Previous Article | Next Article ![]()
Infection and Immunity, February 2007, p. 781-791, Vol. 75, No. 2
0019-9567/07/$08.00+0 doi:10.1128/IAI.01447-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, New York 14853
Received 3 September 2006/ Returned for modification 27 September 2006/ Accepted 7 November 2006
|
|
|---|
|
|
|---|
In addition to chlamydial factors, host factors including microtubules and dynein, a microtubule-associated minus-end-directed motor protein, also regulate the intracellular trafficking and fusogenic properties of the inclusion (9, 19, 43). Although p150(Glued), a component of dynactin that facilitates cargo binding to dynein (44), is recruited to the C. trachomatis inclusion, the trafficking of chlamydial elementary bodies (EBs) to the microtubule organizing center is dynactin independent (18, 19). The dynein-dependent, yet dynactin-independent, trafficking of C. trachomatis inclusions suggests that other host trafficking factors and/or chlamydial factors may also be involved in the intracellular trafficking of EBs.
Rab proteins are small monomeric GTPases that facilitate vesicular trafficking between donor and target membranes by regulating vesicle formation, transport, and fusion as well as SNARE complex formation (33, 55, 62). By cycling between an inactive cytosolic GDP-bound form and an active membrane-localized GTP-bound form, Rab GTPases function through interactions with numerous downstream effector molecules. In addition, organelle identity is mediated in part by the composition of active Rab GTPases present on organelle membranes (3, 33). Importantly, intracellular pathogens, such as Mycobacterium species and Salmonella enterica serovar Typhimurium, exploit Rab GTPases and their associated effectors to modulate the identity of their intracellular vacuoles in order to promote their intracellular survival (29, 57).
Several Rab GTPases, including Rab6, have been shown to localize to the chlamydial inclusion, suggesting that chlamydiae may also exploit specific Rab GTPase/Rab effector interactions to regulate different aspects of their intracellular survival (40). Rab6 isoforms (Rab6A, Rab6A', and Rab6B) function in COPI-independent retrograde Golgi apparatus-to-endoplasmic reticulum (ER) trafficking (11, 26, 59, 61). In addition, Rab6A' also participates in early endosome (EE)-to-trans-Golgi network (TGN) trafficking (11, 25, 61) and cell cycle progression by inactivating the Mad2 spindle checkpoint and regulating the interaction of dynein/dynactin with kinetochores during mitosis (11, 30). Rab6 functions through the interaction with downstream effectors such as Rabkinesin-6 (12), Bicaudal 1/2 (BICD1/2) (27, 49), and the dynactin subunit p150(Glued) (49), which has been shown to associate with chlamydial inclusions (19).
To begin to understand how Rab6 is recruited to C. trachomatis inclusions, we undertook experiments to further characterize the interaction of Rab6 with the inclusion. In this paper, we demonstrate that Rab6 associates with C. trachomatis inclusions in a guanine nucleotide-dependent fashion, suggesting that Rab6 associates directly with inclusions through interactions with a chlamydial protein that mimics a Rab6 effector or indirectly with inclusions through interactions with a Rab6 effector. In addition, we also demonstrate that the Rab6 effector BICD1 is recruited to C. trachomatis inclusions in a biovar-specific manner. Although both Rab6 and BICD1 function in a microtubule- and dynein/dynactin-dependent fashion in uninfected cells, both Rab6 and BICD1 are recruited to inclusions in a microtubule-independent manner, suggesting that they are recruited to the inclusion by a unique, but unidentified, mechanism.
|
|
|---|
Antibodies. Mouse antichlamydial lipopolysaccharide (LPS) was generously provided by Harlan Caldwell (Rocky Mountain Laboratories, National Institutes of Allergy and Infectious Diseases [NIAID], and National Institutes of Health [NIH]), and rabbit anti-C. trachomatis EB antiserum was prepared as previously described (48). Additional antibodies used were as follows: mouse anti-GM130 (BD Transduction Laboratories, San Jose, CA), goat anti-mouse immunoglobulin G (IgG) conjugated to fluorescein isothiocyanate or Texas Red and goat anti-rabbit IgG conjugated to Texas Red (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA), and goat anti-mouse and anti-rabbit IgG conjugated to Cy5 (Zymed Laboratories, Inc., South San Francisco, CA).
