IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow An author's correction has been published
Right arrow Other Versions of this Article:
IAI.01228-06v1
75/2/634    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fouts, A. E.
Right arrow Articles by Boothroyd, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fouts, A. E.
Right arrow Articles by Boothroyd, J. C.

 Previous Article  |  Next Article 

Infection and Immunity, February 2007, p. 634-642, Vol. 75, No. 2
0019-9567/07/$08.00+0     doi:10.1128/IAI.01228-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Infection with Toxoplasma gondii Bradyzoites Has a Diminished Impact on Host Transcript Levels Relative to Tachyzoite Infection{triangledown},{dagger}

A. E. Fouts and J. C. Boothroyd1*

Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, California 94305-51241

Received 2 August 2006/ Returned for modification 29 August 2006/ Accepted 30 October 2006


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Toxoplasma gondii, an intracellular pathogen, has the potential to infect nearly every warm-blooded animal but rarely causes morbidity. The ability for the parasite to convert to the bradyzoite stage and live inside slow-growing cysts that can go unnoticed by the host immune system allows for parasite persistence for the life of the infected host. This intracellular survival likely necessitates host cell modulation, and tachyzoites are known to modify a number of signaling cascades within the host to promote parasite survival. Little is known, however, about how bradyzoites manipulate their host cell. Microarrays were used to profile the host transcriptional changes caused by bradyzoite infection and compared to those of tachyzoite-infected and uninfected hosts cells 2 days postinfection in vitro. Infection resulted in chemokine, cytokine, extracellular matrix, and growth factor transcript level changes. A small group of genes were specifically induced by tachyzoite infection, including granulocyte-macrophage colony-stimulating factor, BCL2-related protein A1, and interleukin-24. Bradyzoite infection yielded only about half the changes seen with tachyzoite infection, and those changes that did occur were almost all of lower magnitude than those induced by tachyzoites. These results suggest that bradyzoites lead a more stealthy existence within the infected host cell.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Toxoplasma gondii is an extremely common parasite in humans and animals. Although sexual reproduction of this intracellular protozoan takes place only within felines, the intermediate hosts (many species of mammals and birds) support asexual reproduction consisting of two stages: tachyzoites and bradyzoites. Tachyzoites replicate rapidly, disseminate through the host, and cause tissue damage. Most are then cleared by the host immune response but not before some have converted into the bradyzoite stage. Bradyzoites replicate slowly, form a cyst within the host cell, and sustain a chronic infection for the life of the mammalian host. These bradyzoites latently persist and cause little pathology in a healthy host but, in an immunocompromised animal, they can reconvert into the tachyzoite stage and cause potentially fatal encephalitis.

Toxoplasma has a variety of mechanisms to co-opt the host cell and evade host defenses, thereby promoting intracellular survival. In particular, a number of studies indicate that tachyzoites manipulate various signaling pathways within the host cell. For example, tachyzoite-infected cells have been shown to be resistant to the induction of apoptosis through the targeting of multiple, distinct steps (29, 33, 20, 7). Toxoplasma tachyzoites also manipulate host cell NF-{kappa}B signaling (32, 28), as well as mitogen-activated protein kinase signaling based on the fact that tachyzoite-infected macrophages are refractory to additional stimulation by lipopolysaccharide (26, 23). Recent research has also shown that tachyzoite proteins can be injected into the host cell upon invasion (19, 21, 30) and that at least one of these, a protein kinase, can have major effects on host transcription (30).

To better understand the interaction between parasite and host, microarray technology has been used by several groups for genome-wide analysis of the effects of the intracellular tachyzoite on the host cell transcriptome. Two groups have shown cell-specific responses to Toxoplasma tachyzoites in dendritic cells, macrophages, and retinal vascular endothelial cells (10, 25). Another group compared host gene expression in human foreskin fibroblasts (HFFs) infected by Toxoplasma tachyzoites with infection by other pathogens and identified two genes specifically induced by Toxoplasma (MacMarcks and transferrin receptor) (17). Further studies have confirmed that the parasite-induced increase in host transferrin receptor aids parasite survival (18). In addition, marked differences between early and later time points following infection with tachyzoites were revealed by a time course analysis (3): transcript levels that changed at 2 h postinfection (hpi) primarily encoded immune response proteins that did not require parasite invasion for their increase, whereas at 24 hpi there were many additional changes, including increases in the transcript levels of genes encoding enzymes in the glycolytic and mevalonate synthesis pathways.

In contrast to this large body of data on infection with tachyzoites, relatively little is known about changes mediated by intracellular bradyzoites. There are many biological differences between tachyzoites and bradyzoites that predict the host responses to these stages are probably very different. For example, a number of studies have revealed developmentally regulated Toxoplasma genes, including metabolic enzymes, secreted proteins, and surface proteins (1, 36, 13, 15, 11, 24, 34, 31). These differences in gene expression correspond with a much slower growth rate for bradyzoites and development of a cyst wall characteristic of this stage, both of which might contribute to bradyzoite persistence. Furthermore, unlike tachyzoites, which attract a strong proinflammatory response, bradyzoites often persist in the animal without attracting immune infiltrates (24). This led us to hypothesize that bradyzoites might produce a unique signature of changes in the host cell transcriptome.

