This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bandyopadhyay, P.
Right arrow Articles by Steinman, H. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bandyopadhyay, P.
Right arrow Articles by Steinman, H. M.

 Previous Article  |  Next Article 

Infection and Immunity, February 2007, p. 723-735, Vol. 75, No. 2
0019-9567/07/$08.00+0     doi:10.1128/IAI.00956-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Environmental Mimics and the Lvh Type IVA Secretion System Contribute to Virulence-Related Phenotypes of Legionella pneumophila{triangledown}

Purnima Bandyopadhyay, Shuqing Liu,{dagger} Carolina B. Gabbai,{ddagger} Zeah Venitelli,§ and Howard M. Steinman*

Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York

Received 15 June 2006/ Returned for modification 26 July 2006/ Accepted 26 October 2006


arrow
ABSTRACT
 
Legionella pneumophila, the causative organism of Legionnaires' disease, is a fresh-water bacterium and intracellular parasite of amoebae. This study examined the effects of incubation in water and amoeba encystment on L. pneumophila strain JR32 and null mutants in dot/icm genes encoding a type IVB secretion system required for entry, delayed acidification of L. pneumophila-containing phagosomes, and intracellular multiplication when stationary-phase bacteria infect amoebae and macrophages. Following incubation of stationary-phase cultures in water, mutants in dotA and dotB, essential for function of the type IVB secretion system, exhibited entry and delay of phagosome acidification comparable to that of strain JR32. Following encystment in Acanthamoeba castellanii and reversion of cysts to amoeba trophozoites, dotA and dotB mutants exhibited intracellular multiplication in amoebae. The L. pneumophila Lvh locus, encoding a type IVA secretion system homologous to that in Agrobacterium tumefaciens, was required for restoration of entry and intracellular multiplication in dot/icm mutants following incubation in water and amoeba encystment and was required for delay of phagosome acidification in strain JR32. These data support a model in which the Dot/Icm type IVB secretion system is conditionally rather than absolutely required for L. pneumophila virulence-related phenotypes. The data suggest that the Lvh type IVA secretion system, previously thought to be dispensable, is involved in virulence-related phenotypes under conditions mimicking the spread of Legionnaires' disease from environmental niches. Since environmental amoebae are implicated as reservoirs for an increasing number of environmental pathogens and for drug-resistant bacteria, the environmental mimics developed here may be useful in virulence studies of other pathogens.


arrow
INTRODUCTION
 
Legionnaires' disease is a potentially fatal pneumonia acquired by inhalation of aerosols containing Legionella pneumophila from standing-water reservoirs of man-made origin (10, 11, 47). L. pneumophila, the causative organism (58), is a fresh-water bacterium capable of entry and intracellular multiplication in aquatic amoebae (38, 39). In response to environmental stress, amoebae containing internalized bacteria can form cysts that resist killing by water purification treatment (32, 39, 49, 70). In this fashion, L. pneumophila housed within amoeba cysts is proposed to enter domestic water supplies. Subsequent aerosolization and inhalation of encysted bacteria by susceptible persons is proposed to lead to Legionnaires' disease via entry, intracellular multiplication, and killing of alveolar macrophages by L. pneumophila.

Virulence genes in L. pneumophila have been identified by screening for defective phenotypes following infection of macrophages and amoebae with bacteria cultured to stationary phase in rich medium. This approach identified mutants in the dot/icm (defective organelle trafficking/intracellular multiplication) genes (9, 12, 72, 96). Based on homology of dot/icm genes to plasmid conjugation genes and to the virB/virD genes of type IV secretion systems (T4SSs) found in Agrobacterium tumefaciens, Helicobacter pylori, and other bacterial species (15, 18, 24, 65, 102), the dot/icm genes were proposed to encode a T4SS (98). The L. pneumophila dot/icm T4SS, also found in Coxiella burnetii, was designated a type IVB secretion system (SS) and the virB/virD T4SSs was designated type IVA SS, reflecting different chromosomal organizations of the genes and the fact that only four of 25 L. pneumophila dot/icm genes showed homology to the more widely distributed virB/virD genes (26, 76, 82, 98).

The DotA membrane protein (9, 71) and DotB ATPase (81) are considered essential for function of the Dot/Icm T4SS. Mutants in dotA or dotB are defective in entry, delay of acidification of L. pneumophila-containing phagosomes, intracellular multiplication, and cytotoxicity toward host cells when stationary-phase cultures are used for infection of host cells (3, 6-8, 43, 48, 50, 71, 80, 81, 99). On this basis, the Dot/Icm T4SS is proposed to be essential for these virulence-related phenotypes. The virulence-related substrates of the Dot/Icm T4SS are effector proteins made by L. pneumophila whose translocation into host cells is proposed to be required for delay of acidification of the L. pneumophila-containing phagosome, intracellular multiplication, and cytotoxicity to the host. Functions of DotA, DotB, and other Dot/Icm proteins and of the known effector proteins have been recently reviewed (62, 76).

Since L. pneumophila is an environmental pathogen found in association with aquatic amoebae (38, 39, 70), the effects of nutrient limitation and coculture with amoebae on virulence-related phenotypes have been studied frequently. Virulence-related phenotypes of L. pneumophila were enhanced in stationary-phase compared to exponential-phase broth cultures (16) and following intracellular multiplication in amoebae (27, 28). These observations led to current models for the role of nutrient limitation in the induction of dot/icm genes (41, 42) and the role of regulatory networks in the transition of bacteria from an intracellular replicative form to a transmissive form capable of invading new host cells (37, 63, 75). In these studies, L. pneumophila with wild-type dot/icm genes was used, and nutrient limitation was achieved by growth of bacterial cultures to postexponential or stationary phase in rich medium.

Our laboratory is studying how virulence-related phenotypes of dot/icm mutants can be enhanced by mimicking environmental niches of L. pneumophila. Since dot/icm mutants are generally defective in virulence-related phenotypes, this approach has the potential to identify new virulence factors that function in the absence of a Dot/Icm T4SS and thus are dot/icm independent (6, 48). We previously reported that incubating stationary-phase cultures of dotA or dotB mutants of strain JR32 in buffered saline reversed the defective entry of the mutants, restoring entry to the level of strain JR32, and implicated a tetratricopeptide repeat-containing protein in restoration of entry (6). Those studies led to the hypothesis that culture conditions mimicking environmental reservoirs for Legionnaires' disease play a critical role in determining whether dotA and dotB and, by implication, the Dot/Icm T4SS or Dot/Icm-independent factors are required for virulence-related phenotypes.

Here, we describe studies testing that hypothesis using exposure to water as a mimic of the aquatic milieu of L. pneumophila and encystment in the environmental amoeba Acanthamoeba castellanii. Our data support a model in which a defective Dot/Icm T4SS can be functionally replaced by the Lvh T4SS in entry, delay of phagosome acidification, and intracellular multiplication phenotypes under conditions mimicking aquatic and amoeba-encysted niches of L. pneumophila.


arrow
MATERIALS AND METHODS
 
Bacterial strains and culture conditions. All L. pneumophila mutants were derived from serotype 1 strain JR32 (72, 100) (Table 1). Legionella strains were revived from –70°C storage on charcoal-N-(2-acetamido)-2-aminoethanesulfonic acid (ACES)-buffered (pH 6.9) yeast extract agar (CAYE) plates and then cultured in ACES-buffered (pH 6.9) yeast extract (AYE) broth (36, 46) to stationary phase, with an optical density at 600 nm of >2.7 (16). When required, chloramphenicol, hygromycin sulfate, and gentamicin sulfate were present at 5, 100, and 10 µg/ml, respectively. Recombinant constructions used Escherichia coli strain DH5{alpha}, cultured in Luria-Bertani medium (84) with chloramphenicol, hygromycin sulfate, and gentamicin sulfate present at 25, 150, and 5 µg/ml, respectively. All cultures were incubated at 37°C with aeration unless otherwise indicated. Bacterial viability was determined with the Live/Dead BacLight technique (Molecular Probes, Invitrogen, Carlsbad, CA).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Strains and plasmids

WS treatment. WS (water stress)-treated cultures were prepared from stationary-phase cultures that were grown overnight at 30°C or 37°C in 5 ml of AYE broth in a 16- by 150-mm glass culture tube on a rotary shaker at 30 to 55 rpm. After overnight growth, the culture was centrifuged for 10 min at 3,000 x g at 4°C; the supernatant was aspirated, and the pellet was resuspended in 5 ml of autoclaved distilled, deionized water and then incubated for 18 to 19 h in an 16- by 150-mm glass culture tube in a rotary at 30 to 55 rpm at the same temperature as the AYE broth culture.

Amoebae and macrophage lines and culture conditions. A. castellanii (ATCC 30234) was cultured at 28°C in peptone yeast extract glucose (PYG) medium in25-cm2 or 75-cm2 tissue culture flasks containing 10 ml or 20 ml of PYG, respectively, as described earlier (3, 6, 43, 80). The HL-60 human leukemic monocyte cell line was maintained in RPMI 1640 medium supplemented with 2 mM L-glutamine (6, 43, 80); the MH-S BALB/c mouse alveolar macrophage line (ATCC CRL-2019) was maintained in RPMI 1640 medium with 2 mM L-glutamine, 10 mM HEPES, 1 mM sodium pyruvate, 0.25% glucose, and 0.05 mM 2-mercaptoethanol (56); and the J774 BALB/c mouse peritoneal macrophage line was maintained in RPMI 1640 medium with 2 mM L-glutamine (21). All cell culture media contained 10% heat-inactivated fetal bovine serum and penicillin-streptomycin (PenStrep; 5,000 U/ml). All cell cultures were maintained at 37°C in a humidified atmosphere containing 5% CO2.

Preparation of macrophages from mouse bone marrow. Bone marrow macrophages (BMMs) of 11- to 12-week-old female A/J mice (Harlan, Indianapolis, IN) were prepared as previously described (88) and maintained at 37°C in 5% CO2. Bone marrow exudates were maintained in alpha minimal essential medium, 15% fetal bovine serum, and 10,000 U/ml colony-stimulating factor 1 for 7 days; samples were then washed and incubated overnight in RPMI medium, 10% fetal bovine serum, and 10,000 U/ml colony-stimulating factor 1 prior to intracellular multiplication, entry, and phagosome acidification experiments on the following day.

Plasmids. Transformation of L. pneumophila with green fluorescent protein (GFP), lvh complementation, or lacZ fusion plasmids (Table 1) was accomplished by natural competence (64, 92) or by electroporation (6).

