy-dependent systems that include a Wzx flippase; however, several differences have been used to discriminate these CPS groups. In group I CPS biosynthesis, WbaP is the initiating transferase and the wza, wzb, wzc, wzx, and wzy genes reside within the same genetic locus. This feature distinguishes group I Wzy-dependent loci from O-antigen loci (60). In group IV CPS biosynthesis, the initiating transfer is catalyzed by WecA and the wza, wzb, and wzc genes are found at a chromosomal location different from that of the wzx and wzy genes, making group IV CPS loci allelic to many Wzy-dependent O-antigen loci (60). Despite this, the wza, wzb, and wzc genes still participate in group IV capsule assembly, as recently demonstrated with E. coli (41).

Based on the location of the wza, wzb, and wzc genes, a group I capsule was proposed for several V. vulnificus strains (12, 66). BLAST analysis indicated that neither V. vulnificus strain CMCP6 nor YJ016 contained a wecA homologue, supporting their group I classification (12, 66). Homologues of wecA, wzy, and wzx were identified in a CPS cluster in V. vulnificus 1003 (O) (51). Based on the presence of wecA, a group IV capsule was proposed for this strain; however, the chromosomal location of these genes relative to wza, wzb, and wzc was not determined. Furthermore, functional assignments for the ORFs were similarity based; none were shown to catalyze the proposed reaction, and none of the disrupted genes were genetically complemented with their functional counterparts to demonstrate their specific role in CPS production. Hence, a CPS grouping for the capsule could not be assigned with certainty. The CPS of strain 27562 is a serine-linked polysaccharide composed of D-GlcNAc, MurNAc, D-GalA, and L-Rha (29). The 9.3-kb CPS loci identified here contained wecA, wzx, and wzy genes, and we have demonstrated that Wzy is a functional polysaccharide polymerase. Southern analysis and sequencing have indicated that the wza, wzb, and wzc genes reside within the same genetic locus as the wecA, wzx, and wzy genes that we identified in strain 27562 (A. Nakhamchik, C. Wilde, and D. A. Rowe-Magnus, unpublished results). Hence, this strain appears to have a group IV Wzy-dependent CPS with a locus organization that mirrors that of group I CPS loci.

A comparison of the CPS biosynthesis regions of strains 27562 and 1003 (O) revealed that the two loci were similar but not identical in organization (Fig. 8). In 1003 (O), the wcvF rhamnosyltransferase is 5' of wzx, while it is 3' of wzx in 27562. IS1348, wecA, wcvB, and wcvA occur in the same order in the two strains, but strain 1003 (O) also contains INSE, IS3Tn, and a nonfunctional wcvA duplication. The presence of wecA and a rhamnosyltransferase gene, wcvF, in strain 27562 accounts for two of the transfer activities required for the assembly of its CPS. Transfer of the D-GalA and MurNAc moieties could be catalyzed by the wcvD and wcvE transferases to complete the structure.


Figure 8
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 8. Genomic comparison of the group IV capsule loci of V. vulnificus strains 27562 and 1003 (O) and V. cholerae NRT36S. Open arrows represent the locations and directions of transcription of the respective ORFs. Horizontally striped, spotted, black, and white arrows indicate nucleotide sugar biosynthesis, transferase, insertion sequence, and processing genes, respectively. Dotted lines highlight the similar gene arrangements of the strains. The gene designations for strains 1003 (O) and NRT36S are as described in references 51 and 14.