In the present study, human cDNA microarrays were used to investigate whether and how the changes in host gene expression during infection with bradyzoites differ from those during infection with tachyzoites. Employing a commonly used method for induction of bradyzoite differentiation (high pH and low serum) (34), parallel cultures of HFFs infected by bradyzoites and tachyzoites were obtained, and microarrays were used to profile changes in host gene expression. We observed that, overall, bradyzoite infection caused transcriptional changes of lesser magnitude than those brought about by tachyzoite infection but that the two stages have similar effects on host transcription.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture. Cultures of primary HFFs at passages 9 to 13 were grown to confluence in 175-cm2 flasks and incubated for 3 to 5 weeks in a humidified, 37°C, 5% CO2 incubator. Fresh medium was added to these cultures the day before infection. Pru strain parasites expressing green fluorescent protein (GFP) from a bradyzoite-specific promoter (bradyzoite-specific GFP-4, BSG-4) (34) were allowed to lyse their host cells and remain extracellular for approximately 24 h before they were washed three times, counted, and added to HFFs at an effective multiplicity of infection of 1:5. At 4 h postinfection (hpi) the medium was removed, and fresh medium of either Dulbecco modified Eagle medium plus 10% fetal calf serum (pH 7.5) ("standard") or RPMI plus 1% fetal calf serum, buffered with 50 mM HEPES to pH 8.2 ("stress"), was added. Flasks with standard medium were incubated in the conditions described above, whereas flasks with stress medium were incubated as described above but capped tightly without added CO2. Tachyzoite-infected cultures were labeled "standard+TZ"; bradyzoite-infected cultures were termed "stress+BZ." At 44 hpi the cells were harvested for RNA preparation. Only cultures with infection rates of at least 20% of the cells and a bradyzoite conversion of better than 90% were used for RNA isolation. The bradyzoite conversion was assayed by counting all vacuoles in an area and then counting the vacuoles that contained GFP-positive bradyzoites. In the standard+TZ cultures, no conversion to bradyzoites occurred based on a total absence of detectable GFP expression (data not shown).

cDNA synthesis. Total RNA was extracted by using TRIzol reagent (Gibco-BRL). RNA was assessed for quality using spectrophotometry and gel analysis. mRNA was isolated by using Oligotex mRNA minikit (QIAGEN). cDNA was synthesized by using Superscript II (Life Technologies) and quantified by measuring ethidium fluorescence in electrophoresed samples.

Labeling and microarrays. Second-strand cDNA was labeled by using the direct incorporation of Cy3 (reference) or Cy5 (sample) dUTPs (Amersham) through random nonomer priming with Klenow enzyme (Gibco-BRL). Type II microarray experiments were performed (common reference on all slides) (14) using a reference sample made from a pool of first-strand cDNA from all conditions. Each reference and sample were labeled in parallel and purified by using YM-30 columns (Amicon) and then simultaneously hybridized to human cDNA microarrays (Stanford Functional Genomics Facility) by using 3.4x SSC (1x SSC is 0.15 M sodium chloride plus 0.015 M sodium citrate), 0.3% sodium dodecyl sulfate, 20 µg of poly(A) RNA (Sigma), and 2 µg of yeast tRNA (Roche) at 65°C for at least 22 h. Prior to hybridization microarray slides were hydrated, cross-linked, and prehybridized in 25% formamide according to the manufacturer's instructions (Corning UltraGAPS-coated slides instruction manual). Slides were rinsed in water, followed by 95% ethanol, and then dried by centrifugation. Hybridization was followed by washing for 5 min each in 2x, 1x, and 0.2x SSC and then drying by centrifugation. Each microarray contains 40,996 cDNA spots representing 23,228 unique putative genes (gene identity information may be found in Fig. 2 and 4).


Figure 2
View larger version (51K):
[in this window]
[in a new window]

  		FIG. 2. GO categories significantly modulated by infection and/or culture condition. Clusters include genes called significant by SAM in highly significant GO categories. Vertical groupings show hierarchical clustering of gene expression in HFF with or without stress and/or parasites 44 hpi The matrix contains log-transformed medians of normalized ratios, averaged over each condition and converted to a color scale as shown (log2 values greater than 3 or less than –3 were assigned as 3 and –3, respectively). Each row represents the color-coded expression of one spot corresponding to one gene on the arrays. Genes with asterisks are discussed in detail in the text. (A and B) "Cholesterol biosynthesis" and "lipid metabolism", two GO categories significantly modulated by stress; (C and D) "extracellular matrix structural constituent" and "growth factor activity", the two GO categories most significantly modulated by infection and stress; (E and F) "cytokine activity" and "chemokine activity," two GO categories significantly modulated by infection only.

 

Figure 4
View larger version (30K):
[in this window]
[in a new window]

  		FIG. 4. Clusters of genes that are tachyzoite specific or bradyzoite specific. Clusters include genes called significant by SAM in either tachyzoite infection or bradyzoite infection that, upon examination (see the text), met the criteria for being "tachyzoite specific" (A and B) or "bradyzoite specific" (C). Color-coding is as described for Fig. 2. Genes with asterisks are discussed in detail in the text.

 
Data analysis. Slides were scanned by using an Axon Genepix 4000A and gridded by using Genepix 5.1. The data were entered into Stanford Microarray Database (SMD [genome-www5.stanford.edu]), and two-dimensional spatial local estimation was used to normalize the spots (span factor of 0.4) (39) to enable comparison between arrays (raw data will be available from SMD, GEO, and ArrayExpress repositories). Five arrays per condition were selected to be included in the analysis based on overall signal-to-noise ratios. These arrays include at least one from each of three biological replicates and an additional two technical replicates. Three filters to remove poor quality spots were applied before data were downloaded: the spot had to be flagged as "OK" in Genepix, the regression correlation had to be greater than 0.6, and the channel 2 signal had to be at least threefold greater than the background. Genes for which there are high-quality data on 14 of 20 of the arrays (18,425 spots) were entered into MeV 3.0 (www.tigr.org). The following pairwise combinations of the conditions were used for two-class unpaired significance analysis of microarrays (SAM) (37) analysis (1% false-positive cutoff): standard versus (standard+TZ), stress versus (stress+BZ), and standard versus stress. Gene Ontology (http://www.geneontology.org/) analysis was performed on the SAM data with the additional cutoff of requiring a fold change greater than 1.5, either up or down. The abbreviated gene symbol (e.g., STAT1 [for signal transducer and activator of transcription 1]) was used to reduce the lists to include one copy of each gene for further analysis. Using Onto-Express (http://vortex.cs.wayne.edu/projects.htm [12]), each individual list of significant genes was queried against the entire list of genes present in the input for the SAM analysis. Lists of significant genes from the most significant gene ontology (GO) categories were used to query the 18,425 spots to obtain data on all replicates of a gene. We used a cutoff of 14 or more genes in the GO category to consider it for discussion. The replicate experiments were averaged, entered into MeV 3.1, and clustered with average linkage Euclidian parameters for image generation.