Construction of {Delta}lvh null mutants. The {Delta}lvh mutation, in which the lvh locus is replaced by a Gmr cassette, was introduced into dotA and dotB mutants by allelic exchange using the same allelic exchange plasmid previously used to construct {Delta}lvh dotB and {Delta}lvh icmE double mutants (77). As described previously (5, 77), individual Gmr transformants obtained following electroporation were streaked on CAYE-gentamicin-2% sucrose plates and Gmr Sucr Cms colonies screened by PCR to identify the desired allelic exchange double mutant.

Immunofluorescence assay for entry of Legionella into A. castellanii and macrophages. Amoebae (5 x 106 cells in A. castellanii buffer) (6) or macrophages (1.5 x 106 cells in tissue culture medium) were added in 0.5-ml aliquots to 12-mm diameter glass coverslips in 24-well microtiter dishes. After 1 (amoebae) or 2 (macrophages) h, cell monolayers were washed and infected with L. pneumophila in fresh A. castellanii buffer or tissue culture medium without PenStrep and then centrifuged at 700 x g for 10 min at 25°C. In any given experiment, at least two coverslips were infected for each strain/culture condition, and data from replicate coverslips were in agreement. Entry experiments with amoebae were performed at 28°C with L. pneumophila cultured at 37°C. Macrophage entry experiments were performed at 37°C with L. pneumophila cultured at 37°C. After 30 min and 1 h, respectively, amoeba and macrophage monolayers were washed with 20% DPBS (Dulbecco's phosphate-buffered saline), formaldehyde fixed, and stained as previously described (43) with the following modifications. Monolayers were incubated with rabbit anti-L. pneumophila serotype 1 antibody (m-Tech, Atlanta, GA) and then with Cy3-conjugated donkey anti-rabbit immunoglobulin G (IgG) (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA); coverslips were then inverted and mounted onto microscope slides using 1x phosphate-buffered saline (pH 7.4)-0.1 M n-propyl gallate in 50% glycerol.

Immunofluorescence assay for acidification of Legionella-containing phagosomes in macrophages. J774 macrophages were resuspended to a concentration of 2 x 105 cells/ml in tissue culture medium, without PenStrep and containing a 1:20,000 dilution of LysoTracker Red DND 99 (Molecular Probes, Invitrogen, Carlsbad, CA) at a concentration of 1 mM in dimethyl sulfoxide(97), and 0.5-ml aliquots were put into wells of a 24-well tissue culture plate containing glass coverslips. After 2 h at 37°C, cell monolayers were washed with DPBS and infected with L. pneumophila that had been cultured at 37°C, resuspended in tissue culture medium lacking PenStrep, and then centrifuged at 700 x g for 10 min at 25°C. In any given experiment, at least two coverslips were infected for each strain/culture condition, and data from replicate coverslips were in agreement. After 1 h at 37°C cell monolayers were washed with DPBS, fixed with formaldehyde, stained, and mounted as described above for assay of entry. Acidification of L. pneumophila-containing phagosomes was scored as the colocalization of GFP fluorescence with LysoTracker Red fluorescence in macrophages.

Assay of intracellular multiplication by titer of L. pneumophila. Monolayers of A. castellanii were infected at 28°C with L. pneumophila cultured to stationary phase or WS-treated at 30°C, and intracellular multiplication was monitored by the titer of bacteria in aliquots removed from the A. castellanii buffer infection medium, as described previously (3, 6). For the titer of bacteria internalized in macrophages, washed macrophage monolayers were lysed by the addition of 0.5 ml of 0.1% saponin in water and incubation at room temperature for 20 min (53). Monolayers of HL-60-derived macrophages, MH-S macrophages, J774 macrophages, or BMMs were infected at 37°C with L. pneumophila cultured at 37°C and resuspended in tissue culture medium lacking PenStrep, and intracellular multiplication was monitored by titer, as described previously (5, 80). For each time point, titers were determined for three aliquots, and the mean ± standard deviation was plotted. Infections were performed in 24-well microtiter plates containing 0.5 ml of 2.5 x105 A. castellanii cells or macrophages per well. In any given experiment, at least two wells were infected for each strain/culture condition, and data from replicate wells were in agreement.

Amoeba encystment and intracellular multiplication in amoeba trophozoites. L. pneumophila cells were grown to stationary phase in AYE broth at 30°C, incubated in distilled, deionized water for 19 h at 30°C as described for WS treatment above, and then added at a multiplicity of infection (MOI) of 10 to adherent A. castellanii in 20 ml of A. castellanii buffer in 75-cm2 tissue culture flasks. After 30 min at 28°C, external bacteria were removed by washing the monolayer five times, each with 20 ml of A. castellanii buffer. Then, 20 ml of fresh A. castellanii buffer was added, and the flask was incubated at 4°C for conversion of amoeba trophozoites to amoeba cysts (B. S. Fields, personal communication). Monitored microscopically, the conversion to cysts was complete within 60 min. After 21 h at 4°C the cysts were pelleted by centrifugation for 10 min at 3,000 x g at 4°C and resuspended in A. castellanii buffer to a concentration of 5 x 105 cysts/ml at room temperature, where conversion to trophozoites was complete in 20 min. Aliquots of 0.5 ml were added to glass coverslips placed in wells of 24-well tissue culture plates. After 1 h at 28°C the coverslips were washed three times each with 0.5 ml of A. castellanii buffer, 0.5 ml of fresh A. castellanii buffer was added, and then aliquots were periodically removed for titer of triplicate aliquots of L. pneumophila on CAYE plates as described in the preceding section. In any given experiment, at least two coverslips were infected for each strain/culture condition, and data from replicate coverslips were in agreement.

Microscopic analysis of intracellular multiplication after encystment in amoebae. For these experiments, L. pneumophila expressing GFP was used. L. pneumophila culturing, A. castellanii infection, cyst formation, and conversion to trophozoites were performed as described in the preceding section. However, at the point in the protocol when trophozoites were resuspended to a concentration of 5 x 105/ml following 21 h at 4°C, 6 ml of this amoeba suspension was added to a 60- by 15-mm petri dish containing 12 glass coverslips placed adjacent to one another (94). After 1 h at 28°C the coverslips were washed in the petri dish with 6 ml of A. castellanii buffer, and 6 ml of fresh A. castellanii buffer was added. At that time and at each subsequent time point, at least two coverslips were removed from the petri dish for analysis, washed with 20% DPBS, and processed by fixation and staining as described for entry experiments. GFP-expressing L. pneumophila and the corresponding strains without GFP showed comparable intracellular multiplication by titer of released bacteria in the above infection and encystment protocol.

Fluorescence microscopy. Microscope slides with immunofluorescence samples were observed at a magnification of x60 using a HiQ band pass fluorescein isothiocyanate filter for GFP fluorescence and a tetramethyl rhodamine isothiocyanate filter for rhodamine and Cy3 (Chroma Technology Corp., Brattleboro, VT) with Zeiss Axioskop epifluorescence microscopes. Bacteria within the host cell are not accessible to the antibody. Internalized L. pneumophila organisms were scored as those within the confines of a host cell envelope that were green with the GFP filter and not visible with the rhodamine filter (6, 43, 97). In immunofluorescence assays for entry, 130 to 190 amoeba or macrophage host cells containing zero, one, or more internalized bacteria were counted for each strain in each experiment (Fig. 1 and 2). In assays for acidification of Legionella-containing phagosomes, 90 to 100 macrophage host cells containing one or more internalized bacteria were counted for each strain in each experiment (Fig. 3). In microscopic assays for intracellular growth after reversion of amoeba cysts to trophozoites, 90 to 120 amoeba host cells containing one or more internalized bacteria were counted for each strain in each experiment except for some time zero and 1-h time points for {Delta}lvh dotA or {Delta}lvh dotB double mutants, where only 50 to 60 amoebae could be counted because entry was very inefficient at the MOI used (see Fig. 6).


Figure 1
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 1. Reversal of defective entry into amoebae and macrophages by WS treatment. Stationary phase (Stat) or WS-treated (WS) cultures of the indicated L. pneumophila strains were used to infect A. castellanii trophozoites (A), J774 mouse macrophages (B), or primary cultures of bone marrow macrophages from A/J mice (C) at an MOI of 2 at 28°C (A) or 100 at 37°C (B and C). At 30 min (A and C) or 60 min (B) postinfection, samples were fixed and stained, and entry of GFP-expressing Legionella was quantified by epifluorescence microscopy. Means and standard deviations are shown. The number of independent experiments, i.e., experiments performed on separate days in addition to the replicates performed on a given day, in which the effect of WS treatment on entry was shown is three for dotA and five for dotB in panel A; seven for dotA, six for dotB, and two for all other dot/icm mutants in panel B, and three for dotA and three for dotB in panel C.


Figure 2
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 2. Reversal of defective entry by WS treatment requires the lvh locus. Entry into A. castellanii trophozoites (A) or J774 macrophages (B) was quantified as described in the legend of Fig. 1. Strains are the {Delta}lvh deletion mutant, the {Delta}lvh dotA dotB double mutants, or double mutants complemented with the lvh locus on a plasmid, plvh+. In panel A reference values for the dotA and dotB single mutants are 1.5 (stationary phase) and 50 (WS) and 11.2 (stationary phase) and 66 (WS), respectively, internalized bacteria/50 amoebae. Reference values in panel B for the dotA and dotB single mutants are, respectively, 7.9 (stationary phase) and 48 (WS) and 5.6 (stationary phase) and 34 (WS), respectively, internalized bacteria/50 J774 macrophages. The number of independent experiments in which the effect of the {Delta}lvh mutation on entry and complementation of this effect were shown is two for {Delta}lvh dotA, two for {Delta}lvh dotA plvh+, and three for {Delta}lvh dotB in panel A and one for {Delta}lvh dotA and {Delta}lvh dotA plvh+, three for {Delta}lvh dotB, and one for {Delta}lvh dotB plvh+ in panel B. Stat, stationary phase.