 
Recent acquisition of the CPS biosynthesis cluster. The new arrangement that we observed for the group IV CPS locus of strain 27562 may be linked to our finding that the CPS region appears to have been recently acquired by horizontal transfer. While the average G+C content for V. vulnificus strains CMCP6 and YJ016 is 46.7% (13), the G+C contents of the genes in the CPS cluster identified here dropped from 41.7% for the wcvB gene to 30.8% for the wzx gene (Fig. 2). The five genes with the lowest G+C contents (wzx, wcvD, wzy, wcvE, and wcvF) were adjacent to IS1358, appear to be organized as an operon, and showed the highest similarity to genes from gram-positive or archaeal organisms (Table 1). The horizontal acquisition of the CPS biosynthesis clusters can clearly contribute to the tremendous structural diversity observed for the CPS of V. vulnificus clinical and environmental isolates and may play an important role in the evolution of new strains, similar to what has been observed for Vibrio cholerae O139. The epidemic Vibrio cholerae O139 serovar emerged from the pandemic biotype El Tor O1 serovar through the replacement of a 22-kb region by a 40-kb O139-specific DNA fragment (7) that contained the IS1358 insertion sequence. IS1358 was shown to be active for transposition (25) and is also associated with LPS loci in serovars of V. cholerae (52, 53), V. vulnificus (51), and Vibrio anguillarum (33, 53), making it possible to envision IS1358-mediated genetic exchange between Vibrio species that leads to the genesis of new capsule regions. It is tempting to speculate that IS1358 participated in the acquisition of the CPS loci in strain 27562; however, low-G+C-content polysaccharide biosynthesis genes are found on both sides of IS1358 and only a single copy of IS1358 is present on the chromosome (A. Nakhamchik and D. Rowe-Magnus, unpublished results). At present, the role, if any, of IS1358 in the evolution of CPS clusters in the Vibrionaceae remains unclear.

Does V. vulnificus harbor a hybrid CPS/LPS biosynthetic cluster? Wzy polymerases participate in O-antigen and CPS (K-antigen) production in group I and group IV capsules (3, 4, 23, 61, 63). Hence, it is possible for the same Wzy polymerase to be involved in the production of both the O and K antigens in the same strain. E. coli O9a:K30 has the same antigen, K30, present in two forms: as a smaller polymer attached to lipid A (KLPS) and as a capsular antigen. A Wzy polymerase mutation in this strain results in the loss of both the K30LPS and the capsular K30 antigen (23). Campbell et al. isolated Sinorhizobium meliloti mutants that were defective in the production of K antigen; these mutants also had an altered LPS profile (11). The LPS and CPS of V. cholerae O139 are structurally identical (19, 58), and the functions for the biosynthesis of the O antigen and the CPS were shown to be dependent upon shared genes that were carried on the same locus (17, 18). Interestingly, the overall organization (Fig. 8) and effect of transposon insertions on CPS and LPS biosynthesis that we observed in strain 27562 paralleled those reported for V. cholerae NRT36S (14). In NRT36S, the CPS and LPS biosynthesis genes share the same genetic locus. It was proposed that such an arrangement could play a key role in the evolution of new V. cholerae strains by providing a mechanism for the simultaneous emergence of new K and O antigens in a single strain. This notion is supported by the isolation and characterization of genetically similar strains of V. parahaemolyticus that express entirely different O and K antigens (15). Our results clearly demonstrate a link between CPS and LPS production in V. vulnificus 27562. Thus, it is conceivable that enzymes common to these two biosynthetic pathways are encoded by the same locus in this strain. We are examining the effects of targeted, nonpolar knockouts of other genes in this region on CPS and O-antigen production, and we are determining the structure of its O antigen.

Does V. vulnificus produce a KLPS? The persistence of the K band in both the LPS and CPS preparations was unexpected. The K band remained in the LPS preparations despite the performance of six PBS washes. Hence, it is tightly linked to the cell surface rather than loosely associated with it. This suggested that either the K band represents an O antigen of a preferred chain length whose size is governed by an as yet unidentified chain length determinant (23, 69) or strain 27562 produces an additional polysaccharide (KLPS) that is linked to lipid A in a manner similar to that for the KLPS in E. coli serotype K40 (3, 60). The presence of the K band in CPS preparations can be best explained by the production of a KLPS. The OD600 and CFU counts were monitored before and after the PBS wash during preparation of the CPS. Both the OD600 and CFU/ml values increased, indicating that the bacteria remained intact and viable. Thus, the release of LPS due to cell lysis was not the source of the K band in the CPS preparation. Furthermore, a 100-kDa-cutoff Amicon Centriprep column was used to minimize LPS cross-contamination of the CPS. We believe that the K band produced by V. vulnificus 27562 is actually a KLPS and its presence in the CPS preparations is a result of unlinked KLPS associating with the higher-molecular-weight CPS during purification.