Plasmid constructions. Enhanced green fluorescent protein (EGFP)-Rab6 nucleotide-binding mutants were constructed by site-directed mutagenesis (QuikChange; Stratagene, La Jolla, CA) using EGFP-Rab6A (40) as a template. EGFP-Rab6A(Q72L) was constructed using the 5' mutagenic oligonucleotide GGGACACAGCAGGTCTAGAGCGGTTCAGGAGC and the 3' mutagenic oligonucleotide GCTCCTGAACCGCTCTAGACCTGCTGTGTCCC; EGFP-Rab6A(T27N) was constructed using the 5' mutagenic oligonucleotide CAAAGCGTTGGAAAGAACTCTTTGATCACCAGATTC and the 3' mutagenic oligonucleotide GAATCTGGTGATCAAAGAGTTCTTTCCAACGCTTTG; EGFP-Rab6A(I46E) was constructed using the 5' mutagenic oligonucleotide CCTATCAGGCAACAGAAGGCATTGACTTTTTATC and the 3' mutagenic oligonucleotide GATAAAAAGTCAATGCCTTCTGTTGCCTGATAGG; and EGFP-Rab6AN126I was constructed using the 5' mutagenic oligonucleotide CATCATGCTAGTAGGAATTAAAACAGATCTTGCTG and the 3' mutagenic oligonucleotide CAGCAAGATCTGTTTTAATTCCTACTAGCATGATG. EGFP-BICD1 was constructed by PCR amplification using a 5' gene-specific primer designed with a 5' BamHI site (GGATCCATATGGCCGCAGAAGAGGTATTGC) and a 3' gene-specific primer designed with a 5' SalI site (GTCGACCTAGGGGTGAGGAGGCTTGGAG) using a HeLa cDNA library (Clontech, Palo Alto, CA) as a template. EGFP-BICD1-CC1(1-276) and EGFP-BICD1-CC1/CC2(1-630) were constructed by PCR amplification using the same 5' gene-specific primer as EGFP-BICD1 and the 3' gene-specific primers with a 5' SalI site (GTCGACCTACCCATCCTCGGCAAATTTGAGTCC and GTCGACCTAGGCATTAAGGTTGTAGATATTCATTGG, respectively). EGFP-BICD1-CC3(630-975*) was similarly constructed using a 5' gene-specific primer designed with a 5' BamHI site (GGATCCATATAATCCGGGACCAAATCAAGC) and the same 3' oligonucleotide that was used for EGFP-BICD1. After cloning the PCR products into pGEM-T Easy (Promega, Madison, WI), the BamHI/SalI fragments containing the BICD1 coding regions were cloned into the BglII/SalI sites of pEGFP-C2 (Clontech). Upon DNA sequencing, it was determined that amino acids 821 to 920 were deleted from this construct, and the construct is designated 630-975* to indicate this deletion. The same deletion was found in EGFP-BICD1. DsRed-BICD1-CC1(1-276) was constructed by PCR amplification using a 5' gene-specific primer with a 5' BamHI site (GGATCCATGGCCGCAGAAGAGGTATTGC) and the same 3' gene-specific primer used for EGFP-BICD1-CC1(1-276) using EGFP-BICD1 as a template. DsRed-BICD1-CC3(630-975*) was constructed in a similar fashion using a 5' gene-specific primer with a BamHI site (GGATCCATAATCCGGGACCAAATCAAGC) and the same 3' gene-specific primer used for EGFP-BICD1. The PCR products were cloned into pGEM-T Easy, and the BamHI/SalI fragments containing the BICD1 coding regions were isolated and cloned into the BglII/SalI sites of DsRed-Express-C1 (Clontech). All PCR amplifications were performed using HiFidelity Platinum Taq polymerase (Invitrogen), and each fusion construct was confirmed by DNA sequencing (BioResource Center, Cornell University, Ithaca, NY).
Eukaryotic cell transfection and infection. HeLa 229 cells were grown on 12-mm-diameter glass coverslips (no. 1 thickness) in 24-well plates (Corning Inc., Corning, NY) at 37°C in an atmosphere of 5% CO2 and 95% humidified air. Cells were washed once in serum-free RPMI 1640 and transfected with Lipofectamine (Invitrogen) using a total of 0.4 µg of DNA per well according to the manufacturer's protocol (Invitrogen). For C. trachomatis serovar L2 infections, 24 h posttransfection, the cells were infected at a multiplicity of infection of approximately 1 or 20 and incubated for the indicated times in RPMI 1640 supplemented with 10% FBS and 10 µg/ml of gentamicin at 37°C in an atmosphere of 5% CO2 and 95% humidified air. For C. trachomatis serovars B and D, C. muridarum, and C. pneumoniae, the chlamydial inoculum was centrifuged onto transfected HeLa cell monolayers for 1 h at 20°C at 900 x g, and cycloheximide was added to growth media at a final concentration of 1 µg/ml. Cells were infected for 18 h, except for C. pneumoniae infections, which were allowed to proceed for 44 h.