Figure 3
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 3. Effect of WS treatment and the lvh locus on delay of phagosome acidification. Cultured J774 macrophages (A and C) or primary cultures of bone marrow mouse macrophages (B) were incubated with LysoTracker Red then infected with stationary phase (Stat) or WS-treated (WS) cultures of the indicated L. pneumophila strain at an MOI of 10 or 50 (A and C) or 100 (B) at 37°C. After 1 h, the samples were fixed and stained, and colocalization of GFP-expressing Legionella with LysoTracker was quantified by epifluorescence microscopy. (A and B) The colocalization of stationary-phase cultures was significantly different from that of the respective WS culture (P < 0.001) for dotA, dotB, icmE, and icmF mutants of strain JR32. For these four strains colocalization of WS cultures was not significantly different from that of WS-treated strain JR32 (P values of 0.12 to 0.84). Colocalization of the {Delta}lvh dotB double mutant was significantly different from that of the {Delta}lvh mutant for WS cultures (P = 0.02) and showed a trend to be different for {Delta}lvh dotB and {Delta}lvh Stat cultures (P = 0.12). (C) Colocalization with LysoTracker in J774 macrophages for strain JR32 or the {Delta}lvh mutant containing no vector, vector pMMB207, or the complementing pMMB207 plasmid (plvh+) was determined as in panel A. Following complementation, colocalization of stationary-phase {Delta}lvh mutant was significantly different from {Delta}lvh mutant strains without vector or with pMMB207 (P < 0.006). Colocalization for the WS-complemented {Delta}lvh mutant showed a trend to be different from {Delta}lvh strains with no vector or with pMMB207 (P values of 0.1 to 0.2). Colocalization of the JR32 strain with plvh+ was not significantly different from JR32 strains with no vector or with pMMB207 for stationary-phase or WS cultures (P > 0.6). The number of independent experiments in which the effect of WS on colocalization was as shown in panel A is nine for dotA, six for dotB, five for {Delta}lvh, three for icmG, two for icmE and icmF, and one for the {Delta}lvh dotB mutant. Reversal of defective colocalization in BMMs as in panel B was shown in two independent experiments for dotA and dotB. Complementation of the defective colocalization of stationary-phase or WS-treated {Delta}lvh mutant (C) was shown in two independent experiments.


Figure 6
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 6. Microscopic assay of intracellular growth after reversion of amoeba cysts to trophozoites. A. castellanii trophozoites were infected with the indicated WS-treated Legionella strain containing plasmid GFP, converted to amoeba cysts, then reverted to trophozoites as described in the legend of Fig. 5, and then adhered to glass coverslips. At the indicated times after adherence to coverslips, infected amoebae were fixed and stained for visualization of internal bacteria. In panel A values at 22 h are significantly different from respective values at 1 h for JR32, {Delta}lvh, dotA, and dotB strains (P ≤ 0.02). For {Delta}lvh dotA and {Delta}lvh dotB strains, values at 22 and 47 h are not significantly different from respective values at 1 h (P > 0.3). For dotA and dotB strains, values at 47 h are not significantly different from respective values at 1 h (P > 0.3). Intracellular replication was shown in three independent experiments for the dotA and dotB mutants, and a decrease in replication for the {Delta}lvh dotA and {Delta}lvh dotB mutants was shown in two independent experiments. In panel B at 4.5 h, P values for single versus {Delta}lvh double mutants are 0.064 and 0.029 for dotA and dotB mutants, respectively. At 21 h, P values for the corresponding comparisons are 0.11 and 0.001. The P values for the {Delta}lvh double mutants versus the corresponding strains complemented with plvh+ are 0.16 and 0.19 for dotA and dotB mutants, respectively, at 4.5 h and 0.35 and 0.013, respectively, at 21 h. The experiment with the plvh+-complemented strains in panel B was performed once.

LacZ fusion measurements. The upstream 411 nucleotides and the first seven codons of the lvhB2 gene were amplified by PCR and ligated into the EcoRI site of the lacZ translational fusion vector pGS-lac-01 using EcoRI sites in the PCR primers CGCTACCGAATTCCGATGTGGTACTGACCAAGGC and CGGTTCCGAATTCCTCCATCGTTTTAATTTGCTCATGGC. L. pneumophila strains JR32, dotA::Tn903dIIlacZ, and dotB::Tn903dIIlacZ were transformed by electroporation with plasmids containing the lvhB2 promoter region in the forward and in the reverse orientation with respect to the lacZ open reading frame. Activity of ß-galactosidase was determined as described previously (4). To correct for LacZ activity from the Tn903dIIlacZ insertions (72, 100), the Miller units (4, 59) were calculated as for the strain with lvhB2 promoter in the forward orientation and corrected for the strain with lvhB2 promoter in the reverse orientation, cultured under identical conditions and for the same duration.

Statistical analyses. For entry experiments, the total data set from 130 to 190 host cells was divided into three subgroups which were then used for calculation of means ± standard deviations and P values by a two-sided t test. For phagosome acidification experiments and microscopic assay of intracellular multiplication, P values were calculated using a chi-square test to compare the entire data set of host cells counted for each strain/culture condition. For these experiments a standard deviation is not appropriate because the input data are discontinuous. A bacterium is either colocalized or not colocalized with LysoTracker or an amoeba contains either 1 or >1 internalized Legionella bacteria. Thus, means are shown without standard deviations and P values are cited.


arrow
RESULTS
 
WS as a mimic of the aquatic milieu of L. pneumophila. As a bacterium ubiquitous in fresh-water reservoirs, L. pneumophila is expected to replicate when nutrients are available, enter stationary phase when nutrients are depleted, and exist in stationary phase in low osmolarity regions of the reservoir. As a laboratory mimic of that aquatic milieu, L. pneumophila was grown to stationary phase in broth medium and then resuspended overnight in distilled, deionized water, a treatment named water stress (WS). Viability was not diminished by the WS mimic. L. pneumophila strain JR32 was 91% ± 0.7% and 91% ± 1.4% viable in stationary-phase cultures and after WS treatment, respectively. Respective values for the dotA mutant of strain JR32 were 89% ± 2.1% and 92% ± 1.2%, indicating that viability was not decreased in a strain lacking a functional Dot/Icm T4SS.

WS reverses the defective entry of dot/icm mutants into macrophage and amoebae. Defective entry of dotA and dotB mutants of strain JR32 into A. castellanii amoebae (Fig. 1A), cultured J774 murine macrophages (Fig. 1B), and primary cultures of macrophages from bone marrow of A/J mice (Fig. 1C, BMMs) was reversed by WS treatment. Defective entry of the dotA mutant into HL-60-derived macrophages was also reversed by WS treatment, increasing from 25% to 150% of strain JR32 (data not shown). WS treatment reversed defective entry into J774 murine macrophages for null mutants in icmF, icmQ, and icmT but not for icmR and icmS mutants (Fig. 1B). IcmQ, a substrate of the IcmR chaperone (30, 34), forms pores in lipid membranes and may be involved in pore formation in host membranes (35). IcmT is required for egress from host cells following intracellular multiplication (61). The functions of IcmF and IcmS in the Dot/Icm type IVB SS are not well defined (76).

Given the essentiality of DotA and DotB for function of the Dot/Icm T4SS, the data in Fig. 1 suggest that the Dot/Icm T4SS is dispensable for entry when WS-treated Legionella infect amoebae, cultured human or murine macrophages, or primary cultures of mouse bone marrow-derived macrophages.

The Legionella lvh locus encodes a type IVA secretion system. The above data demonstrating entry in the absence of a functional Dot/Icm T4SS suggest involvement of an alternative T4SS. In fact, all three sequenced L. pneumophila strains and strain JR32 used in this study contain the lvh (Legionella virulence homolog) locus encoding a type IVA secretion system (19, 22, 73). In contrast to the dot/icm loci, the lvh type IVA locus is highly homologous to the virB/virD loci of A. tumefaciens, H. pylori, and Bordetella pertussis (23, 77, 102). However, a mutant of strain JR32 with a deletion of the entire lvh locus was unchanged in entry, intracellular multiplication, and cytotoxicity to HL-60-derived macrophages and J774 macrophages as well as in intracellular multiplication in A. castellanii amoebae when stationary-phase cultures are used for infection (77; also data not shown). Nonetheless, an in-frame deletion mutant of lvhB2 encoding a putative pilin subunit of the Lvh T4SS in L. pneumophila strain AA100 exhibits decreased intracellular multiplication in HL-60 macrophages when grown at 30°C compared to 37°C (69). This result suggested that the lvh locus might be involved in virulence phenotypes when L. pneumophila is cultured under conditions different from those routinely used for stationary-phase broth cultures.

The lvh type IVA SS locus is required for reversal of defective entry of dot/icm mutants by WS treatment. To determine if the lvh locus is involved in reversal of virulence defects in dotA and dotB mutants following WS treatment, entry was studied in the lvh deletion mutant described above (77) and in {Delta}lvh dotA and {Delta}lvh dotB double mutants (Table 1). The {Delta}lvh mutant was not defective in entry into amoebae (Fig. 2A) or J774 macrophages (Fig. 2B) when stationary or WS-treated cultures were used for infection. As expected from stationary-phase entry defects of dotA and dotB mutants (Fig. 1A, B), stationary-phase cultures of the {Delta}lvh dotA and {Delta}lvh dotB double mutants were defective for entry into both amoeba and macrophage hosts (Fig. 2A and B). However, the defective entry of the {Delta}lvh dotA and {Delta}lvh dotB double mutants was not reversed by WS treatment, contrasting with WS reversal of defective entry in dotA and dotB single mutants (Fig. 1). These results suggested that the lvh locus was involved in WS reversal of defective entry in the dotA and dotB mutants. Similar experiments with {Delta}lvh icmE and {Delta}lvh icmT double mutants implicated the lvh locus in WS reversal of defective entry of icmE and icmT mutants into J774 macrophages (data not shown). IcmE is homologous to the VirB10 proteins of type IVA SSs, but its function in the Dot/Icm T4SS is not known (76).

Complementation of double mutants with the lvh locus gave further support to a role for the lvh locus in reversal of defective entry by WS treatment. Plasmid lvh restored WS reversal of defective entry into amoebae for the {Delta}lvh dotA double mutant (Fig. 2A) and defective entry into J774 macrophages for {Delta}lvh dotA and {Delta}lvh dotB double mutants (Fig. 2B). Entry of stationary-phase cultures of the complemented {Delta}lvh dotA double mutant into J774 macrophages was larger than expected, and complementation of the WS-treated {Delta}lvh lvh dotA mutant was partial for both amoeba and macrophage hosts. These nuances in complementation may be due to differences between amoeba and macrophage hosts, to differences in expression of the lvh locus from the complementing plasmid and from a chromosomal location, to differences in complementation in a dotA mutant defective in a membrane protein and complementation in a dotB mutant defective in a cytosolic protein, and/or to the presence of mobilization genes in the complementing pMMB207 vector which is known to inhibit intracellular multiplication and macrophage killing phenotypes in complementation of dot/icm mutants (79).

Use of LysoTracker Red to quantify acidification of L. pneumophila-containing phagosomes. The delayed acidification of Legionella-containing phagosomes (44, 93) was initially demonstrated using the pH dependence of fluorescence from fluorescein-labeled Legionella (45). More recently, colocalization of internalized L. pneumophila with LAMP-1 or LAMP-2 membrane protein markers of lysosomes and late endosomes has been used (3, 48, 60, 93, 96). Phagosomes containing dotA or dotB mutants acquired LAMP-1 or LAMP-2 markers at a greater frequency than the corresponding parental strain, demonstrating that a functional Dot/Icm T4SS is required for the delayed acidification when stationary cultures from rich medium are used to infect macrophages.