    ACKNOWLEDGMENTS
 
We thank Joe Lam and members of his laboratory for assistance with the Novex Tricine and Bis-Tris gel electrophoresis. A. Nakhamchik is a University of Toronto doctoral fellow.

This work was supported by funding from the Canadian Institutes of Health Research (CIHR), the Natural Sciences and Engineering Research Council of Canada (NSERC), and a Premier's Research Excellence Award (PREA) to D.R.-M.


    FOOTNOTES
 
* Corresponding author. Mailing address: Division of Clinical Integrative Biology, Sunnybrook Health Sciences Centre, 2075 Bayview Avenue, S1-26A, Toronto, Ontario, Canada M4N 3N5. Phone: (416) 480-6100, ext. 3318. Fax: (416) 180-5737. E-mail: dean.rowe-magnus{at}sri.utoronto.ca Back

{triangledown} Published ahead of print on 8 October 2007. Back

Editor: A. Camilli


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Abeyrathne, P. D., C. Daniels, K. K. Poon, M. J. Matewish, and J. S. Lam. 2005. Functional characterization of WaaL, a ligase associated with linking O-antigen polysaccharide to the core of Pseudomonas aeruginosa lipopolysaccharide. J. Bacteriol. 187:3002-3012.[Abstract/Free Full Text]
2. Amaro, C., E. G. Biosca, B. Fouz, and E. Garay. 1992. Electrophoretic analysis of heterogeneous lipopolysaccharides from various strains of Vibrio vulnificus biotypes 1 and 2 by silver staining and immunoblotting. Curr. Microbiol. 25:99-104.[CrossRef][Medline]
3. Amor, P. A., and C. Whitfield. 1997. Molecular and functional analysis of genes required for expression of group IB K antigens in Escherichia coli: characterization of the his-region containing gene clusters for multiple cell-surface polysaccharides. Mol. Microbiol. 26:145-161.[CrossRef][Medline]
4. Amor, P. A., J. A. Yethon, M. A. Monteiro, and C. Whitfield. 1999. Assembly of the K40 antigen in Escherichia coli: identification of a novel enzyme responsible for addition of L-serine residues to the glycan backbone and its requirement for K40 polymerization. J. Bacteriol. 181:772-780.[Abstract/Free Full Text]
5. Bahrani, K., and J. D. Oliver. 1990. Studies on the lipopolysaccharide of a virulent and an avirulent strain of Vibrio vulnificus. Biochem. Cell Biol. 68:547-551.[Medline]
6. Bahrani, K. F., and J. D. Oliver. 1991. Electrophoretic analysis of lipopolysaccharide isolated from opaque and translucent colony variants of Vibrio vulnificus using various extraction methods. Microbios 66:83-93.[Medline]
7. Bik, E. M., A. E. Bunschoten, R. D. Gouw, and F. R. Mooi. 1995. Genesis of the novel epidemic Vibrio cholerae O139 strain: evidence for horizontal transfer of genes involved in polysaccharide synthesis. EMBO J. 14:209-216.[Medline]
8. Biosca, E. G., C. Amaro, E. Marco-Noales, and J. D. Oliver. 1996. Effect of low temperature on starvation-survival of the eel pathogen Vibrio vulnificus biotype 2. Appl. Environ. Microbiol. 62:450-455.[Abstract]
9. Bisharat, N., V. Agmon, R. Finkelstein, R. Raz, G. Ben-Dror, L. Lerner, S. Soboh, R. Colodner, D. N. Cameron, D. L. Wykstra, D. L. Swerdlow, and J. J. Farmer III. 1999. Clinical, epidemiological, and microbiological features of Vibrio vulnificus biogroup 3 causing outbreaks of wound infection and bacteraemia in Israel. Lancet 354:1421-1424.[CrossRef][Medline]