Nocodazole, chloramphenicol, and BFA treatment of cells. Cells were transfected as described above. For experiments requiring pretreatment with nocodazole (Calbiochem, San Diego, CA) or brefeldin A (BFA; EMD Biosciences, San Diego, CA), cells were incubated in RPMI 1640 supplemented with 10% FBS, 10 µg/ml of gentamicin, and 20 µM nocodazole or 1 µg/ml BFA for 3 h prior to infection. Cells were infected as described above and incubated in RPMI 1640 supplemented with 10% FBS, 10 µg/ml of gentamicin, and 20 µM nocodazole or 1 µg/ml BFA for the indicated times before fixation. For experiments in which cells were treated with nocodazole postinfection, RPMI 1640 supplemented with 10% FBS, 10 µg/ml of gentamicin, and 20 µM nocodazole was added to the cells for 4 h prior to fixation. For chloramphenicol-treated cells, cells were infected for 12 h in the presence of 200 µg/ml chloramphenicol (EM Science, Gibbstown, NJ). Cells were then fixed in 4% formaldehyde in phosphate-buffered saline (PBS) and labeled with antibodies as described below.
LSCM. Cells were fixed in 4% formaldehyde in PBS for 60 min (antichlamydial LPS) or in ice-cold methanol for 10 min at room temperature (RT) (anti-GM130, antichlamydial EB antiserum). For antibody labeling of formaldehyde-fixed cells, cells were permeabilized in PBS containing 0.05% saponin and 0.2% bovine serum albumin for 10 min at RT, and primary and secondary antibodies were incubated in permeabilization buffer sequentially for 60 min each at RT. For antibody labeling of methanol-fixed cells, cells were blocked in PBS containing 3.0% bovine serum albumin for 10 min at RT, and primary and secondary antibodies were incubated in blocking buffer sequentially for 60 min each at RT. Coverslips were mounted onto glass slides using Prolong Antifade (Molecular Probes, Eugene, OR) and viewed by laser scanning confocal microscopy (LSCM). An Olympus Fluoview 500 confocal laser scanning imaging system equipped with argon, krypton, and He-Ne lasers on an Olympus IX70 inverted microscope with a PLAPO 60x objective was used (Olympus America, Inc., Melville, NY). Confocal images were processed using Adobe Photoshop 6.0 (Adobe Systems, Inc., Mountain View, CA).
|
|
|---|
![]() View larger version (71K): [in a new window] |
FIG. 1. EGFP-Rab6A localizes to C. trachomatis serovar L2 inclusions in a guanine nucleotide-dependent fashion. HeLa cells transiently transfected with EGFP-Rab6A (A), EGFP-Rab6A(Q72L) (B), EGFP-Rab6A(T27N) (C), EGFP-Rab6A(I46E) (D), or EGFP-Rab6A(N126I) (E) were infected with C. trachomatis serovar L2 EBs for 18 h. Cells were then fixed and stained with antichlamydial LPS (data not shown) and examined by LSCM. Both EGFP-Rab6A (A) and EGFP-Rab6A(Q72L) (B) were recruited to inclusions, as demonstrated by the distinct rim-like staining pattern. In contrast, EGFP-Rab6A(T27N) (C), EGFP-Rab6A(I46E) (D), and EGFP-Rab6A(N126I) (E) were not recruited. Arrows indicate inclusions. The asterisk indicates an untransfected infected cell. Bar, 10 µm.
|
-helical coiled-coil protein that is a human orthologue of the Drosophila melanogaster protein Bic-D, which is essential for oocyte development and microtubule organization during oogenesis (22, 24, 52, 53). In order to determine whether BICD1 localized to the inclusion, we examined the intracellular localization of EGFP-BICD1 in uninfected or infected HeLa cells. HeLa cells transiently expressing EGFP-BICD1 were infected with C. trachomatis serovar L2 for 18 h or mock infected. Cells were fixed and stained with antichlamydial LPS (data not shown) and viewed by LSCM. Similar to endogenous BICD1 (27), EGFP-BICD1 localized to the Golgi apparatus in uninfected cells (data not shown). As shown in Fig. 2A, EGFP-BICD1 is recruited to the serovar L2 inclusion, as demonstrated by the distinct rim-like immunofluorescence staining surrounding the inclusion. EGFP-BICD2 was also recruited to the serovar L2 inclusion (data not shown).