In our studies, acidification of L. pneumophila-containing phagosomes was quantified by colocalization of GFP-expressing bacteria with the LysoTracker Red fluorophore. LysoTracker Red is preferentially retained in acidic vacuoles and is thus a direct probe for phagosome acidification. The equivalence of LysoTracker Red and LAMP-1 for assessing acidification of L. pneumophila-containing phagosomes is supported by several observations. In J774 murine macrophages, LysoTracker Red and LAMP-1 show identical intracellular localizations (97). In BMMs, our LysoTracker Red data are in excellent agreement with published data using LAMP-1 following infection with broth stationary cultures of strain JR32: 29% colocalization with LysoTracker (Fig. 3B) compared to 30% with LAMP-1 (3). Stationary cultures of dotA and dotB mutants of strain JR32 colocalized 70 to 80% with LysoTracker compared to 80 to 90% colocalization with LAMP-1 for dotA and dotB mutants of L. pneumophila strain Lp02 (3).

Water stress reverses the defective acidification of phagosomes containing L. pneumophila dot/icm mutants. Following WS treatment, acidification of phagosomes containing dotA and dotB mutants of strain JR32 was identical to that of strain JR32 in J774 peritoneal macrophages (Fig. 3A) and in murine BMMs (Fig. 3B). WS treatment also reversed the defective acidification of dotA-containing phagosomes in HL-60-derived human macrophages. Colocalization with LysoTracker was 58% for stationary-phase cultures and 32% after WS treatment, compared to 27 and 26%, respectively, for parental strain JR32 (data not shown). In MH-S murine alveolar macrophages, WS treatment of stationary cultures reduced colocalization of the dotA mutant from 56 to 29%, compared to 13% and 19%, respectively, for strain JR32 (data not shown). In sum, our data demonstrated WS reversal of defective phagosome acidification of dotA and dotB mutants in primary and cultured macrophage lines, in human and murine macrophages, and in macrophages of leukemic, bone marrow, peritoneal, and alveolar origins. These data suggested that the Dot/Icm type IVB SS is not required for delayed acidification of L. pneumophila-containing phagosomes when stationary-phase broth cultures are treated with the WS aquatic mimic.

Reversal of defective phagosome acidification in J774 macrophages by WS treatment was also demonstrated for null mutants in icmE and icmF strains but not icmG (Fig. 3B). IcmG interacts with the carboxyl terminus of the RalF translocated protein and is therefore implicated in recognition or escort of translocated proteins (55). The ability to reverse defective phenotypes in some but not all dot/icm mutants, previously noted for reversal of defective entry by treatment with buffered saline (6), is likely a complex function of which genes are differentially expressed by WS treatment and the interaction of Dot/Icm and Lvh T4SS components. Phagosome acidification experiments could not be performed in A. castellanii because LysoTracker dispersed throughout the amoeba cytosol, suggestive of disruption of vacuole structure or toxicity to the amoeba.

The lvh type IVA SS locus is required for effective delay of phagosome acidification in L. pneumophila strain JR32. Phagosomes containing the {Delta}lvh mutant were defective in delay of acidification in J774 macrophages following infection with stationary or WS cultures (Fig. 3A). These data suggested that the lvh locus and, by implication, the Lvh T4SS are required for delay of phagosome acidification in strain JR32. The difference between the 50 to 55% colocalization of the {Delta}lvh mutant and the 65 to 75% colocalization of the dotA and dotB mutants can be attributed to wild-type dot/icm genes and the Dot/Icm T4SS in the {Delta}lvh mutant. Supporting this, the percent colocalization of the {Delta}lvh dotB double mutant tended to be greater than that for the {Delta}lvh mutant. Direct support for involvement of the lvh locus in delayed phagosome acidification was obtained by complementation, comparing colocalization of {Delta}lvh mutant strains containing no vector, the complementation plasmid plvh+ used in the experiment shown in Fig. 2, or an empty pMMB207 vector (Fig. 3C). In the presence of plasmid plvh+, colocalization of the {Delta}lvh mutant decreased, approaching values of strain JR32. Partial complementation can be attributed to the factors discussed above. The presence of the plvh+ plasmid or empty vector had no effect on colocalization of stationary or WS-treated cultures of L. pneumophila strain JR32 (Fig. 3C). Data shown in Fig. 3A and C support the hypothesis that the lvh locus and, by implication, the Lvh T4SS are required for delay of phagosome acidification of strain JR32 and for reversal of defective acidification of the dotB mutant by the WS mimic of aquatic niches of L. pneumophila.

Although the {Delta}lvh mutant was defective in delay of phagosome acidification in macrophages (Fig. 3A), it replicated identically to its parental strain JR32 when stationary-phase cultures were used to infect HL-60-derived macrophages (77) or J774 macrophages (data not shown). This intracellular multiplication could be attributed to the Dot/Icm T4SS present and functional in the {Delta}lvh mutant and to the fact that ~45% of {Delta}lvh mutant bacteria reside in phagosomes that are delayed in acidification (Fig. 3A) and are thus, presumably, able to acquire an intracellular multiplication phenotype.

Defective intracellular multiplication in amoebae and macrophages is not reversed by WS treatment. Since WS treatment of dot/icm mutants reversed their defective entry and delay of phagosome acidification, which precede intracellular multiplication, the effect of WS treatment on intracellular multiplication was tested. The Tn903 insertion mutants of dotA (80) and dotB used in these studies were unable to replicate in A. castellanii amoebae and J774 macrophages following infection with stationary-phase broth cultures (Fig. 4A and B). The inability of stationary-phase dotA and dotB mutants to replicate in BMMs and the MH-S alveolar macrophage line was also demonstrated (data not shown).


Figure 4
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 4. Stationary-phase and WS-treated cultures of dotA and dotB mutants are nonreplicative in amoeba trophozoites and macrophages. A. castellanii trophozoites (A) or cultured J774 mouse macrophages (B) were infected with stationary-phase (filled symbols) or WS treated cultures (open symbols) of the indicated L. pneumophila strain at an MOI of 1, and intracellular multiplication was quantified by titer of the infection medium during incubation at 28°C (A) or 37°C (B). The number of independent experiments in which stationary-phase or WS-treated cultures were unable to replicate is two for dotA and two for dotB in A. castellanii trophozoites and one for dotA and two for dotB in J774 macrophages. t0, time zero.

Defective intracellular multiplication of dotA or dotB mutants in A. castellanii or J774 macrophages was not reversed by WS treatment (Fig. 4A and B). To test if dotA and dotB mutants replicated intracellularly but were defective in release into the infection medium, as shown for lepA and lepB mutants (21), L. pneumophila was titered following lysis of J774 macrophages with saponin. At 24 h after infection with WS-treated bacteria, the titer of strain JR32 increased 2.7 times while the titer of dotA and dotB mutants was <0.4 times that immediately following infection. These data indicated that dotA and dotB mutants were nonreplicative in macrophages following WS treatment and did not suggest that replication occurs but release from macrophage hosts is defective. We also tested if WS treatment enhanced intracellular multiplication of an icmF mutant which is partially defective in intracellular multiplication in HL-60 macrophages (80). Consistent with prior data for HL-60 macrophages (80), stationary-phase cultures of icmF L. pneumophila showed a partial replication defect in J774 macrophages (data not shown). WS-treated cultures of the icmF mutant were nonreplicative in J774 macrophages as assessed by titering the infection medium or by titering saponin lysates of macrophage host cells (data not shown). In sum, WS treatment was unable to reverse defective intracellular multiplication in nonreplicative dotA and dotB mutants or in the icmF mutant that is partially defective in macrophages infected with stationary-phase cultures.

The amoeba cyst environmental mimic. The entrance of Legionella into domestic water supplies from aquatic niches has been attributed to the resistance of L. pneumophila encysted in amoeba to chlorine used for water purification (49). Coculture with A. castellanii resuscitated L. pneumophila from a viable but nonculturable state (90). These observations prompted the development of an encystment mimic to test the reversal of intracellular multiplication defects in dot/icm mutants. A. castellanii trophozoites were infected with WS-treated dotA and dotB L. pneumophila bacteria, which show entry into amoebae comparable to that of parental strain JR32 (Fig. 1A); the trophozoites were then converted to cysts by cooling to 4°C. This temperature is relevant to the etiology of Legionnaires' disease because L. pneumophila has been isolated from water of 6°C (40), and water temperatures in cooling towers have been reported as low as 8°C (101). After overnight incubation cysts were reverted to trophozoites at 28°C, and intracellular multiplication was quantified.

Mutants in dotA and dotB replicate in amoebae following encystment. The rate of intracellular multiplication of strain JR32 in the encystment mimic (Fig. 5A) was comparable to that following infection of A. castellanii trophozoites with stationary-phase or with WS-treated cultures (Fig. 4A). Following encystment, dotA and dotB mutants replicated intracellularly, as assessed by increased titers in the infection medium, with increases of 50-fold and 19-fold, respectively, at 18 to 27 h after reversion of cysts to trophozoites (Fig. 5B). Control experiments were performed with WS-treated L. pneumophila incubated at 4°C without prior exposure to amoebae and then warmed to 28°C before infection of amoeba trophozoites. Strain JR32 replicated intracellularly, but dotA and dotB mutants were nonreplicative (data not shown) and behaved comparable to data shown in Fig. 4A. These results indicated that intracellular multiplication of dotA and dotB mutants is dependent on encystment of L. pneumophila in amoebae. In the absence of encystment, WS treatment and incubation at 4°C are insufficient to reverse the intracellular multiplication defect of stationary or WS-treated cultures of dotA or dotB mutants.


Figure 5
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 5. Intracellular multiplication of internalized dotA and dotB mutants in amoebae following reversion of cysts to trophozoites. A. castellanii trophozoites were infected with WS-treated cultures of the indicated L. pneumophila strain at an MOI of 10 at 28°C. After 30 min external bacteria were removed by washing, and trophozoites containing internalized bacteria were converted to cysts at 4°C. After 19 h at 4°C, cysts were reverted to trophozoites at 28°C, and intracellular multiplication was quantified by titer of the infection medium at the indicated times after addition to microtiter dishes. The number of independent experiments in which intracellular multiplication comparable to that in panel A was observed is 10 for strain JR32 and seven for the {Delta}lvh mutant. For panel B the number of independent experiments in which an increase in titer comparable to or greater than that shown was observed is five for dotA and seven for dotB. Decreased intracellular multiplication in the {Delta}lvh dotB mutant was observed in three independent experiments. t0, time zero.