ELISA. HFFs were grown in 24-well tissue culture plates. The experiment commenced exactly as for the cultures used for microarrays, but 2 h before the final time point (44 hpi), medium was removed, and cells were washed with warm phosphate-buffered saline. A total of 600 µl of fresh medium of the proper type (standard or stress) without serum was added to the wells. After 2 h, the medium was harvested for enzyme-linked immunosorbent assay (ELISA) experiments. ELISAs were performed in duplicates according to manufacturer's protocol for CCL2 (1:10 dilution of sample; eBioscience, San Diego, CA) and CXCL1 (no dilution of sample; BD-Clontech, Palo Alto, CA).

Semiquantitative PCR. cDNA from microarray experiment 3 (for a description of the experiments, see supplemental material) was diluted to 10 ng/µl. A standard curve was made by using one of the samples at 20 ng/µl and diluting it further to 1:10, 1:100, and 1:1,000. PCR was performed with 25 or 50 ng of cDNA and QuantiTect SYBR PCR Mastermix (QIAGEN) according to manufacturer's instructions on a Lightcycler 1.2 (Roche). Two replicates of each sample were performed, quantitation was performed by using Lightcycler software version 3.5, and abundances were calculated based on the standard curve for each primer pair. Primer pairs were as follows: BCL2A1 (GAAGACGGCATCATTAACT and CCCAGCCTCCGTTTTG), GM-CSF (AGCATGTGAATGCCATC and GTTTCCGGGGTTGGAG), IL-24 (CTCCTTTGCTGGCGAC and GGGCACTCGTGATGTT), ENC1 (GCCGTCGTAGGTATTAGT and ACATCTAGGAACCAGGG), FAS (CCAACCTTAAATCCTGAAACA and GCCAATTACGAAGCAGT), and IFI16 (GTGCCAGCGTAACTCC and CCCGGTATTCCCACTT).

GenBank accession numbers. The accession numbers for the genes identified in Fig. 2 and 4 (in the order listed in these figures) are as follows: for Fig. 2A (cholesterol biosynthesis), AA477781, AI214581, N62195, T65790, T56013, N50834, H08205, R06715, AA420437, AA436425, AA779417, N67038, and AI364688; for Fig. 2B (lipid biosynthesis), AI081548, N47716, AA873159, AA991590, W80637, AA464566, AA126676, AI304790, H15842, AA456975, AI924357, AA504461, R25823, T56013, N62195, AA779417, AA216528, N98509, H29214, W48579, R28548, R07295, AA988876, AA972780, N70176, R72174, AA058383, AA401952, AA983633, H19050, AA190764, AI985827, T71976, H15155, N91990, N72215, AA453471, AI261602, T71713, AA457697, N95187, AA443630, AA459293, AA775445, AI393019, and AA693488; for Fig. 2C (extracellular matrix structural constituent), AA293402, AA459308, W90359, AA035657, AA453712, AA455542, AA167222, AA284301, R68634, N73836, W89143, T98611, AA044829, AI679372, AA134757, AA614680, W93067, AA434067, R62612, AI262682, AA953560, N26285, W90740, AA599273, AA430540, AA994760, R52037, AA464042, AI830005, W84711, H77493, AA633747, AA682527, N78828, T99055, AA046525, H99676, AA047208, W93113, AA455157, AA056415, AA418674, AA452840, AI982687, AA490172, N74178, AA857098, N67487, AA488444, AA393766, R77226, R78225, AA150402, AA780815, AA056013, H92621, AI038302, AA177109, AA177011, H17882, AI732248, AA125940, and AA195302; for Fig. 2D (growth factor activity), W42723, W46900, W46577, AA706226, R50018, N26311, AA011061, AA026118, AI811492, AA401111, AA489383, AA450062, AA292891, AA910443, AW008840, N71102, AA946776, N74623, N76677, H59614, R42395, AA456321, AA128355, AA701502, AA904948, AI083520, AA488780, AA253446, H23457, AA422166, AA234298, R56773, T52484, AA496452, AI054019, T62547, AA431428, AA463224, R70684, R83377, AA293109, H11088, and AA630120; for Fig. 2E (cytokine activity), AA884403, R56773, AA708512, AI075036, AA463224, AA496452, AI054019, AA431428, N26311, AA450062, AA401111, AA281635, AI335002, AI074784, AA995402, R50018, and AA489629; for Fig. 2F (chemokine activity), AI016051, W72294, AA873792, AA780059, AA953842, W42723, W46900, AA935273, AI668847, AA425102, T77816, W69211, AI268937, AI359519, AA486072, and AI298976; for Fig. 4A (tachyzoite-specific decreases), AA971543, AA055520, AA041382, AA142919, AA894927, AI015679, AI375048, AI084504, N92167, R85685, AW028368, AA419176, AA677174, AA486367, AA076085, AA659567, AA459743, N81036, AI659563, H70866, H07920, AA176999, T62048, T69603, AA463224, AA885288, AA058383, T64469, AA971188, AA778276, N31493, N27086, AA229714, N70176, R34682, AA404967, AA079495, AA173408, W44856, AA486836, T71976, R09561, AA411394, AI823924, H50344, AA405488, N30573, AA070357, AA126869, AA479313, AA410636, AI675465, AA912034, AA292213, R64454, AA863403, AA678160, AA676466, AA676804, H13074, AI014468, AA629909, AA953006, AI017846, AA608531, AA190871, AA676405, R92852; for Fig. 4B (tachyzoite-specific increases), AA459263, AI766870, T53705, AA995402, AA449750, AA449720, W96134, W44549, AA293362, H87471, AA281635, N98757, T99302, H55907, AA429661, AA456161, R71691, and T55353; and for Fig. 4C (bradyzoite-specific changes), R62138, AW029226, H72122, N26311, AA126958, AA490996, AA425320, AA450062, N66644, AA044023, AI038014, R63922, AA045792, AA598526, W47003, AA010400, AA293570, AA287732, AA480994, AI361330, AI950601, AI284281, H58872, and AA679565.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Experimental system. To examine bradyzoite-specific effects on host cell transcription, bradyzoite-bearing cells would ideally be isolated from an infected animal. Unfortunately, however, this approach is not feasible because of the extremely low number of such cells (e.g., an entire mouse brain typically contains only ca. 100 to 3,000 cysts). We attempted to use in vitro cultures of primary rat astrocytes (neural fibroblasts) but were unable to obtain consistent results due to limitations on cell viability and the variable purity of the starting material (data not shown). We therefore turned to another primary cell line, HFFs, that has been used extensively for the study of bradyzoites in vitro. Fibroblasts are involved in the regulation of inflammation, and activated fibroblasts have roles such as providing costimulatory signaling to leukocytes (38), influencing Th1 or Th2 patterning (22), and downregulating the immune response in tissues to limit chronic inflammation (5). These functions of fibroblasts, along with their ease of manipulation as primary cell lines, make them a useful and relevant cell type for studying how Toxoplasma manipulates its host cell.