![]() View larger version (94K): [in a new window] |
FIG. 2. EGFP-BICD1 localizes to the C. trachomatis serovar L2 inclusion. HeLa cells transiently expressing EGFP-BICD1 (A), EGFP-BICD1-CC1(1-276) (B), EGFP-BICD1-CC1/2(1-630) (C), or EGFP-BICD1-CC3(630-975*) (D) were infected with C. trachomatis serovar L2 for 18 h and then fixed and stained with antichlamydial LPS (data not shown). Cells were examined by LSCM. EGFP-BICD1 (A) and EGFP-BICD1-CC3(630-975*) (D) were recruited to C. trachomatis serovar L2 inclusions, as demonstrated by the distinct rim-like staining pattern surrounding the chlamydial inclusion, whereas EGFP-BICD1-CC1(1-276) (B) and EGFP-CC1/CC2(1-630) (C) were not recruited. Arrows indicate inclusions. Bar, 10 µm.
|
![]() View larger version (9K): [in a new window] |
FIG. 3. Schematic of BICD1 fusion proteins used in this study. BICD1 contains three coiled-coil domains (CC1, CC2, and CC3) (black rectangles) encoded by amino acids 1 to 265, 319 to 496, and 663 to 803, respectively. The CC1 domain of BICD1, encoded by amino acids 1 to 265, has been shown to interact with dynein (22), while amino acids 673 to 803, which are contained within CC3, have been shown to interact with Rab6 (49), as indicated by the white rectangles. The full-length BICD1 and fusions containing the CC3 domain utilized in this study are deleted for amino acids 821 to 920, possibly due to PCR amplification of a previously unreported splice variant of BICD1. EGFP and DsRed-Express amino-terminal fusions containing the indicated amino acids of BICD1 were constructed and expressed in HeLa cells infected with C. trachomatis serovars L2, D, and B, C. muridarum, or C. pneumoniae (Cpn). Localization to each inclusion was determined by LSCM. + indicates localization to the inclusion, as demonstrated by a rim-like fluorescence staining pattern at the inclusion membrane; indicates the absence of localization to the inclusion.
|
![]() View larger version (52K): [in a new window] |
FIG. 4. EGFP-BICD1, but not EGFP-BICD1-CC3, localizes to C. trachomatis inclusions in a biovar-specific manner. HeLa cells transiently expressing EGFP-BICD1 (A to D) or EGFP-BICD1-CC3(630-975*) (E to H) were infected 24 h posttransfection with C. trachomatis (CT) serovar B (A and E), C. trachomatis serovar D (B and F), or C. muridarum (C and G) for 18 h or C. pneumoniae for 44 h (D and H). Cells were fixed, permeabilized, and stained with antichlamydial LPS (data not shown). Cells were viewed by LSCM. EGFP-BICD1 was not recruited to C. trachomatis serovar B (A), C. trachomatis serovar D (B), C. muridarum (C), or C. pneumoniae (D) inclusions. In contrast, EGFP-BICD1-CC3(630-975*) was recruited to C. trachomatis serovar B (E), C. trachomatis serovar D (F), and C. pneumoniae (H) inclusions but not to C. muridarum inclusions (G). Arrows indicate inclusions. Bar, 10 µm.