To test if the titer increases after encystment were attributable to a progressive egress of dotA or dotB L. pneumophila internalized following WS treatment rather than to authentic intracellular replication, GFP-expressing Legionella were directly observed in fixed amoebae by epifluorescence microscopy. We assumed that 25 to 50 Legionella bacteria were released into the medium on lysis of an infected amoeba cell since encystment can trap ~50 L. pneumophila bacteria per amoeba cyst (32). Calculations showed that the increase in titer (Fig. 5A) at 20 to 24 h is attributable to less than 1% of the amoebae present. Analysis of internalized GFP-expressing L. pneumophila showed 0.3 bacterium per amoeba prior to encystment at 4°C (data not shown). Since very few amoebae contain large numbers of bacteria, the percentage of infected amoebae containing 2 or more GFP-L. pneumophila bacteria was taken as indicative of bacteria undergoing replication (Fig. 6). For strain JR32 and the dotA and dotB strains, this percentage increased between 1 and 22 h after the reversion to trophozoites. Thus, microscopic analysis confirmed that dotA and dotB mutants undergo bona fide intracellular multiplication following WS-mediated entry and amoeba encystment.

The titer of dotA and dotB L. pneumophila in the infection medium decreased between 30 and 47 h after the reversion of cysts to trophozoites (Fig. 5B). When aliquots were removed from the infection medium at 20 to 30 h and maintained at 28°C in the absence of amoebae, the titer was not significantly decreased at 47 h. This indicated that the decrease in titer was not due to loss of plating efficiency in the infection medium (data not shown). Microscopic examination of internalized GFP-expressing Legionella showed that the number of replicating dotA and dotB mutants decreased between 22 and 47 h while the percentage of replicating bacteria of the parental strain JR32 continued to increase (Fig. 6). The number of CFU and microscopic data suggested that the decreased titer shown in the graph in Fig. 5B was due to phagocytosis and killing of dotA and dotB L. pneumophila by A. castellanii. These data support a model in which dotA and dotB mutants are able to undergo intracellular replication in A. castellanii amoebae following encystment but are unable to reinfect and/or continue multiple successive rounds of intracellular multiplication after egress from initial amoeba hosts.

Involvement of the lvh T4SS locus in intracellular multiplication of dotA and dotB mutants following encystment. To test involvement of the lvh locus in reversal of defective intracellular multiplication, the encystment experiment was performed with the {Delta}lvh mutant and the {Delta}lvh dotB double mutant used to show lvh involvement in entry and delay of phagosome acidification phenotypes (Fig. 1 to 3). Assessed by titer of the infection medium, the {Delta}lvh mutant replicated identically to the parental strain JR32 (Fig. 5A), as expected from the identical intracellular multiplication of the {Delta}lvh mutant and strain JR32 in conventional infection protocols with A. castellanii trophozoites and HL-60 (77) and J774 macrophages (data not shown). Consistent with these titer data, microscopic analysis of the GFP-expressing {Delta}lvh mutant demonstrated intracellular replication comparable to that of strain JR32 (Fig. 6A). In contrast, replication was significantly reduced for the {Delta}lvh dotA mutant by microscopic analysis (Fig. 6A) and for the {Delta}lvh dotB double mutant by titer of bacteria in the infection medium (Fig. 5B) and by microscopic analysis (Fig. 6A). Complementation of the {Delta}lvh dotA or {Delta}lvh dotB double mutants was tested in the microscopic assay for intracellular replication (Fig. 6B). Complementation of the {Delta}lvh dotB double mutant was demonstrable at 4.5 and 21 h while the {Delta}lvh dotA double mutant was complemented only at 4.5 h. It is unclear why the {Delta}lvh dotA double mutant was not complemented at 21 h. As stated above, complementation may be influenced by different levels of expression from plasmid and chromosomal lvh genes and the presence of mob genes on the complementing plasmid. Maintenance of appropriate expression levels is likely a critical factor in achieving complementation of the intracellular replication defect. The 21-h time point in the intracellular replication experiment shown in Fig. 6B is considerably longer than the 0.5- to 1-h length of entry (Fig. 2) and phagosome acidification experiments (Fig. 3C) in which complementation of the {Delta}lvh dotA or {Delta}lvh dotB double mutants was demonstrated. Complementation of the {Delta}lvh mutation may be more successful for virulence phenotypes of shorter duration. In sum, data on single mutants, double mutants, and complemented mutants indicated that the lvh locus and, by inference, the Lvh T4SS are required for intracellular multiplication of dotA and dotB Legionella following amoeba encystment. The data were consistent with a model in which the Lvh T4SS is preferentially involved in virulence phenotypes of L. pneumophila under conditions that mimic the aquatic and amoeba cyst niches of the Legionnaires' disease bacterium.

Effect of WS treatment on lvh expression. Since the lvh locus was implicated in reversal of defective virulence-related phenotypes following WS treatment, the effect of WS treatment on expression of the lvh locus was tested using a LacZ fusion with the 5' end of the first virB gene of the lvh locus, virB2. The virB locus of many type IVA SSs consists of a single operon beginning with the first virB gene (20). LacZ assays performed over the first 6 hours and after 16 to 19 h of WS treatment showed no induction of LacZ activity in WS-treated cultures of strain JR32 or the dotA or dotB strains compared to the corresponding stationary-phase cultures (data not shown). These data raised the possibility of posttranslational changes in Lvh expression, such as posttranslational modification, association with accessory proteins, or changes in intracellular location. Formation of a functional type IVA SS in A. tumefaciens involves localization of VirB/D proteins to the poles of the bacterial cell. In L. pneumophila the SdeA, SidC, and LidA protein substrates of the Dot/Icm T4SS show polar localization (7, 31, 55), suggesting that L. pneumophila T4SSs have polar locations and that localization to specific subcellular regions is involved in formation or activation of a functional T4SS.


arrow
DISCUSSION
 
The requirement for the Dot/Icm T4SS and the dispensability of the Lvh T4SS for entry, intracellular multiplication, and cytotoxicity of L. pneumophila to host cells were deduced from infecting amoebae and macrophages with dot/icm or {Delta}lvh mutants grown to stationary phase in rich medium. Data presented in this work support a model in which the requirement for the Dot/Icm T4SS and the dispensability of the Lvh type IVA SS are conditional and dependent on Legionella culture conditions. Defective entry and defective delay of phagosome acidification of mutants in dotA and dotB, essential for function of the Dot/Icm T4SS, were reversed and restored to values of the parental strain JR32 by incubation of stationary-phase cultures in water prior to infection of amoebae or macrophages. Defective intracellular multiplication of dotA and dotB mutants in A. castellanii amoebae was reversed by encystment of water-treated cultures in amoebae. The data for {Delta}lvh dotA and {Delta}lvh dotB double mutants suggested that the Lvh T4SS can substitute for the Dot/Icm T4SS or components of the Dot/Icm T4SS in entry following WS treatment and can substitute for intracellular multiplication following encystment. In addition, the Lvh T4SS contributed to delay of phagosome acidification in L. pneumophila strain JR32. The Lvh T4SS was previously shown to function in conjugal transfer of RSF1010-related plasmids (77). Demonstrating a role for the Lvh T4SS in phagosome acidification suggested that the Lvh T4SS can also translocate Legionella effector proteins because secretion of protein substrates of a T4SS is thought to be required for delayed phagosome acidification (65, 76).

Identification of a role for the L. pneumophila Lvh T4SS in virulence-related phenotypes raises questions about redundant, overlapping, or independent contributions of the Dot/Icm and Lvh T4SSs to virulence-related phenotypes. Principal questions are whether virulence-related proteins translocated by the Dot/Icm T4SS are recognized and translocated by the Lvh T4SS and whether the Lvh T4SS is involved in association of components of the endoplasmic reticulum with the Legionella-containing phagosome. Salmonella enterica serovar Typhimurium utilizes two type III secretion systems in producing a typhoid-like disease in mice. One, encoded by SPI-1, is required for entry into nonphagocytic cells and a second, encoded by SPI-2, is required for optimal replication in macrophages (14). The culture conditions in which dispensability of the Legionella Dot/Icm T4SS was demonstrated, exposure to water and encystment in amoebae, suggest that the Lvh T4SS is preferentially involved in the spread of Legionnaires' disease from environmental niches. In this regard, promising approaches for dissecting the contributions of Dot/Icm and Lvh T4SSs will be testing the effect of other environmental mimics on virulence-related phenotypes and analysis of aerosol infection by L. pneumophila in animal models (85-87).

Reversal of defective virulence phenotypes in dot/icm mutants by WS treatment and amoeba encystment could involve functional substitution of the Lvh T4SS for a nonfunctional Dot/Icm T4SS, full or partial reconstitution, or repair of the Dot/Icm T4SS using components of the Lvh T4SS or functional contributions to type IV secretion from both Lvh and Dot/Icm systems. Studies to distinguish between these molecular mechanisms will be facilitated by the strong homologies of Lvh proteins with proteins of the A. tumefaciens type IVA SS for which functional roles have been identified for nearly all VirB and VirD components (25, 33). Cross-linking (17, 18, 54), immunofluorescence, and immuno-electron microscopy approaches (51, 52) used to demonstrate changes in the intracellular location of A. tumefaciens VirB/D proteins in response to secretion stimuli are likely to be feasible for studying assembly and intracellular location of Lvh T4SS proteins under different culture conditions and in response to environmental mimics.

L. pneumophila has been proposed to be an accidental pathogen that transitions from a planktonic pond bacterium and parasite of environmental amoebae to the causative agent of Legionnaires' disease (74, 83, 95). Our studies implicating the Lvh T4SS in the spread of Legionnaires' disease suggest that the lvh locus is involved in that transition. Supporting this suggestion is the observation that the lvh locus is present in L. pneumophila and other species of the Legionella genus that are human pathogens but absent from species that are not human pathogens (73). In addition, microarray data show increased expression of both lvh and dot/icm genes following internalization by A. castellanii amoebae (66).

Following entry into a host cell, L. pneumophila cycles between a replicative form capable of intracellular multiplication and a transmissive form capable of reinfecting new host cells. Current models of the role of nutrient limitation in signaling this transition, the stress regulators involved, and the changes in dot/icm gene expression are based principally on studies in which stationary or postexponential broth cultures are used for infection (41, 42, 63, 75). The present study demonstrated that following WS treatment, mutants in dotA, dotB, and other dot/icm genes become infective and capable of entering amoeba and macrophage hosts and delaying phagosome acidification. Studies following encystment in amoebae demonstrated that dotA and dotB mutants can become capable of replication in amoeba trophozoites and suggest that they are unable to reinfect new amoeba hosts. These results identify WS treatment and amoeba encystment as new, etiologically relevant experimental systems for studying the transition between replicative and transmissive forms.