Pru strain parasites have been well characterized regarding their ability to convert into bradyzoites in vitro and in vivo. We used a Pru strain engineered to express GFP by a bradyzoite-specific promoter (LDH2) (34). Parallel cultures were initiated by adding tachyzoites to HFF monolayers and then, at 4 hpi, the medium was removed, and fresh standard medium was added for tachyzoite ("standard+TZ") conditions or stress medium was added for bradyzoite ("stress+BZ") cultures to induce conversion. The resulting percentage of cells infected was examined microscopically and found to be the same for standard+TZ and stress+BZ cultures (data not shown). Mock-infected cultures were similarly treated to yield uninfected "standard" and uninfected "stress" cultures. RNA from all cultures was harvested at 44 hpi, just before tachyzoites lyse their host cells (bradyzoite cultures are slower to grow and so do not lyse the host cell for several days, if ever [data not shown]). In preliminary experiments we determined that the efficiency of bradyzoite conversion decreased dramatically with increasing multiplicity of infection. The optimum was achieved when ca. 20% of host cells were infected, which allowed at least 90% bradyzoite conversion (data not shown). The implications of this are further discussed below.

To examine host transcription, microarrays were used to compare mRNA transcript abundance for the four experimental conditions: standard, stress, standard+TZ, and stress+BZ cultures. These data are all available in the SMD (2; (http://genome-www5.stanford.edu/microarray). Three separate, pairwise SAM analyses were performed (37) to obtain significance and fold changes for 18,425 spots (9,750 unique genes) on the arrays for these pairs: standard versus standard+TZ, stress versus stress+BZ, and standard versus stress. (A table of these results is included as supplemental Fig. 1.) To increase our confidence in the data, further analysis was performed only on genes that were called significant by SAM and changed 1.5-fold or more. Due to the low percentage of cells infected (~20%), relatively small changes in transcript levels might reflect larger changes in the subset of cells that are actually infected. Unfortunately, however, the inherent variability across multiple microarray experiments precluded the inclusion of fold changes less than 1.5 in our study and so genes with only modest changes in infected cells will not be identified in these analyses. Despite these limitations, 1483(14%) and 692 (7%) of unique genes changed significantly in at least one spot as a result of tachyzoite or bradyzoite infection, respectively, whereas just 349 (4%) of the genes' transcript levels changed significantly from stress medium alone (Fig. 1).


Figure 1
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 1. Differential gene expression due to infection and/or culture condition. Venn diagram of the statistically significant genes in pairwise comparisons using a SAM 1% false-positive rate and a 1.5-fold change cutoff. The pairwise comparisons include standard versus standard+TZ, stress versus stress+BZ, and standard versus stress.

 
Stress conditions induce cholesterol and lipid synthesis. To reveal the kinds of genes differentially expressed, a gene ontology-based analysis was used (12). The list of significant genes from each pairwise SAM output was queried against the entire input list, and P values were obtained for the enrichment of functional categories of genes. To determine the effects of the stress medium on HFFs, the two uninfected conditions were also compared. The stress conditions alone (i.e., with no infection) induced primarily genes in the GO categories "cholesterol biosynthesis" and "lipid metabolism" suggesting that the low serum conditions increased intracellular lipid production (Table 1 and Fig. 2A and B). These results are consistent with previous microarray studies that examined serum starvation in HFFs (8).