|
Intramolecular interactions between the CC1 and the CC3 domains, which have been postulated to regulate the BICD1 association with Rab6 and dynein/dynactin, have been demonstrated using a yeast two-hybrid system (22, 49). In the absence of Rab6-coated vesicles and dynein/dynactin, CC1 is thought to interact with CC3, thus preventing the interaction of proteins with the CC3 domain (22). The autoinhibitory intermolecular interaction between CC1 and CC3 is relieved through the interaction of CC3 with BICD1-interacting proteins such as Rab6 (22). Based upon these observations, we hypothesize that the C. trachomatis serovar L2 inclusion may have a greater affinity for the CC3 domain than the other strains examined and thus is able to promote the "release" of CC3 from CC1, resulting in the recruitment of full-length BICD1 to the inclusion. In contrast, the affinity of the CC3 domain for the other chlamydial inclusions is too weak to promote the dissociation of the intermolecular interactions between CC1 and CC3, and therefore, the CC3 domain present within full-length BICD1 is not accessible to the inclusion. If this hypothesis is correct, the overexpression of both EGFP-BICD1-CC3 and DsRed-BICD1-CC1 in the same cell should prevent the recruitment of EGFP-BICD1-CC3 to the C. trachomatis serovar B and D inclusions as well as to the C. pneumoniae inclusion but not to the serovar L2 inclusion. As predicted, in the presence of DsRed-BICD1-CC1 (1-276), EGFP-BICD1-CC3(630-975*) was not recruited to C. trachomatis serovar B (Fig. 5B), C. trachomatis serovar D (Fig. 5C), or C. pneumoniae (Fig. 5D) inclusions but was still recruited to the C. trachomatis serovar L2 inclusion (Fig. 5A). Interestingly, in the presence of EGFP-BICD1-CC3(630-975*), DsRed-BICD1-CC1(1-276) was now recruited to the serovar L2 inclusion (Fig. 5B), presumably through its interaction with EGFP-BICD1-CC3(630-975*).
![]() View larger version (68K): [in a new window] |
FIG. 5. Recruitment of EGFP-BICD1-CC3(630-975*) to the C. trachomatis (CT) serovar B, C. trachomatis serovar D, and C. pneumoniae inclusions, but not to the C. trachomatis serovar L2 inclusion, is inhibited by coexpression of DsRed-BICD1-CC1(1-276). HeLa cells transiently coexpressing EGFP-BICD1-CC3(630-975*) (A to D) and DsRed-BICD1-CC1(1-276) (E to H) were infected 24 h posttransfection with C. trachomatis serovar L2 (A and E), C. trachomatis serovar B (B and F), or C. trachomatis serovar D (C and G) for 18 h or C. pneumoniae for 44 h (D and H). Cells were fixed and viewed by LSCM. Neither EGFP-BICD1-CC3(630-975*) nor DsRed-BICD1-CC1(1-276) was recruited to C. trachomatis serovar B (B and F), C. trachomatis serovar D (C and G), or C. pneumoniae (D and H) inclusions. In contrast, DsRed-BICD1-CC1(1-276) and EGFP-BICD1-CC3(630-975*) were both recruited to C. trachomatis serovar L2 inclusions (A and E). Arrows indicate inclusions. Asterisks indicate aggregates of colocalized EGFP-BICD1-CC3(630-975*) and DsRed-CC1(1-276). Bar, 10 µm.
|
![]() View larger version (67K): [in a new window] |
FIG. 6. EGFP-Rab6A and EGFP-BICD1 are recruited to the inclusion by a unique microtubule- and Golgi apparatus-independent mechanism. HeLa cells transiently expressing EGFP-Rab6A (A to C), EGFP-BICD1-CC3(630-975*) (D to G), or EGFP-BICD1 (H to K) were infected with C. trachomatis serovar L2 EBs for 12 h in absence of any treatment (A, D, and H) or in the presence of nocodazole for 12 h (B, E, and I) or were infected for 18 h and then treated with nocodazole for 4 h (G and K). At the indicated times, cells were fixed and stained with antichlamydial LPS and viewed by LSCM. EGFP-Rab6A, EGFP-BICD1-CC3(630-975*), and EGFP-BICD1 were recruited to the inclusion in the absence of microtubules (B, E, and I) and maintained their association with the inclusion when microtubules were dissembled after their recruitment to the inclusion (G and K) (40). HeLa cells transiently expressing EGFP-Rab6A (C), EGFP-BICD-CC3(630-975*) (F), or EGFP-BICD1 (J) were infected with C. trachomatis serovar L2 EBs in the presence of BFA. At 12 h postinfection, cells were fixed and viewed by LSCM. All three EGFP fusion proteins were recruited to the inclusion in the presence of BFA, demonstrating that an intact Golgi apparatus is not required for the trafficking of either Rab6 or BICD1 to the inclusion. Arrows indicate selected inclusions. Bar, 10 µm.