10. Bush, C. A., P. Patel, S. Gunawardena, J. Powell, A. Joseph, J. A. Johnson, and J. G. Morris. 1997. Classification of Vibrio vulnificus strains by the carbohydrate composition of their capsular polysaccharides. Anal. Biochem. 250:186-195.[CrossRef][Medline]
11. Campbell, G. R., B. L. Reuhs, and G. C. Walker. 1998. Different phenotypic classes of Sinorhizobium meliloti mutants defective in synthesis of K antigen. J. Bacteriol. 180:5432-5436.[Abstract/Free Full Text]
12. Chatzidaki-Livanis, M., M. K. Jones, and A. C. Wright. 2006. Genetic variation in the Vibrio vulnificus group 1 capsular polysaccharide operon. J. Bacteriol. 188:1987-1998.[Abstract/Free Full Text]
13. Chen, C. Y., K. M. Wu, Y. C. Chang, C. H. Chang, H. C. Tsai, T. L. Liao, Y. M. Liu, H. J. Chen, A. B. Shen, J. C. Li, T. L. Su, C. P. Shao, C. T. Lee, L. I. Hor, and S. F. Tsai. 2003. Comparative genome analysis of Vibrio vulnificus, a marine pathogen. Genome Res. 13:2577-2587.[Abstract/Free Full Text]
14. Chen, Y., P. Bystricky, J. Adeyeye, P. Panigrahi, A. Ali, J. A. Johnson, C. A. Bush, J. G. Morris, Jr., and O. C. Stine. 2007. The capsule polysaccharide structure and biogenesis for non-O1 Vibrio cholerae NRT36S: genes are embedded in the LPS region. BMC Microbiol. 7:20.[Medline]
15. Chowdhury, N. R., S. Chakraborty, B. Eampokalap, W. Chaicumpa, M. Chongsa-Nguan, P. Moolasart, R. Mitra, T. Ramamurthy, S. K. Bhattacharya, M. Nishibuchi, Y. Takeda, and G. B. Nair. 2000. Clonal dissemination of Vibrio parahaemolyticus displaying similar DNA fingerprint but belonging to two different serovars (O3:K6 and O4:K68) in Thailand and India. Epidemiol. Infect. 125:17-25.[CrossRef][Medline]
16. Collins, R. F., K. Beis, C. Dong, C. H. Botting, C. McDonnell, R. C. Ford, B. R. Clarke, C. Whitfield, and J. H. Naismith. 2007. The 3D structure of a periplasm-spanning platform required for assembly of group 1 capsular polysaccharides in Escherichia coli. Proc. Natl. Acad. Sci. USA 104:2390-2395.[Abstract/Free Full Text]
17. Comstock, L. E., J. A. Johnson, J. M. Michalski, J. G. Morris, Jr., and J. B. Kaper. 1996. Cloning and sequence of a region encoding a surface polysaccharide of Vibrio cholerae O139 and characterization of the insertion site in the chromosome of Vibrio cholerae O1. Mol. Microbiol. 19:815-826.[CrossRef][Medline]
18. Comstock, L. E., D. Maneval, Jr., P. Panigrahi, A. Joseph, M. M. Levine, J. B. Kaper, J. G. Morris, Jr., and J. A. Johnson. 1995. The capsule and O antigen in Vibrio cholerae O139 Bengal are associated with a genetic region not present in Vibrio cholerae O1. Infect. Immun. 63:317-323.[Abstract]
19. Cox, A. D., J. R. Brisson, V. Varma, and M. B. Perry. 1996. Structural analysis of the lipopolysaccharide from Vibrio cholerae O139. Carbohydr. Res. 290:43-58.[CrossRef][Medline]
20. de Boer, H. A., L. J. Comstock, and M. Vasser. 1983. The tac promoter: a functional hybrid derived from the trp and lac promoters. Proc. Natl. Acad. Sci. USA 80:21-25.[Abstract/Free Full Text]
21. Demarre, G., A. M. Guerout, C. Matsumoto-Mashimo, D. A. Rowe-Magnus, P. Marliere, and D. Mazel. 2005. A new family of mobilizable suicide plasmids based on broad host range R388 plasmid (IncW) and RP4 plasmid (IncPalpha) conjugative machineries and their cognate Escherichia coli host strains. Res. Microbiol. 156:245-255.[Medline]