View this table:
[in this window]
[in a new window]

  		TABLE 1. Significant GO categories for infection and/or stress

 
Comparing bradyzoite-infected cells to uninfected controls revealed a slight, further increase in transcript levels for cholesterol biosynthesis genes over and above the effect seen with the stress conditions alone. An increase was also seen with tachyzoite-infected cells versus uninfected cultures (Table 1 and Fig. 2A and B). These data are consistent with previous microarray analysis that showed that enzymes in the mevalonate synthesis pathway were upregulated in tachyzoite-infected cells at 24 hpi The same upward trend in this latter pathway was evident here, although it failed to achieve statistical significance (asterisks in Fig. 2A and B). There is evidence that this induction occurs only in infected cells (35), and thus the lesser induction seen here might be due to the lower percentage of cells infected in the present study.

Infection and stress both cause primarily decreases in expression of genes encoding extracellular matrix proteins and growth factors. A primary role of fibroblasts is the secretion and modification of extracellular matrix; thus, it is not surprising that "extracellular matrix structural constituent" was the most significant gene ontology category for all three pairwise conditions (Table 1). Either stress or infection alone reduced transcript levels of extracellular matrix constituents, and the combination of these two conditions appears to cause even greater decreases in transcript levels (Fig. 2C), suggesting an additive effect of infection and stress.

The next most highly significant category modulated by both stress and infection is "growth factor activity" (Table 1). A number of fibroblast growth factors were markedly decreased as a result of all three conditions (Fig. 2D). This is consistent with the previous finding that pH stress or serum starvation decreases cell proliferation (6). Our data indicate that infection with Toxoplasma also causes a decrease in gene products necessary for the proliferation of fibroblasts although this is experimentally difficult to examine, given that the cells are physically lysed by the parasites after about 2 to 3 days of infection.

Previous reports, in which transcript levels were examined in HFF cells at 24 hpi, found few transcript levels that were decreased in infection (17, 3). It was, therefore, not expected to see the large number of such transcripts, particularly in tachyzoite-infected cells at day 2. This is readily explained, however, by the fact that abundance is a function of both synthesis and decay and so genes whose transcription is switched off might not show a significant change in overall abundance until enough time has elapsed for decay of preexisting message. For the genes described here, this effect might not become apparent until 44 h have elapsed. Alternatively, the expression of these genes might not be impacted until parasite growth has reached a critical point.

Infection by tachyzoites or bradyzoites causes increases in chemokine and cytokine transcript and protein levels. GO categories highly enriched by tachyzoite and bradyzoite infection, but not stress alone, included "cytokine activity" and "chemokine activity" (Table 1 and Fig. 2E and F). To examine how changes in transcript levels correlate with protein levels, ELISA experiments were performed with supernatant harvested from HFFs treated as for the microarray analysis except that at 42 hpi the medium was replaced and harvested 2 h later for the measurement of cytokine secretion by ELISA. We confirmed that CXCL1 (GRO{alpha}) and CCL2 (MCP1) protein levels were increased in accordance with their highly induced transcript levels (Fig. 3) in tachyzoite and bradyzoite infections. The relative differences in the expression of each of these molecules is similar to the transcript level data from the microarrays.


Figure 3
View larger version (36K):
[in this window]
[in a new window]

  		FIG. 3. Secretion of CCL2 and CXCL1 by uninfected and infected cells at 44 hpi postinfection. ELISA data representative of four independent experiments are shown. Tachyzoites were added, and the medium was replaced 4 hpi with normal or stress medium. At 2 h before harvest, the medium was removed, cells washed once with phosphate-buffered saline, and fresh medium of the proper type but without serum was added. Secretion from the last 2 h before harvest at 44 hpi was measured. Error bars reflect the standard deviation of two replicate cell culture wells in the experiment. Microarray transcript levels are the ratio of sample to reference median intensity averaged over two spots and all five arrays per condition. Error bars reflect the standard deviation of these data.

 
Transcript changes are not specific to bradyzoite infection. To compare host response to bradyzoite and tachyzoite infection, we examined the lists of genes deemed significant by SAM in two pairwise comparisons: standard versus standard+TZ and stress versus stress+BZ. The majority (77%) of the genes significantly affected by bradyzoite infection were also significant for tachyzoite conditions (Fig. 1). To determine which of the remaining 23% were truly bradyzoite specific, the genes were manually examined according to the following criteria. After obtaining all spotted replicates for each gene considered significant by SAM, we required that two of three of spots show the same trend and that the ratio of stress+BZ to stress be at least 1.5-fold the ratio of standard+TZ to standard. The final list of genes that met these criteria as "bradyzoite specific" consisted of only 14 genes (12 upregulated and 2 downregulated), and only two of these genes had fold changes greater than two. The 1% false-positive rate of SAM predicts 7 false-positive genes, suggesting that at least half of the 14 genes observed may not be truly specific to bradyzoite versus tachyzoite infection. To explore this further, quantitative PCR (qPCR) was performed on three of the genes specifically induced by bradyzoite infection according to the array data. The results (see Fig. 5) showed that ENC1 transcript levels changed in the manner predicted by the array data, but IFI16 showed similar induction by both stages, and Fas antigen (FAS) appeared to be induced by tachyzoites only. These data indicate that infection by bradyzoites in vitro causes the induction of few if any host genes distinct from those of tachyzoite infection.


Figure 5
View larger version (46K):
[in this window]
[in a new window]

  		FIG. 5. "Tachyzoite-specific" genes show large induction, but "bradyzoite-specific" genes may be induced by infection by both stages of the parasite. Semiquantitative PCR was performed on three "tachyzoite-specific" and three "bradyzoite-specific" genes. Error bars represent the standard deviations of two samples. The array data are presented in graphs, with error bars representing the standard deviations of all five arrays for each condition. GM-CSF, granulocyte-macrophage colony-stimulating factor.