L. pneumophila is a prototypic example of an environmental pathogen for which amoebae play a critical role in the disease etiology (91). Amoeba species in the genera Hartmannella and Acanthamoeba are believed to be environmental reservoirs for replication of aquatic L. pneumophila (13, 38, 39, 91). Encystment protects both amoeba host (32) and Legionella parasite (49) from chlorination treatment used for water purification and likely from thermal, oxidative, pH, and other stresses encountered when cysts reside in standing-water reservoirs of man-made origin. Encystment, which can capture ~50 Legionella bacteria per amoeba host cell (32), is therefore proposed as an avenue by which Legionella can colonize new environments and a means of delivering an infectious inoculum following aerosolization of Legionella-containing cysts. Following infection and intracellular multiplication in amoeba trophozoites, L. pneumophila strain 130b demonstrated enhanced entry and intracellular multiplication in cultured cells and enhanced replication in lungs after intratracheal infection of mice (27, 28). L. pneumophila strain JR32 regained plating ability from a nonviable and nonculturable state after 125 days of incubation in tap water following coincubation with A. castellanii trophozoites (90).

Analogous roles for amoebae have been demonstrated for other bacterial and fungal pathogens of environmental origin, including Mycobacterium tuberculosis, Vibrio cholerae, Francisella tularensis, and Cryptococcus neoformans (1, 2, 29, 89, 91). In addition, rumen protozoa have been implicated in enhancing the pathogenicity and invasion by drug-resistant S. enterica (68) and in the spread of antibiotic resistance between different species of bacteria (57). Our studies describe an experimentally simple system for testing the effect of encystment on virulence-related phenotypes. The increasing number of environmental pathogens that use amoebae as etiological agents suggests that limiting invasion and encystment of environmental amoebae may be a means of controlling the spread of these infectious diseases.


arrow
ACKNOWLEDGMENTS
 
We thank the Summer Undergraduate Research Program of the Sue Golding Graduate Division of Albert Einstein College of Medicine for support of C.B.G. (summer 2004) and Z.V. (summer 2005).

We thank Howard Shuman, Department of Microbiology and Immunology, Columbia University College of Physicians and Surgeons, for Legionella strains, the J774 macrophage line, and review of the manuscript. We thank colleagues at Albert Einstein College of Medicine, Anne Bresnick and Dianne Cox, and the Albert Einstein Analytical Imaging Facility for use of epifluorescence microscopes; Richard Stanley and Fiona Pixley for assistance with preparation of mouse bone marrow for culturing bone marrow macrophages; and Hillel Cohen for advice on statistical analysis.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, New York 10461. Phone: (718) 430-3010. Fax: (718) 430-8565. E-mail: steinman{at}aecom.yu.edu. Back

{triangledown} Published ahead of print on 13 November 2006. Back

Editor: D. L. Burns

{dagger} Present address: Center for Proteomics and Mass Spectrometry, School of Medicine, Case Western Reserve University, Cleveland, OH. Back

{ddagger} Present address: Program in Molecular Biology, Weill Graduate School of Medical Sciences, Cornell University, New York, NY. Back

§ Present address: Department of Surgery, Gastric and Mixed Tumor Service, Memorial Sloan-Kettering Cancer Center, New York, NY. Back