|
Since both Rab6 and BICD1 are normally localized to the Golgi apparatus, we wanted to determine whether an intact Golgi apparatus was required for the localization of either protein to the inclusion. To examine this, HeLa cells transiently expressing EGFP-Rab6A, EGFP-BICD1-CC3(630-975*), or EGFP-BICD1 were pretreated with BFA, a fungal metabolite that causes the collapse of the Golgi apparatus into the ER (45), for 3 h in order to disrupt the Golgi apparatus prior to infection with serovar L2. Twelve hours postinfection, cells grown in the continual presence of BFA were fixed and stained with antichlamydial antiserum to visualize the chlamydiae and anti-GM130 to confirm the breakdown of the Golgi apparatus (data not shown). All three EGFP fusion proteins localized to the inclusion in the presence of BFA, demonstrating that an intact Golgi apparatus is not required for the delivery of either Rab6 or BICD1 to the inclusion (Fig. 6C, F, and J). Finally, the trafficking of EGFP-BICD1 and EGFP-Rab6A to the serovar L2 inclusion was inhibited when infected cells were grown in the presence of chloramphenicol, demonstrating that a chlamydia-derived modification of the inclusion is required for the recruitment of each protein to chlamydia-containing vacuoles (data not shown).
BICD1 is trafficked to the C. trachomatis serovar L2 inclusion by a Rab6-independent mechanism. BICD1 localizes to the Golgi apparatus in a Rab6-dependent fashion (27). To determine whether BICD1 is also trafficked to the inclusion by a Rab6-dependent mechanism, we examined the intracellular localization of DsRed-BICD1-CC3(630-975*) in cells expressing EGFP-Rab6A(T27N). Since Rab6A(T27N) functions as a dominant negative mutant by preventing the activation of endogenous wild-type Rab6 (11, 23, 26), the expression of EGFP-Rab6A(T27N) in infected cells should prevent the localization of endogenous Rab6 to the inclusion. If Rab6A mediates the recruitment of BICD1 to the inclusion, the expression of EGFP-Rab6A(T27N) should prevent the localization of DsRed-BICD1-CC3(630-975*) to the inclusion. However, if the association of DsRed-BICD1-CC3(630-975*) with the inclusion is Rab6 independent, then DsRed-BICD1-CC3(630-975*) should still localize to the inclusion even in the presence of EGFP-Rab6A(T27N). HeLa cells transiently coexpressing DsRed-BICD1-CC3(630-975*) and either EGFP-Rab6A or EGFP-Rab6A(T27N) were mock infected or infected with C. trachomatis serovar L2 EBs. Uninfected cells were then fixed and stained with anti-GM130 antiserum, while infected cells were stained with antichlamydial LPS. As expected, in uninfected cells, DsRed-BICD1-CC3(630-975*) colocalized with the Golgi marker GM130 in the presence of EGFP-Rab6A (Fig. 7E and data not shown) but not EGFP-Rab6A(T27N) (Fig. 7F and data not shown), thus confirming that BICD1 is trafficked to the Golgi apparatus in a Rab6-dependent manner. However, in infected cells, even in the presence of EGFP-Rab6A(T27N), DsRed-BICD1-CC3(630-975*) was still recruited to the inclusion (Fig. 7H). These data demonstrate that BICD1 associates with the inclusion independently of Rab6, which is consistent with the observation that BICD1 does not always colocalize with Rab6 at the inclusion membrane (Fig. 7C and G). In addition, these data also suggest that BICD1 does not require trafficking to the Golgi apparatus prior to delivery to the inclusion.
![]() View larger version (62K): [in a new window] |
FIG. 7. DsRed-BICD1-CC3 associates with the inclusion by a Rab6-independent mechanism. HeLa cells transiently coexpressing EGFP-Rab6A and either DsRed-BICD1-CC3(630-975*) (A, C, E, and G) or EGFP-Rab6A(T27N) and DsRed-BICD1-CC3(630-975*) (B, D, F, and H) were mock infected (A, B, E, and F) or infected with C. trachomatis serovar L2 EBs (C, D, G, and H) for 18 h. Cells were fixed and stained with antichlamydial LPS or anti-GM130 antiserum (data not shown) and examined by LSCM. DsRed-BICD1-CC3(630-975*) colocalized with the Golgi apparatus in the presence of EGFP-Rab6A (E) (data not shown) but not in the presence of EGFP-Rab6A(T27N) (F) (data not shown). In infected cells, DsRed-BICD1-CC3(630-975*) localized to the inclusion in the presence of both EGFP-Rab6A (G) and EGFP-Rab6A(T27N) (H), demonstrating that DsRed-BICD1-CC3(630-975*) localized to the inclusion in a Rab6-independent manner. Asterisks indicate the Golgi apparatus (A and E), and arrows indicate inclusions (C, D, G, and H). Bar, 10 µm.