 
Transcript changes specific to tachyzoite infection. To determine whether there were genes induced exclusively by tachyzoite infection, we examined the list of 950 such genes using the stringent criteria described above. Using these criteria, 54 genes (14 up and 40 down) were tachyzoite specific (Fig. 4). SAM predicts only 14 false-positive genes in this category, and thus most of the 55 are expected to be real differences. In addition, 18 of the 54 had fold changes greater than two, further suggesting that the differences were real. qPCR was performed on three genes that the array data indicate are induced >2-fold in a tachyzoite-specific manner (BCL2-related protein A1 [BCL2A1], granulocyte-macrophage colony-stimulating factor [GM-CSF], and interleukin-24 [IL-24]). In all three cases, the qPCR data were in agreement with the array data, indicating that these genes were all specifically induced in tachyzoite infection (Fig. 5). The qPCR indicates an underestimation by the microarrays of the extent of the tachyzoite induction of these three genes. This is consistent with a study comparing fold changes measured by qPCR versus microarrays that found that microarrays consistently underestimate the induction relative to qPCR (40).

The GM-CSF induction agrees with the work of others that found it to be significantly induced in tachyzoite-infected fibroblasts (9). This protein promotes granulocyte and macrophage differentiation and proliferation and would thus increase inflammation. This tachyzoite-induced transcript may contribute to the known phenomenon that tachyzoites cause extensive inflammation, whereas bradyzoites do not.

Antiapoptotic proteins BCL2A1 and TNF receptor-associated factor 1 (TRAF1) are induced by tachyzoites in dendritic cells (10), and these data suggest that they are induced in fibroblasts by tachyzoites but not by bradyzoites (Fig. 4 and 5). During the extensive inflammation caused by tachyzoites, these antiapoptotic genes, as well as IL-24, may help the tachyzoite-infected cell, and thus the tachyzoites inside, survive.

There were 40 genes that were downregulated significantly in tachyzoite infection, including the "signal transducers and activators of transcription" STAT1 and STAT3. These proteins have been well studied in Toxoplasma infection and shown to be subject to multiple levels of regulation (27, 30, 41). We examined the transcript levels for genes whose expression is mediated by activated STAT1 or STAT3 and saw no significant decrease in infected cells. Consistent with this, we examined STAT1 protein levels by Western blot and saw little if any decrease in the infected cultures (data not shown). Hence, the decrease in the STAT1/3 transcript levels does not appear to impact the overall function of the proteins they encode, at least within the time frame (48 h) examined in these experiments.


   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Under the conditions used here, infection by bradyzoites results in fewer changes in host gene expression than does infection with tachyzoites, and the changes that do occur are essentially a dampened version of those observed with tachyzoites. In addition to the fundamental differences between how bradyzoites and tachyzoites manipulate their host cell, it is possible that the lesser effects of bradyzoites is a consequence of the way in which bradyzoites must be generated in vitro. That is, the infections have to be initiated by tachyzoites and the "bradyzoite-inducing" conditions are not applied until 4 hpi; thus, some host responses might be initiated by proteins on the tachyzoite surface and/or tachyzoite proteins that are injected into the host cell during the invasion process itself (19, 21, 30). For example, CCL2 has been reported to be induced by a tachyzoite-specific surface antigen, SAG1 (4), and an increase in CCL2 transcripts was clearly evident in tachyzoite-infected cells and, to a lesser extent, those infected with bradyzoites; both could be a result of the initial contact with SAG1 on the tachyzoite surface with a diminished effect in the bradyzoite conditions where the SAG1 gene is turned off. The large, tachyzoite-specific induction of genes such as BCL2A1 and GM-CSF, on the other hand, shows that not all transcripts induced by tachyzoites are observed in bradyzoite infection. Such instances could be due to specific effects of the tachyzoites exerted after the initial 4 h of infection, and/or they could require sustained exposure to tachyzoite-specific molecules.

Two additional factors could contribute to the diminished magnitude of host transcript changes in bradyzoite-infected cells. First, due to the slower growth rate of bradyzoites, the tachyzoite-infected cells contain more parasites at a given time point, and this higher parasite number could cause larger transcript changes. Second, the stress conditions used to induce bradyzoite development might have dampened the ability of the host cells to respond to the infection.

To determine whether the parasite load within a cell correlates to the magnitude of the transcript changes, a slow-growing tachyzoite mutant ideally would be compared to bradyzoites. The closest to such mutants are those defective in carbamoyl phosphate synthesis, but their defect is so large (complete cessation of growth) that they are not useful for these purposes (16). Instead, we used ELISA to examine the secretion of CCL2 and CXCL1 at two different multiplicities of infection. Doubling the number of parasites resulted in an ~2-fold increase in secretion (data not shown). These results are consistent with the larger magnitude of changes seen in tachyzoite-infected cells being due in part to the greater number of parasites within the culture, although increasing the percentage of cells infected is clearly very different from increasing the number of parasites per cell.

To determine whether stress conditions suppress the ability of an infected cell to respond, the secretion of CXCL1 and CCL2 was examined by ELISA using cells that were incubated for 44 h with culture supernatant from a tachyzoite-lysed flask. The supernatant stimulated a marked secretion of CXCL1 and CCL2 by HFFs in both standard and stressed conditions, although the increases in stressed cells were 2- and 1.5-fold less, respectively, than similarly treated, unstressed cells (data not shown). These results show that stress medium can have a suppressive effect on chemokine secretion by stimulated cells, but this is not enough to account for the 17- to 20-fold depression in secretion when BCL2A1, granulocyte-macrophage colony-stimulating factor, and IL-24 in tachyzoite-and bradyzoite-infected cells are compared.