22. Dong, C., K. Beis, J. Nesper, A. L. Brunkan-Lamontagne, B. R. Clarke, C. Whitfield, and J. H. Naismith. 2006. Wza the translocon for E. coli capsular polysaccharides defines a new class of membrane protein. Nature 444:226-229.[CrossRef][Medline]
23. Drummelsmith, J., and C. Whitfield. 1999. Gene products required for surface expression of the capsular form of the group 1 K antigen in Escherichia coli (O9a:K30). Mol. Microbiol. 31:1321-1332.[CrossRef][Medline]
24. Drummelsmith, J., and C. Whitfield. 2000. Translocation of group 1 capsular polysaccharide to the surface of Escherichia coli requires a multimeric complex in the outer membrane. EMBO J. 19:57-66.[CrossRef][Medline]
25. Dumontier, S., P. Trieu-Cuot, and P. Berche. 1998. Structural and functional characterization of IS1358 from Vibrio cholerae. J. Bacteriol. 180:6101-6106.[Abstract/Free Full Text]
26. Durland, R. H., A. Toukdarian, F. Fang, and D. R. Helinski. 1990. Mutations in the trfA replication gene of the broad-host-range plasmid RK2 result in elevated plasmid copy numbers. J. Bacteriol. 172:3859-3867.[Abstract/Free Full Text]
27. Fang, F. C., R. H. Durland, and D. R. Helinski. 1993. Mutations in the gene encoding the replication-initiation protein of plasmid RK2 produce elevated copy numbers of RK2 derivatives in Escherichia coli and distantly related bacteria. Gene 133:1-8.[CrossRef][Medline]
28. Goldman, R. C., and F. Hunt. 1990. Mechanism of O-antigen distribution in lipopolysaccharide. J. Bacteriol. 172:5352-5359.[Abstract/Free Full Text]
29. Gunawardena, S., G. P. Reddy, Y. Wang, V. S. Kolli, R. Orlando, J. G. Morris, and C. A. Bush. 1998. Structure of a muramic acid containing capsular polysaccharide from the pathogenic strain of Vibrio vulnificus ATCC 27562. Carbohydr. Res. 309:65-76.[CrossRef][Medline]
30. Hally, R. J., R. A. Rubin, H. S. Fraimow, and M. L. Hoffman-Terry. 1995. Fatal Vibrio parahemolyticus septicemia in a patient with cirrhosis. A case report and review of the literature. Dig. Dis. Sci. 40:1257-1260.[CrossRef][Medline]
31. Heinrichs, D. E., M. A. Monteiro, M. B. Perry, and C. Whitfield. 1998. The assembly system for the lipopolysaccharide R2 core-type of Escherichia coli is a hybrid of those found in Escherichia coli K-12 and Salmonella enterica. Structure and function of the R2 WaaK and WaaL homologs. J. Biol. Chem. 273:8849-8859.[Abstract/Free Full Text]
32. Hitchcock, P. J., and T. M. Brown. 1983. Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J. Bacteriol. 154:269-277.[Abstract/Free Full Text]
33. Jedani, K. E., U. H. Stroeher, and P. A. Manning. 2000. Distribution of IS1358 and linkage to rfb-related genes in Vibrio anguillarum. Microbiology 146:323-331.[Abstract/Free Full Text]
34. Kleckner, N., J. Bender, and S. Gottesman. 1991. Uses of transposons with emphasis on Tn10. Methods Enzymol. 204:139-180.[Medline]
35. Kolter, R., M. Inuzuka, and D. R. Helinski. 1978. Trans-complementation-dependent replication of a low molecular weight origin fragment from plasmid R6K. Cell 15:1199-1208.[CrossRef][Medline]
36. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
37. Linkous, D. A., and J. D. Oliver. 1999. Pathogenesis of Vibrio vulnificus. FEMS Microbiol. Lett. 174:207-214.[CrossRef][Medline]
38. Matsumoto-Mashimo, C., A. M. Guerout, and D. Mazel. 2004. A new family of conditional replicating plasmids and their cognate Escherichia coli host strains. Res. Microbiol. 155:455-461.[Medline]