arrow
REFERENCES
 
    1
  1. Abd, H., T. Johansson, I. Golovliov, G. Sandstrom, and M. Forsman. 2003. Survival and growth of Francisella tularensis in Acanthamoeba castellanii. Appl. Environ. Microbiol. 69:600-606.[Abstract/Free Full Text]
  2. 2
  3. Abd, H., A. Weintraub, and G. Sandstrom. 2005. Intracellular survival and replication of Vibrio cholerae O139 in aquatic free-living amoebae. Environ. Microbiol. 7:1003-1008.[CrossRef][Medline]
  4. 3
  5. Bandyopadhyay, P., B. Byrne, Y. Chan, M. S. Swanson, and H. M. Steinman. 2003. Legionella pneumophila catalase-peroxidases are required for proper trafficking and growth in primary macrophages. Infect. Immun. 71:4526-4535.[Abstract/Free Full Text]
  6. 4
  7. Bandyopadhyay, P., and H. M. Steinman. 2000. Catalase-peroxidases of Legionella pneumophila: cloning of the katA gene and studies of KatA function. J. Bacteriol. 182:6679-6686.[Abstract/Free Full Text]
  8. 5
  9. Bandyopadhyay, P., and H. M. Steinman. 1998. Legionella pneumophila catalase-peroxidases: cloning of the katB gene and studies of KatB function. J. Bacteriol. 180:5369-5374.[Abstract/Free Full Text]
  10. 6
  11. Bandyopadhyay, P., H. Xiao, H. A. Coleman, A. Price-Whelan, and H. M. Steinman. 2004. Icm/Dot-independent entry of Legionella pneumophila into amoeba and macrophage hosts. Infect. Immun. 72:4541-4551.[Abstract/Free Full Text]
  12. 7
  13. Bardill, J. P., J. L. Miller, and J. P. Vogel. 2005. IcmS-dependent translocation of SdeA into macrophages by the Legionella pneumophila type IV secretion system. Mol. Microbiol. 56:90-103.[CrossRef][Medline]
  14. 8
  15. Berger, K. H., and R. R. Isberg. 1993. Two distinct defects in intracellular growth complemented by a single genetic locus in Legionella pneumophila. Mol. Microbiol. 7:7-19.[Medline]
  16. 9
  17. Berger, K. H., J. J. Merriam, and R. R. Isberg. 1994. Altered intracellular targeting properties associated with mutations in the Legionella pneumophila dotA gene. Mol. Microbiol. 14:809-822.[Medline]
  18. 10
  19. Bollin, G. E., J. F. Plouffe, M. F. Para, and B. Hackman. 1985. Aerosols containing Legionella pneumophila generated by shower heads and hot-water faucets. Appl. Environ. Microbiol. 50:1128-1131.[Abstract/Free Full Text]
  20. 11
  21. Bornstein, N., D. Marmet, M. Surgot, M. Nowicki, A. Arslan, J. Esteve, and J. Fleurette. 1989. Exposure to Legionellaceae at a hot spring spa: a prospective clinical and serological study. Epidemiol. Infect. 102:31-36.[Medline]
  22. 12
  23. Brand, B. C., A. Sadosky, and S. H. A. 1994. The Legionella pneumophila icm locus: a set of genes required for intracellular multiplication in human macrophages. Mol. Microbiol. 14:797-808.[Medline]
  24. 13
  25. Brown, M. R., and J. Barker. 1999. Unexplored reservoirs of pathogenic bacteria: protozoa and biofilms. Trends Microbiol. 7:46-50.[CrossRef][Medline]
  26. 14
  27. Brown, N. F., B. A. Vallance, B. K. Coombes, Y. Valdez, B. A. Coburn, and B. B. Finlay. 2005. Salmonella pathogenicity island 2 is expressed prior to penetrating the intestine. PLOS Pathog. 1:e32.
  28. 15
  29. Burns, D. L. 2003. Type IV transporters of pathogenic bacteria. Curr. Opin. Microbiol. 6:29-34.[CrossRef][Medline]
  30. 16
  31. Byrne, B., and M. S. Swanson. 1998. Expression of Legionella pneumophila virulence traits in response to growth conditions. Infect. Immun. 66:3029-3034.[Abstract/Free Full Text]
  32. 17
  33. Carle, A., C. Hoppner, K. Ahmed Aly, Q. Yuan, A. den Dulk-Ras, A. Vergunst, D. O'Callaghan, and C. Baron. 2006. The Brucella suis type IV secretion system assembles in the cell envelope of the heterologous host Agrobacterium tumefaciens and increases IncQ plasmid pLS1 recipient competence. Infect. Immun. 74:108-117.[Abstract/Free Full Text]
  34. 18
  35. Cascales, E., and P. J. Christie. 2004. Definition of a bacterial type IV secretion pathway for a DNA substrate. Science 304:1170-1173.[Abstract/Free Full Text]
  36. 19
  37. Cazalet, C., C. Rusniok, H. Bruggemann, N. Zidane, A. Magnier, L. Ma, M. Tichit, S. Jarraud, C. Bouchier, F. Vandenesch, F. Kunst, J. Etienne, P. Glaser, and C. Buchrieser. 2004. Evidence in the Legionella pneumophila genome for exploitation of host cell functions and high genome plasticity. Nat. Genet. 36:1165-1173.[CrossRef][Medline]
  38. 20
  39. Chen, C. Y., L. Eckmann, S. J. Libby, F. C. Fang, S. Okamoto, M. F. Kagnoff, J. Fierer, and D. G. Guiney. 1996. Expression of Salmonella typhimurium rpoS and rpoS-dependent genes in the intracellular environment of eukaryotic cells. Infect. Immun. 64:4739-4743.[Abstract]
  40. 21
  41. Chen, J., K. S. de Felipe, M. Clarke, H. Lu, O. R. Anderson, G. Segal, and H. A. Shuman. 2004. Legionella effectors that promote nonlytic release from protozoa. Science 303:1358-1361.[Abstract/Free Full Text]
  42. 22
  43. Chien, M., I. Morozova, S. Shi, H. Sheng, J. Chen, S. M. Gomez, G. Asamani, K. Hill, J. Nuara, M. Feder, J. Rineer, J. J. Greenberg, V. Steshenko, S. H. Park, B. Zhao, E. Teplitskaya, J. R. Edwards, S. Pampou, A. Georghiou, I. C. Chou, W. Iannuccilli, M. E. Ulz, D. H. Kim, A. Geringer-Sameth, C. Goldsberry, P. Morozov, S. G. Fischer, G. Segal, X. Qu, A. Rzhetsky, P. Zhang, E. Cayanis, P. J. De Jong, J. Ju, S. Kalachikov, H. A. Shuman, and J. J. Russo. 2004. The genomic sequence of the accidental pathogen Legionella pneumophila. Science 305:1966-1968.[Abstract/Free Full Text]
  44. 23
  45. Christie, P. J. 2001. Type IV secretion: intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol. Microbiol. 40:294-305.[CrossRef][Medline]
  46. 24
  47. Christie, P. J. 2004. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim. Biophys. Acta 1694:219-234.[Medline]
  48. 25
  49. Christie, P. J., and E. Cascales. 2005. Structural and dynamic properties of bacterial type IV secretion systems. Mol. Membr. Biol. 22:51-61.[Medline]
  50. 26
  51. Christie, P. J., and J. P. Vogel. 2000. Bacterial type IV secretion: conjugation systems adapted to deliver effector molecules to host cells. Trends Microbiol. 8:354-360.[CrossRef][Medline]
  52. 27
  53. Cirillo, J. D., S. L. Cirillo, L. Yan, L. E. Bermudez, S. Falkow, and L. S. Tompkins. 1999. Intracellular growth in Acanthamoeba castellanii affects monocyte entry mechanisms and enhances virulence of Legionella pneumophila. Infect. Immun. 67:4427-4434.[Abstract/Free Full Text]
  54. 28
  55. Cirillo, J. D., S. Falkow, and L. S. Tompkins. 1994. Growth of Legionella pneumophila in Acanthamoeba castellanii enhances invasion. Infect. Immun. 62:3254-3261.[Abstract/Free Full Text]
  56. 29
  57. Cirillo, J. D., S. Falkow, L. S. Tompkins, and L. E. Bermudez. 1997. Interaction of Mycobacterium avium with environmental amoebae enhances virulence. Infect. Immun. 65:3759-3767.[Abstract]
  58. 30
  59. Coers, J., J. C. Kagan, M. Matthews, H. Nagai, D. M. Zuckman, and C. R. Roy. 2000. Identification of Icm protein complexes that play distinct roles in the biogenesis of an organelle permissive for Legionella pneumophila intracellular growth. Mol. Microbiol. 38:719-736.[CrossRef][Medline]
  60. 31
  61. Conover, G. M., I. Derre, J. P. Vogel, and R. R. Isberg. 2003. The Legionella pneumophila LidA protein: a translocated substrate of the Dot/Icm system associated with maintenance of bacterial integrity. Mol. Microbiol. 48:305-321.[CrossRef][Medline]
  62. 32
  63. De Jonckheere, J., and H. van de Voorde. 1976. Differences in destruction of cysts of pathogenic and nonpathogenic Naegleria and Acanthamoeba by chlorine. Appl. Environ. Microbiol. 31:294-297.[Abstract/Free Full Text]
  64. 33
  65. Ding, Z., K. Atmakuri, and P. J. Christie. 2003. The outs and ins of bacterial type IV secretion substrates. Trends Microbiol. 11:527-535.[CrossRef][Medline]
  66. 34
  67. Dumenil, G., and R. R. Isberg. 2001. The Legionella pneumophila IcmR protein exhibits chaperone activity for IcmQ by preventing its participation in high-molecular-weight complexes. Mol. Microbiol. 40:1113-1127.[CrossRef][Medline]
  68. 35
  69. Dumenil, G., T. P. Montminy, M. Tang, and R. R. Isberg. 2004. IcmR-regulated membrane insertion and efflux by the Legionella pneumophila IcmQ protein. J. Biol. Chem. 279:4686-4695.[Abstract/Free Full Text]
  70. 36
  71. Feeley, J. C., R. J. Gibson, G. W. Gorman, N. C. Langford, J. K. Rasheed, D. C. Mackel, and W. B. Baine. 1979. Charcoal-yeast extract agar: primary isolation medium for Legionella pneumophila. J. Clin. Microbiol. 10:437-441.[Abstract/Free Full Text]
  72. 37
  73. Fernandez-Moreira, E., J. H. Helbig, and M. S. Swanson. 2006. Membrane vesicles shed by Legionella pneumophila inhibit fusion of phagosomes with lysosomes. Infect. Immun. 74:3285-3295.[Abstract/Free Full Text]
  74. 38
  75. Fields, B. Legionella in the environment. In P. S. Hoffman, T. W. Klein, and H. Friedman (ed.), Legionella pneumophila: pathogenesis and immunity, in press. Springer Publishing Corp., New York, NY.
  76. 39
  77. Fields, B. S. 1996. The molecular ecology of Legionellae. Trends Micro. 4:286-290.
  78. 40
  79. Fliermans, C. B., W. B. Cherry, L. H. Orrison, S. J. Smith, D. L. Tison, and D. H. Pope. 1981. Ecological distribution of Legionella pneumophila. Appl. Environ. Microbiol. 41:9-16.[Abstract/Free Full Text]
  80. 41
  81. Gal-Mor, O., and G. Segal. 2003. Identification of CpxR as a positive regulator of icm and dot virulence genes of Legionella pneumophila. J. Bacteriol. 185:4908-4919.[Abstract/Free Full Text]
  82. 42
  83. Gal-Mor, O., and G. Segal. 2003. The Legionella pneumophila GacA homolog (LetA) is involved in the regulation of icm virulence genes and is required for intracellular multiplication in Acanthamoeba castellanii. Microb. Pathog. 34:187-194.[CrossRef][Medline]
  84. 43
  85. Hilbi, H., G. Segal, and H. A. Shuman. 2001. Icm/dot-dependent upregulation of phagocytosis by Legionella pneumophila. Mol. Microbiol. 42:603-617.[CrossRef][Medline]
  86. 44
  87. Horwitz, M. A. 1983. Formation of a novel phagosome by the Legionnaires' disease bacterium (Legionella pneumophila) in human monocytes. J Exp. Med. 158:1319-1331.[Abstract/Free Full Text]
  88. 45
  89. Horwitz, M. A., and F. R. Maxfield. 1984. Legionella pneumophila inhibits acidification of its phagosome in human monocytes. J. Cell Biol. 99:1936-1943.[Abstract/Free Full Text]
  90. 46
  91. Horwitz, M. A., and S. C. Silverstein. 1983. Intracellular multiplication of Legionnaires' disease bacteria (Legionella pneumophila) in human monocytes is reversibly inhibited by erythromycin and rifampin. J. Clin. Investig. 71:15-26.[Medline]
  92. 47
  93. Horwitz, M. A., and S. C. Silverstein. 1980. Legionnaires' disease bacterium (Legionella pneumophila) multiples intracellularly in human monocytes. J. Clin. Investig. 66:441-450.[Medline]
  94. 48
  95. Joshi, A. D., S. Sturgill-Koszycki, and M. S. Swanson. 2001. Evidence that Dot-dependent and -independent factors isolate the Legionella pneumophila phagosome from the endocytic network in mouse macrophages. Cell Microbiol. 3:99-114.[CrossRef][Medline]
  96. 49
  97. Kilvington, S., and J. Price. 1990. Survival of Legionella pneumophila within cysts of Acanthamoeba polyphaga following chlorine exposure. J. Appl. Bacteriol. 68:519-525.[Medline]
  98. 50
  99. Kirby, J. E., J. P. Vogel, H. L. Andrews, and R. R. Isberg. 1998. Evidence for pore-forming ability by Legionella pneumophila. Mol. Microbiol. 27:323-336.[CrossRef][Medline]
  100. 51
  101. Kumar, R. B., and A. Das. 2002. Polar location and functional domains of the Agrobacterium tumefaciens DNA transfer protein VirD4. Mol. Microbiol. 43:1523-1532.[CrossRef][Medline]
  102. 52
  103. Kumar, R. B., Y. H. Xie, and A. Das. 2000. Subcellular localization of the Agrobacterium tumefaciens T-DNA transport pore proteins: VirB8 is essential for the assembly of the transport pore. Mol. Microbiol. 36:608-617.[CrossRef][Medline]
  104. 53
  105. Liles, M. R., P. H. Edelstein, and N. P. Cianciotto. 1999. The prepilin peptidase is required for protein secretion by and the virulence of the intracellular pathogen Legionella pneumophila. Mol. Microbiol. 31:959-970.[CrossRef][Medline]
  106. 54
  107. Liu, Z., and A. N. Binns. 2003. Functional subsets of the virB type IV transport complex proteins involved in the capacity of Agrobacterium tumefaciens to serve as a recipient in virB-mediated conjugal transfer of plasmid RSF1010. J. Bacteriol. 185:3259-3269.[Abstract/Free Full Text]
  108. 55
  109. Luo, Z. Q., and R. R. Isberg. 2004. Multiple substrates of the Legionella pneumophila Dot/Icm system identified by interbacterial protein transfer. Proc. Natl. Acad. Sci. USA 101:841-846.[Abstract/Free Full Text]
  110. 56
  111. Matsunaga, K., T. W. Klein, H. Friedman, and Y. Yamamoto. 2001. Alveolar macrophage cell Line MH-S is valuable as an in vitro model for Legionella pneumophila infection. Am. J. Respir. Cell Mol. Biol. 24:326-331.[Abstract/Free Full Text]
  112. 57
  113. McCuddin, Z. P., S. A. Carlson, M. A. Rasmussen, and S. K. Franklin. 2006. Klebsiella to Salmonella gene transfer within rumen protozoa: implications for antibiotic resistance and rumen defaunation. Vet. Microbiol. 114:275-284.[CrossRef][Medline]
  114. 58
  115. McDade, J. E., C. C. Shepard, D. W. Fraser, T. R. Tsai, M. A. Redus, and W. R. Dowdle. 1977. Legionnaires' disease: isolation of a bacterium and demonstration of its role in other respiratory disease. N. Engl. J. Med. 297:1197-1203.[Abstract]
  116. 59
  117. Miller, J. H. 1992. A short course in bacterial genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  118. 60
  119. Miyake, M., T. Watanabe, H. Koike, M. Molmeret, Y. Imai, and Y. Abu Kwaik. 2005. Characterization of Legionella pneumophila pmiA, a gene essential for infectivity of protozoa and macrophages. Infect. Immun. 73:6272-6282.[Abstract/Free Full Text]
  120. 61
  121. Molmeret, M., O. A. Alli, S. Zink, A. Flieger, N. P. Cianciotto, and Y. A. Kwaik. 2002. icmT is essential for pore formation-mediated egress of Legionella pneumophila from mammalian and protozoan cells. Infect. Immun. 70:69-78.[Abstract/Free Full Text]
  122. 62
  123. Molmeret, M., D. M. Bitar, L. Han, and Y. A. Kwaik. 2004. Cell biology of the intracellular infection by Legionella pneumophila. Microbes Infect. 6:129-139.[CrossRef][Medline]
  124. 63
  125. Molofsky, A. B., and M. S. Swanson. 2004. Differentiate to thrive: lessons from the Legionella pneumophila life cycle. Mol. Microbiol. 53:29-40.[CrossRef][Medline]
  126. 64
  127. Molofsky, A. B., and M. S. Swanson. 2003. Legionella pneumophila CsrA is a pivotal repressor of transmission traits and activator of replication. Mol. Microbiol. 50:445-461.[CrossRef][Medline]
  128. 65
  129. Nagai, H., and C. R. Roy. 2003. Show me the substrates: modulation of host cell function by type IV secretion systems. Cell Microbiol. 5:373-383.[CrossRef][Medline]
  130. 66
  131. Pampou, S., I. Morozova, D. Hilbert, K. S. de Felipe, P. Morozov, J. J. Russo, H. A. Shuman, and S. Kalachikov. 2006. Analysis of gene expression in Legionella during axenic growth and infection, p. 343-346. In N. P. Cianciotto (ed.), Legionella: state of the art 30 years after its recognition. ASM Press, Washington, DC.
  132. 67
  133. Purcell, M., and H. A. Shuman. 1998. The Legionella pneumophila icmGCDJBF genes are required for killing of human macrophages. Infect. Immun. 66:2245-2255.[Abstract/Free Full Text]
  134. 68
  135. Rasmussen, M. A., S. A. Carlson, S. K. Franklin, Z. P. McCuddin, M. T. Wu, and V. K. Sharma. 2005. Exposure to rumen protozoa leads to enhancement of pathogenicity of and invasion by multiple-antibiotic-resistant Salmonella enterica bearing SGI1. Infect. Immun. 73:4668-4675.[Abstract/Free Full Text]
  136. 69
  137. Ridenour, D. A., S. L. Cirillo, S. Feng, M. M. Samrakandi, and J. D. Cirillo. 2003. Identification of a gene that affects the efficiency of host cell infection by Legionella pneumophila in a temperature-dependent fashion. Infect. Immun. 71:6256-6263.[Abstract/Free Full Text]
  138. 70
  139. Rowbotham, T. J. 1986. Current views on the relationships between amoebae, legionellae and man. Isr. J. Med. Sci. 22:678-689.[Medline]
  140. 71
  141. Roy, C. R., and R. R. Isberg. 1997. Topology of Legionella pneumophila DotA: an inner membrane protein required for replication in macrophages. Infect. Immun. 65:571-578.[Abstract]
  142. 72
  143. Sadosky, A. B., L. A. Wiater, and H. A. Shuman. 1993. Identification of Legionella pneumophila genes required for growth within and killing of human macrophages. Infect. Immun. 61:5361-5373.[Abstract/Free Full Text]
  144. 73
  145. Samrakandi, M. M., S. L. Cirillo, D. A. Ridenour, L. E. Bermudez, and J. D. Cirillo. 2002. Genetic and phenotypic differences between Legionella pneumophila strains. J. Clin. Microbiol. 40:1352-1362.[Abstract/Free Full Text]
  146. 74
  147. Santic, M., and Y. Abu Kwaik. 2006. Legionella pneumophila can hijack the self-destruct system of macrophages. Microbe 1:185-191.
  148. 75
  149. Sauer, J. D., M. A. Bachman, and M. S. Swanson. 2005. The phagosomal transporter A couples threonine acquisition to differentiation and replication of Legionella pneumophila in macrophages. Proc. Natl. Acad. Sci. USA 102:9924-9929.[Abstract/Free Full Text]
  150. 76
  151. Segal, G., M. Feldman, and T. Zusman. 2005. The Icm/Dot type-IV secretion systems of Legionella pneumophila and Coxiella burnetii. FEMS Microbiol. Rev. 29:65-81.[CrossRef][Medline]
  152. 77
  153. Segal, G., J. J. Russo, and H. A. Shuman. 1999. Relationships between a new type IV secretion system and the icm/dot virulence system of Legionella pneumophila. Mol. Microbiol. 34:799-809.[CrossRef][Medline]
  154. 78
  155. Segal, G., and H. A. Shuman. 1997. Characterization of a new region required for macrophage killing by Legionella pneumophila. Infect. Immun. 65:5057-5066.[Abstract]
  156. 79
  157. Segal, G., and H. A. Shuman. 1998. Intracellular multiplication and human macrophage killing by Legionella pneumophila are inhibited by conjugal components of IncQ plasmid RSF1010. Mol. Microbiol. 30:197-208.[CrossRef][Medline]
  158. 80
  159. Segal, G., and H. A. Shuman. 1999. Legionella pneumophila utilizes the same genes to multiply within Acanthamoeba castellanii and human macrophages. Infect. Immun. 67:2117-2124.[Abstract/Free Full Text]
  160. 81
  161. Sexton, J. A., J. S. Pinkner, R. Roth, J. E. Heuser, S. J. Hultgren, and J. P. Vogel. 2004. The Legionella pneumophila PilT homologue DotB exhibits ATPase activity that is critical for intracellular growth. J. Bacteriol. 186:1658-1666.[Abstract/Free Full Text]
  162. 82
  163. Sexton, J. A., and J. P. Vogel. 2002. Type IVB secretion by intracellular pathogens. Traffic 3:178-185.[CrossRef][Medline]
  164. 83
  165. Shuman, H. A., M. Purcell, G. Segal, L. Hales, and L. A. Wiater. 1998. Intracellular multiplication of Legionella pneumophila: human pathogen or accidental tourist? Curr. Topics Microbiol. Immun. 225:99-112.[Medline]
  166. 84
  167. Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments with gene fusions. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  168. 85
  169. Skerrett, S. J., G. J. Bagby, R. A. Schmidt, and S. Nelson. 1997. Antibody-mediated depletion of tumor necrosis factor-alpha impairs pulmonary host defenses to Legionella pneumophila. J. Infect. Dis. 176:1019-1028.[Medline]
  170. 86
  171. Skerrett, S. J., and T. R. Martin. 1991. Alveolar macrophage activation in experimental legionellosis. J. Immunol. 147:337-345.[Abstract]
  172. 87
  173. Skerrett, S. J., R. A. Schmidt, and T. R. Martin. 1989. Impaired clearance of aerosolized Legionella pneumophila in corticosteroid-treated rats: a model of Legionnaires' disease in the compromised host. J. Infect. Dis. 160:261-273.[Medline]
  174. 88
  175. Stanley, E. R. 1997. Murine bone marrow-derived macrophages. Methods Mol. Biol. 75:301-304.[Medline]
  176. 89
  177. Steenbergen, J. N., H. A. Shuman, and A. Casadevall. 2001. Cryptococcus neoformans interactions with amoebae suggest an explanation for its virulence and intracellular pathogenic strategy in macrophages. Proc. Natl. Acad. Sci. USA 98:15245-15250.[Abstract/Free Full Text]
  178. 90
  179. Steinert, M., L. Emody, R. Amann, and J. Hacker. 1997. Resuscitation of viable but nonculturable Legionella pneumophila Philadelphia JR32 by Acanthamoeba castellanii. Appl. Environ. Microbiol. 63:2047-2053.[Abstract]
  180. 91
  181. Steinert, M., U. Hentschel, and J. Hacker. 2002. Legionella pneumophila: an aquatic microbe goes astray. FEMS Microbiol. Rev. 26:149-162.[CrossRef][Medline]
  182. 92
  183. Stone, B. J., and Y. A. Kwaik. 1999. Natural competence for DNA transformation by Legionella pneumophila and its association with expression of type IV pili. J. Bacteriol. 181:1395-1402.[Abstract/Free Full Text]
  184. 93
  185. Sturgill-Koszycki, S., and M. S. Swanson. 2000. Legionella pneumophila replication vacuoles mature into acidic, endocytic organelles. J Exp. Med. 192:1261-1272.[Abstract/Free Full Text]
  186. 94
  187. Sun, A. N., A. Camilli, and D. A. Portnoy. 1990. Isolation of Listeria monocytogenes small-plaque mutants defective for intracellular growth and cell-to-cell spread. Infect. Immun. 58:3770-3778.[Abstract/Free Full Text]
  188. 95
  189. Swanson, M. S., and B. K. Hammer. 2000. Legionella pneumophila pathogenesis: a fateful journey from amoebae to macrophages. Annu. Rev. Microbiol. 54:567-613.[CrossRef][Medline]
  190. 96
  191. Swanson, M. S., and R. R. Isberg. 1996. Identification of Legionella pneumophila mutants that have aberrant intracellular fates. Infect. Immun. 64:2585-2594.[Abstract]
  192. 97
  193. Via, L. E., R. A. Fratti, M. McFalone, E. Pagan-Ramos, D. Deretic, and V. Deretic. 1998. Effects of cytokines on mycobacterial phagosome maturation. J. Cell Sci. 111:897-905.[Abstract]
  194. 98
  195. Vogel, J. P., H. L. Andrews, S. K. Wong, and R. R. Isberg. 1998. Conjugative transfer by the virulence system of Legionella pneumophila. Science 279:873-876.[Abstract/Free Full Text]
  196. 99
  197. Watarai, M., I. Derre, J. Kirby, J. D. Growney, W. F. Dietrich, and R. R. Isberg. 2001. Legionella pneumophila is internalized by a macropinocytotic uptake pathway controlled by the Dot/Icm system and the mouse Lgn1 locus. J. Exp. Med. 194:1081-1096.[Abstract/Free Full Text]
  198. 100
  199. Wiater, L. A., A. B. Sadosky, and H. A. Shuman. 1994. Mutagenesis of Legionella pneumophila using Tn903dIIlacZ: identification of a growth-phase-regulated pigmentation gene. Mol. Micro. 11:641-653.[CrossRef][Medline]
  200. 101
  201. Yamamoto, H., M. Sugiura, S. Kusunoki, T. Ezaki, M. Ikedo, and E. Yabuuchi. 1992. Factors stimulating propagation of Legionellae in cooling tower water. Appl. Environ. Microbiol. 58:1394-1397.[Abstract/Free Full Text]
  202. 102
  203. Yeo, H. J., and G. Waksman. 2004. Unveiling molecular scaffolds of the type IV secretion system. J. Bacteriol. 186:1919-1926.[Free Full Text]
  204. 103
  205. Zusman, T., O. Gal-Mor, and G. Segal. 2002. Characterization of a Legionella pneumophila relA insertion mutant and roles of RelA and RpoS in virulence gene expression. J. Bacteriol. 184:67-75.[Abstract/Free Full Text]