In conclusion, the results presented here show that the effects of maturing bradyzoites on host cells are generally very similar to those of tachyzoites. Although we sought to identify bradyzoite-specific changes in host transcript levels, only tachyzoite-specific changes were identified. The overall lesser effect of bradyzoites on the host cell supports the hypothesis that infection with bradyzoites is less disruptive than infection with tachyzoites. Additional techniques and in vivo work is needed to study the effects of mature bradyzoites on the host cell, although the absence of methods to specifically isolate bradyzoite-infected cells from an infected animal, coupled with the rarity of such cells, makes this a daunting challenge.


   ACKNOWLEDGMENTS
 
This study was supported by grants from the NIH (AI41014) to J.C.B. and a Stanford Graduate Fellowship and Cell and Molecular Training Grant fellowship (GM07276) to A.E.F.

We gratefully acknowledge the help of Jeroen Saeij, Michael Cleary, and other members of the Boothroyd lab, as well as Kathleen Rubins, Tammy Doukas, and Lucy Thompson for helpful suggestions and advice. We also acknowledge the Steinman lab for help with qPCR.


   FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, Fairchild Building D305, 300 Pasteur Dr., Stanford University School of Medicine, Stanford, CA 94305-5124. Phone: (650) 723-7984. Fax: (650) 723-6853. E-mail: john.boothroyd{at}stanford.edu. Back

{triangledown} Published ahead of print on 6 November 2006. Back

Editor: W. A. Petri, Jr.

{dagger} Supplemental material for this article may be found at http://iai.asm.org/. Back