|
|
|
|---|
Similar to the interaction of Rab GTPases with their respective effector proteins (8), Rab6 also interacts with the inclusion in a guanine nucleotide-dependent manner. In addition, chlamydia-mediated modification of the inclusion is also required, as demonstrated by the observation that EGFP-Rab6 is not recruited to EB-containing vacuoles grown in the presence of chloramphenicol (data not shown). Collectively, these data suggest that a chlamydial protein, such as a chlamydia-specific Inc that is expressed only during intracellular growth, recruits and interacts with Rab6 directly or indirectly through recruitment and interaction with a host Rab6 effector molecule, such as BICD1 or p150(Glued). Although we have not yet identified a chlamydial protein that recruits Rab6 or its effectors to the inclusion, the recently described interaction between Rab4 and the C. trachomatis Inc CT229 supports this hypothesis (39).
Chlamydiae exploit host vesicle-mediated trafficking pathways to deliver Golgi apparatus-derived lipids to the inclusion (20, 21). Since both Rab6 and BICD1 are localized to the Golgi apparatus, Rab6 and BICD1 may be delivered to the inclusion as components of these vesicles. However, the data presented in this paper do not support this hypothesis. First, in uninfected cells, BICD1 is trafficked to the Golgi apparatus by a dynein/dynactin- and microtubule-dependent mechanism as well as a Rab6-dependent trafficking mechanism (22, 27, 49, 61). In contrast, we demonstrate that BICD1, like Rab6, is recruited to the inclusion by a microtubule- and dynein/dynactin-independent mechanism as well by a Rab6-independent mechanism. Second, we also demonstrate that EGFP-BICD1 is still recruited to the inclusion under conditions that prevent Rab6 recruitment to the inclusion. These data suggest that chlamydiae do not exploit Rab6-dependent trafficking pathways to recruit BICD1 to the inclusion. In addition, they also suggest that localization to or transit through the Golgi apparatus is not essential for the delivery of either BICD1 or Rab6 to the chlamydial inclusion. These data may provide further evidence that the chlamydial vacuole may not intercept vesicles directly from the Golgi apparatus but may instead intercept other host vesicles including MVB-derived vesicles (2).
Rab6 also regulates the trafficking of several proteins from EEs to the TGN (11, 25, 56, 59), and therefore, chlamydiae may exploit a similar trafficking pathway to deliver Rab6 to the inclusion. However, since the trafficking of Rab6-containing vesicles from the EE to the TGN is also dependent on the dynein/dynactin complex (27), chlamydiae are also unlikely to exploit this pathway. Finally, EGFP-BICD1 and EGFP-Rab6A are still recruited to the inclusion even in the presence of BFA, which has been shown to redistribute both BICD2 and Rab6 from the Golgi membranes to the cytosol (22, 36), suggesting that neither membrane localization nor Golgi apparatus localization of BICD1 or Rab6 is needed for their delivery to the inclusion. These data are consistent with chlamydiae targeting a cytoplasmic pool of BICD1 and Rab6.
Rab6 isoforms have been shown to regulate a microtubule-mediated COPI-independent retrograde trafficking pathway from the TGN to the ER (27), and vesicles trafficked in the COPI-independent pathway have been demonstrated to have a higher percentage of sphingomyelin than other vesicles (4). These data suggest that chlamydiae may exploit this pathway to deliver Golgi-derived vesicles to the inclusion. As mentioned above, sphingomyelin can be trafficked from CD63-positive MVBs, which are late endosomes that intersect the exocytic pathway, to the inclusion (2) and therefore may not be directly trafficked from the Golgi apparatus as previously suggested (20, 21). Although several Rab GTPases that are localized to chlamydial inclusions (Rab4 and Rab11) have been shown to localize to exosomes (58), which are exocytic vesicles derived from MVBs (51), or regulate exosome biogenesis (13) or homotypic exosome fusion (41), neither Rab6 nor BICD1 is known to regulate MVB-mediated trafficking pathways. Collectively, these data suggest that Rab6 or BICD1 does not regulate the trafficking of sphingomyelin to the inclusion.
Alternatively, based upon the role of Rab6A in regulating EE-to-TGN trafficking and the role of BICD1 in mediating the trafficking of Rab6-containing vesicles to the Golgi apparatus, Rab6 and/or BICD1 may regulate the trafficking of EBs to the peri-Golgi region of the cell (11, 25, 27, 61). Although we have not detected either EGFP-Rab6 isoforms or EGFP-BICD1 at the inclusion prior to 8 h postinfection (data not shown), at which time the inclusion is already localized to the peri-Golgi region, both proteins may be recruited to the inclusion prior to delivery to the peri-Golgi region but at levels too low to be detected by LSCM.
We attempted to examine the function of Rab6 in infected cells expressing either GTPase-defective constitutively active or dominant negative Rab6 mutants. However, inclusions develop in cells expressing single Rab6 guanine nucleotide-binding mutants, suggesting that Rab6 is not essential for chlamydial development in our in vitro system. However, the failure to alter chlamydial development in our experiments does not rule out a role for Rab6. Instead, these data may be suggestive of either functional redundancy or an environmentally specific role for Rab6, such as in polarized cells. Rab6A mRNA levels are upregulated by chlamydia infection in HeLa cells (60), suggesting that Rab6 does indeed play a role in chlamydial development. Therefore, experiments to deplete Rab6 isoforms individually or in combination by using small interfering RNA gene silencing techniques in polarized and nonpolarized infected cells are ongoing. Additionally, similar experiments are being conducted to examine the role of BICD1 in serovar L2-infected cells.
The trachoma and LGV biovars differ greatly with regard to host-pathogen interactions and disease expression even though they are approximately 98% identical at the DNA level, suggesting that small genetic differences can result in large phenotypic differences (6). Genetic variation present within "the plasticity zone" has been shown to contribute to differences in host susceptibility and immune responses to the different C. trachomatis biovars in the mouse model (14, 32, 34, 38). However, we believe that additional diversity may also arise due to differences in the types or amino acid compositions of Incs expressed by the different Chlamydia species and serovars (1, 54). The species-specific interaction between the C. trachomatis-specific inclusion membrane protein IncG and 14-3-3ß (46) supports this model. In addition, serovars L2 and D are predicted to express homologous, but not identical, Incs (5, 50). Therefore, homologous Incs may interact with host proteins with different affinities, resulting in biovar-specific host-pathogen interactions, such as the biovar-specific recruitment of BICD1 to the serovar L2 inclusion that we have demonstrated here. This model is supported by the ability of the CC3 domain of BICD1, but not full-length BICD1, to be recruited to the inclusions of additional Chlamydia species. These data suggest that although the trachoma biovars and C. pneumoniae express a protein that interacts with the CC3 domain of BICD1, the interaction is not strong enough to overcome the intramolecular interactions between the CC1 and CC3 domains of BICD1, and thus, the trachoma biovars are not able to recruit full-length BICD1 to the inclusion (22).
Finally, the biovar-specific pattern of localization to chlamydial inclusions suggests that if Rab6 regulates the activity of BICD1 at the inclusion, then this interaction would be important only in serovar L2-infected cells and that Rab6 regulates a different effector at inclusion membranes of the trachoma biovars. Alternatively, BICD1 may be recruited to and function independently of its interaction with Rab6, indicating that the target of Rab6 in both LGV- and trachoma-infected cells still remains undefined. In our localization studies, although we observed extensive colocalization between BICD1 and Rab6 at the serovar L2 inclusion membrane, BICD1 also localized to the inclusion in the absence of Rab6. These data may support the idea that BICD1 can function independently of Rab6. BICD1 promotes minus-ended microtubule-dependent trafficking through its interaction with components of the dynein/dynactin complex as well as with Rab6 (22, 27, 49). In vivo, C. trachomatis replicates primarily in polarized columnar epithelial cells, which differ from nonpolarized cells in the organization of their microtubule cytoskeleton (31). In polarized epithelial cells, the trachoma biovars remain localized to the apical surface, while the LGV biovars traffic to and exit from the basolateral surface (10). Therefore, one model suggests that the biovar-specific recruitment of BICD1 may function specifically in polarized cells to specifically regulate the intracellular trafficking of the C. trachomatis LGV biovars.
The recruitment of Rab6 and several of its effectors to chlamydial inclusions demonstrates that chlamydiae can exploit host trafficking pathways in both a species-specific and C. trachomatis biovar-specific manner. Further work is needed in order to elucidate the role of both Rab6 and BICD1, determine whether Rab6 regulates the activity of BICD1 in serovar L2-infected cells, and identify the chlamydial proteins that recruit Rab6 and its effectors to C. trachomatis inclusions.
A.R.M. was supported by NIH T32RR07059.
Published ahead of print on 13 November 2006. ![]()
|
|
|---|
immune evasion is linked to host infection tropism. Proc. Natl. Acad. Sci. USA 102:10658-10663.This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»