Infection and Immunity, February 2007, p. 723-735, Vol. 75, No. 2
0019-9567/07/$08.00+0     doi:10.1128/IAI.00956-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Stewart, C. R., Rossier, O., Cianciotto, N. P. (2009). Surface Translocation by Legionella pneumophila: a Form of Sliding Motility That Is Dependent upon Type II Protein Secretion. J. Bacteriol. 191: 1537-1546 [Abstract] [Full Text]  
  • Rossier, O., Dao, J., Cianciotto, N. P. (2008). The Type II Secretion System of Legionella pneumophila Elaborates Two Aminopeptidases, as Well as a Metalloprotease That Contributes to Differential Infection among Protozoan Hosts. Appl. Environ. Microbiol. 74: 753-761 [Abstract] [Full Text]  
  • De Buck, E., Anne, J., Lammertyn, E. (2007). The role of protein secretion systems in the virulence of the intracellular pathogen Legionella pneumophila. Microbiology 153: 3948-3953 [Abstract] [Full Text]  
  • Chatfield, C. H., Cianciotto, N. P. (2007). The Secreted Pyomelanin Pigment of Legionella pneumophila Confers Ferric Reductase Activity. Infect. Immun. 75: 4062-4070 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bandyopadhyay, P.
Right arrow Articles by Steinman, H. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bandyopadhyay, P.
Right arrow Articles by Steinman, H. M.