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Ajioka, J. W. 1998. Toxoplasma gondii: ESTs and gene discovery. Int. J. Parasitol. 28:1025-1031.[CrossRef][Medline]
2. Ball, C. A., I. A. Awad, J. Demeter, J. Gollub, J. M. Herbert, T. Hernandez-Boussard, H. Jin, J. C. Matese, M. Nitzberg, F. Wymore, Z. K. Zachariah, P. O. Brown, and G. Sherlock. 2005. The Stanford microarray database accommodates additional microarray platforms and data formats. Nucleic Acids Res. 33:D580-D582.[Abstract/Free Full Text]
3. Blader, I. J., I. D. Manger, and J. C. Boothroyd. 2001. Microarray analysis reveals previously unknown changes in Toxoplasma gondii-infected human cells. J. Biol. Chem. 276:24223-24231.[Abstract/Free Full Text]
4. Brenier-Pinchart, M.-P., I. Villena, C. Mercier, F. Durand, J. Simon, M.-F. Cesbron-Delauw, and H. Pelloux. 2006. The Toxoplasma surface protein SAG1 triggers efficient in vitro secretion of chemokine ligand (ccl2) from human fibroblasts. Microbes Infect. 8:254-261.[CrossRef][Medline]
5. Buckley, C. D., D. Pilling, J. M. Lord, A. N. Akbar, D. Scheel-Toellner, and M. Salmon. 2001. Fibroblasts regulate the switch from acute resolving to chronic persistent inflammation. Trends Immunol. 22:199-204.[CrossRef][Medline]
6. Bumke, M. A., D. Neri, and G. Elia. 2003. Modulation of gene expression by extracellular pH variations in human fibroblasts: a transcriptomic and proteomic study. Proteomics 3:675-688.[CrossRef][Medline]
7. Carmen, J. C., L. Hardia, and A. P. Sinai. 2006. Toxoplasma gondii inhibits ultraviolet light-induced apoptosis through multiple interactions with the mitochondrion-dependent programmed cell death pathway. Cell. Microbiol. 8:301-315.[CrossRef][Medline]
8. Chang, H. Y., J.-T. Chi, S. Dudoit, C. Bondre, M. van de Rijn, D. Botstein, and P. O. Brown. 2002. Diversity, topographic differentiation, and positional memory in human fibroblasts. Proc. Natl. Acad. Sci. USA 99:12877-12882.[Abstract/Free Full Text]
9. Channon, J. Y., K. A. Miselis, L. A. Minns, C. Dutta, and L. H. Kasper. 2002. Toxoplasma gondii induces granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor secretion by human fibroblasts: implications for neutrophil apoptosis. Infect. Immun. 70:6048-6057.[Abstract/Free Full Text]
10. Chaussabel, D., R. T. Semnani, M. A. McDowell, D. Sacks, A. Sherr, and T. B. Nutman. 2003. Unique gene expression profiles of human macrophages and dendritic cells to phylogenetically distinct parasites. Blood 102:672-681.[Abstract/Free Full Text]
11. Cleary, M. D., U. Singh, I. J. Blader, J. L. Brewer, and J. C. Boothroyd. 2002. Toxoplasma gondii asexual development: identification of developmentally regulated genes and distinct patterns of gene expression. Eukaryot. Cell 1:329-340.[Abstract/Free Full Text]
12. Draghici, S., P. Khatri, R. P. Martins, G. C. Ostermeier, and S. A. Krawetz. 2003. Global functional profiling of gene expression. Genomics 81:98-104.[CrossRef][Medline]
13. Dzierszinski, F., M. Nishi, L. Ouko, and D. S. Roos. 2004. Dynamics of Toxoplasma gondii differentiation. Eukaryot. Cell 3:992-1003.[Abstract/Free Full Text]
14. Eisen, M. B., and P. O. Brown. 1999. DNA arrays for analysis of gene expression. Methods Enzymol. 303:179-205.[Medline]
15. Ferguson, D. J. 2004. Use of molecular and ultrastructural markers to evaluate stage conversion of Toxoplasma gondii in both the intermediate and definitive host. Int. J. Parasitol. 34:347-360.[CrossRef][Medline]
16. Fox, B. A., and D. J. Bzik. 2002. De novo pyrimidine biosynthesis is required for virulence of Toxoplasma gondii. Nature 415:926-929.[CrossRef][Medline]
17. Gail, M., U. Gross, and W. Bohne. 2001. Transcriptional profile of Toxoplasma gondii-infected human fibroblasts as revealed by gene-array hybridization. Mol. Genet. Genomics 265:905-912.[CrossRef][Medline]
18. Gail, M., U. Gross, and W. Bohne. 2004. Transferrin receptor induction in Toxoplasma gondii-infected HFF is associated with increased iron-responsive protein 1 activity and is mediated by secreted factors. Parasitol. Res. 94:233-239.[CrossRef][Medline]
19. Gilbert, L. A., S. Ravindran, J. C. Boothroyd, and P. J. Bradley. Toxoplasma gondii targets a protein phosphatase 2C-like protein to the nucleus of infected cells. Eukaryot. Cell, in press.
20. Goebel, S., U. Gross, and C. G. Luder. 2001. Inhibition of host cell apoptosis by Toxoplasma gondii is accompanied by reduced activation of the caspase cascade and alterations of poly (ADP-ribose) polymerase expression. J. Cell Sci. 114(Pt. 19):3495-3505.[Abstract/Free Full Text]
21. Hakansson, S., A. J. Charron, and D. Sibley. 2001. Toxoplasma evacuoles: a two-step process of secretion and fusion forms the parasitophorous vacuole. EMBO. 20:3132-3144.[CrossRef][Medline]
22. Hogaboam, C. M., M. L. Steinhauser, S. W. Chensue, and S. L. Kunkel. 1998. Novel roles for chemokines and fibroblasts in interstitial fibrosis. Kidney Int. 54:2152-2159.[CrossRef][Medline]
23. Kim, L., B. A. Butcher, and E. Y. Denkers. 2004. Toxoplasma gondii interferes with lipopolysaccharide-induced mitogen-activated protein kinase activation by mechanisms distinct from endotoxin tolerance. J. Immunol. 172:3003-3010.[Abstract/Free Full Text]
24. Kim, S. K., and J. C. Boothroyd. 2005. Stage-specific expression of surface antigens by Toxoplasma gondii as a mechanism to facilitate parasite persistence. J. Immunol. 174:8038-8048.[Abstract/Free Full Text]
25. Knight, B. C., C. L. Brunton, N. C. Modi, G. R. Wallace, and M. R. Stanford. 2005. The effect of Toxoplasma gondii infection on expression of chemokines by rat retinal vascular endothelial cells. J. Neuroimmunol. 160:41-47.[CrossRef][Medline]
26. Lee, C. W., S. Bennouna, and E. Y. Denkers. 2006. Screening for Toxoplasma gondii-regulated transcriptional responses in lipopolysaccharide-activated macrophages. Infect. Immun. 74:1916-1923.[Abstract/Free Full Text]
27. Luder, C. G., W. Walter, B. Beuerle, M. J. Maeurer, and U. Gross. 2001. Toxoplasma gondii down-regulates MHC class II gene expression and antigen presentation by murine macrophages via interference with nuclear translocation of STAT1 alpha. Eur. J. Immunol. 31:1475-1484.[CrossRef][Medline]
28. Molestina, R. E., and A. P. Sinai. 2005. Host and parasite-derived IKK activities direct distinct temporal phases of NF-kB activation and target gene expression following Toxoplasma gondii infection. J. Cell Sci. 118(Pt. 24):5785-5796.[Abstract/Free Full Text]
29. Nash, P. B., M. B. Purner, R. P. Leon, P. Clarke, R. C. Duke, and T. J. Curiel. 1998. Toxoplasma gondii-infected cells are resistant to multiple inducers of apoptosis. J. Immunol. 160:1824-1830.[Abstract/Free Full Text]
30. Saeij, J. P. J., S. Coller, J. P. Boyle, M. Jerome, M. W. White, and J. C. Boothroyd. Toxoplasma co-opts host gene expression by injection of a polymorphic kinase homologue. Nature, in press.
31. Schwarz, J. A., A. E. Fouts, C. A. Cummings, D. J. Ferguson, and J. C. Boothroyd. 2005. A novel rhoptry protein in Toxoplasma bradyzoites and merozoites. Mol. Biochem. Parasitol. 114:159-166.[CrossRef]
32. Shapira, S., O. S. Harb, J. Margarit, M. Matrajt, J. Han, A. Hoffmann, B. Freedman, M. J. May, D. S. Roos, and C. A. Hunter. 2005. Initiation and termination of NF-{kappa}B signaling by the intracellular protozoan parasite Toxoplasma gondii. J. Cell Sci. 118(Pt. 15):p. 3501-3508.
33. Sinai, A. P., T. M. Payne, J. C. Carmen, L. Hardia, S. J. Watson, and R. E. Molestina. 2004. Mechanisms underlying the manipulation of host apoptotic pathways by Toxoplasma gondii. Int. J. Parasitol. 34:381-391.[CrossRef][Medline]
34. Singh, U., J. L. Brewer, and J. C. Boothroyd. 2002. Genetic analysis of tachyzoite to bradyzoite differentiation mutants in Toxoplasma gondii reveals a hierarchy of gene induction. Mol. Microbiol. 44:721-733.[CrossRef][Medline]
35. Spear, W., D. Chan, I. Coppens, R. S. Johnson, A. Giaccia, and I. J. Blader. 2006. The host cell transcription factor hypoxia-inducible factor 1 is required for Toxoplasma gondii growth and survival at physiological oxygen levels. Cell. Microbiol. 8:339-352.[CrossRef][Medline]
36. Tomavo, S.<