39. Metcalf, W. W., W. Jiang, and B. L. Wanner. 1994. Use of the rep technique for allele replacement to construct new Escherichia coli hosts for maintenance of R6K gamma origin plasmids at different copy numbers. Gene 138:1-7.[CrossRef][Medline]
40. Page, R. D. M. 1996. TREEVIEW, tree drawing software for Apple Macintosh and Microsoft Windows, version 1.4. Division of Environmental and Evolutionary Biology, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow, United Kingdom.
41. Peleg, A., Y. Shifrin, O. Ilan, C. Nadler-Yona, S. Nov, S. Koby, K. Baruch, S. Altuvia, M. Elgrably-Weiss, C. M. Abe, S. Knutton, M. A. Saper, and I. Rosenshine. 2005. Identification of an Escherichia coli operon required for formation of the O-antigen capsule. J. Bacteriol. 187:5259-5266.[Abstract/Free Full Text]
42. Pelkonen, S., and J. Finne. 1989. Polyacrylamide gel electrophoresis of capsular polysaccharides of bacteria. Methods Enzymol. 179:104-110.[Medline]
43. Pelkonen, S., J. Hayrinen, and J. Finne. 1988. Polyacrylamide gel electrophoresis of the capsular polysaccharides of Escherichia coli K1 and other bacteria. J. Bacteriol. 170:2646-2653.[Abstract/Free Full Text]
44. Priefer, U. B., R. Simon, and A. Puhler. 1985. Extension of the host range of Escherichia coli vectors by incorporation of RSF1010 replication and mobilization functions. J. Bacteriol. 163:324-330.[Abstract/Free Full Text]
45. Raetz, C. R. H., and C. Whitfield. 2002. Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 71:635-700.[CrossRef][Medline]
46. Rahn, A., J. Drummelsmith, and C. Whitfield. 1999. Conserved organization in the cps gene clusters for expression of Escherichia coli group 1 K antigens: relationship to the colanic acid biosynthesis locus and the cps genes from Klebsiella pneumoniae. J. Bacteriol. 181:2307-2313.[Abstract/Free Full Text]
47. Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. 27:493-497.
48. Roberts, I. S. 1996. The biochemistry and genetics of capsular polysaccharide production in bacteria. Annu. Rev. Microbiol. 50:285-315.[CrossRef][Medline]
49. Rossignol, M., A. Basset, O. Espeli, and F. Boccard. 2001. NKBOR, a mini-Tn10-based transposon for random insertion in the chromosome of Gram-negative bacteria and the rapid recovery of sequences flanking the insertion sites in Escherichia coli. Res. Microbiol. 152:481-485.[Medline]
50. Schild, S., A. K. Lamprecht, and J. Reidl. 2005. Molecular and functional characterization of O antigen transfer in Vibrio cholerae. J. Biol. Chem. 280:25936-25947.[Abstract/Free Full Text]
51. Smith, A. B., and R. J. Siebeling. 2003. Identification of genetic loci required for capsular expression in Vibrio vulnificus. Infect. Immun. 71:1091-1097.[Abstract/Free Full Text]
52. Stroeher, U. H., K. E. Jedani, B. K. Dredge, R. Morona, M. H. Brown, L. E. Karageorgos, M. J. Albert, and P. A. Manning. 1995. Genetic rearrangements in the rfb regions of Vibrio cholerae O1 and O139. Proc. Natl. Acad. Sci. USA 92:10374-10378.[Abstract/Free Full Text]
53. Stroeher, U. H., K. E. Jedani, and P. A. Manning. 1998. Genetic organization of the regions associated with surface polysaccharide synthesis in Vibrio cholerae O1, O139 and Vibrio anguillarum O1 and O2: a review. Gene 223:269-282.[CrossRef][Medline]
54. Strom, M. S., and R. N. Paranjpye. 2000. Epidemiology and pathogenesis of Vibrio vulnificus. Microbes Infect. 2:177-188.[CrossRef][Medline]
55. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24:4876-4882.
56. Todd, E. C. 1989. Costs of acute bacterial foodborne disease in Canada and the United States. Int. J. Food Microbiol. 9:313-326.[CrossRef][Medline]
57. Trent, M. S. 2004. Biosynthesis, transport, and modification of lipid A. Biochem. Cell Biol. 82:71-86.[CrossRef][Medline]
58. Waldor, M. K., R. Colwell, and J. J. Mekalanos. 1994. The Vibrio cholerae O139 serogroup antigen includes an O-antigen capsule and lipopolysaccharide virulence determinants. Proc. Natl. Acad. Sci. USA 91:11388-11392.[Abstract/Free Full Text]
59. Warnock, E. W., III, and T. L. MacMath. 1993. Primary Vibrio vulnificus septicemia. J. Emerg. Med. 11:153-156.[CrossRef][Medline]
60. Whitfield, C. 2006. Biosynthesis and assembly of capsular polysaccharides in Escherichia coli. Annu. Rev. Biochem. 75:39-68.[CrossRef][Medline]
61. Whitfield, C., P. A. Amor, and R. Koplin. 1997. Modulation of the surface architecture of gram-negative bacteria by the action of surface polymer:lipid A-core ligase and by determinants of polymer chain length. Mol. Microbiol. 23:629-638.[CrossRef][Medline]
62. Whitfield, C., N. Kaniuk, and E. Frirdich. 2003. Molecular insights into the assembly and diversity of the outer core oligosaccharide in lipopolysaccharides from Escherichia coli and Salmonella. J. Endotoxin Res. 9:244-249.[Medline]
63. Whitfield, C., and I. S. Roberts. 1999. Structure, assembly and regulation of expression of capsules in Escherichia coli. Mol. Microbiol. 31:1307-1319.[CrossRef][Medline]
64. Whitfield, C., and M. A. Valvano. 1993. Biosynthesis and expression of cell-surface polysaccharides in gram-negative bacteria. Adv. Microb. Physiol. 35:135-246.[Medline]
65. Wise, K. A., and P. J. Newton. 1992. A fatal case of Vibrio vulnificus septicemia. Pathology 24:121-122.[Medline]
66. Wright, A. C., J. L. Powell, J. B. Kaper, and J. G. Morris, Jr. 2001. Identification of a group 1-like capsular polysaccharide operon for Vibrio vulnificus. Infect. Immun. 69:6893-6901.[Abstract/Free Full Text]
67. Wright, A. C., L. M. Simpson, and J. D. Oliver. 1981. Role of iron in the pathogenesis of Vibrio vulnificus infections. Infect. Immun. 34:503-507.[Abstract/Free Full Text]
68. Wright, A. C., L. M. Simpson, J. D. Oliver, and J. G. Morris, Jr. 1990. Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus. Infect. Immun. 58:1769-1773.[Abstract/Free Full Text]
69. Wugeditsch, T., A. Paiment, J. Hocking, J. Drummelsmith, C. Forrester, and C. Whitfield. 2001. Phosphorylation of Wzc, a tyrosine autokinase, is essential for assembly of group 1 capsular polysaccharides in Escherichia coli. J. Biol. Chem. 276:2361-2371.[Abstract/Free Full Text]
70. Yoshida, S., M. Ogawa, and Y. Mizuguchi. 1985. Relation of capsular materials and colony opacity to virulence of Vibrio vulnificus. Infect. Immun. 47:446-451.[Abstract/Free Full Text]
71. Zuppardo, A. B., and R. J. Siebeling. 1998. An epimerase gene essential for capsule synthesis in Vibrio vulnificus. Infect. Immun. 66:2601-2606.[Abstract/Free Full Text]


Infection and Immunity, December 2007, p. 5550-5558, Vol. 75, No. 12
0019-9567/07/$08.00+0     doi:10.1128/IAI.00932-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
IAI.00932-07v1
75/12/5550    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted