Previous Article | Next Article ![]()
Infection and Immunity, March 2007, p. 1129-1136, Vol. 75, No. 3
0019-9567/07/$08.00+0 doi:10.1128/IAI.01262-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Christina M. J. E. Vandenbroucke-Grauls,1,4
Jan J. Weening,3 and
Sebastian A. J. Zaat1*
Department of Medical Microbiology, CINIMA (Center for Infection and Immunity Amsterdam), Academic Medical Center, University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands,1 Emergent Europe, 540-545 Eskdale Road, Winnersh Triangle, Wokingham, RG41 5TU, Berkshire, United Kingdom,2 Department of Pathology, Academic Medical Center, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands,3 Department of Medical Microbiology and Infectious Diseases, VU Medical Center, Amsterdam, The Netherlands4
Received 7 August 2006/ Returned for modification 11 September 2006/ Accepted 28 November 2006
|
|
|---|
|
|
|---|
The formation of a biofilm consisting of bacteria, bacterial products, and host proteins on the biomaterial surface (15, 26) is considered a pivotal element in the pathogenesis of these biomaterial-associated infections (BAI) (9, 15, 28). Biofilm formation involves direct adherence of S. epidermidis to the biomaterial surface through autolysin AtlE (13, 15) and to deposited host proteins by fibronectin-binding (45) and fibrinogen-binding (27) proteins. Subsequent accumulation is attributed to polysaccharide intercellular adhesin, elaborated by the products of the icaADBC genes (18, 25), and to accumulation-associated protein (20, 33).
Mutation of either S. epidermidis atlE (34) or icaABC (18, 34) results in a biofilm-negative phenotype in vitro and strongly reduces the numbers of CFU retrieved from implants in animal models (34, 35). However, several studies have failed to demonstrate a requirement for the ica biofilm genes for virulence in experimental BAI (12, 36), and between 40 and 75% of clinical S. epidermidis isolates lack one or more of the biofilm genes (13, 14, 22, 41). This suggests that biofilm formation is not the only mechanism underlying BAI.
As the presence of a biomaterial reduces the efficacy of the local host immune response (21, 46, 47), bacteria may not be cleared from peri-implant tissue (2, 3). Therefore, we studied the kinetics of colonization of implants, as well as peri-implant tissue, with two S. epidermidis strains, two biomaterials, and two mouse strains, C57BL/6 and BALB/c. Our data show that colonization of tissues surrounding implants by S. epidermidis is a general phenomenon, which may be an important element in the pathogenesis of BAI that has been overlooked previously.
(Part of this study was presented at the Gordon Conference on Staphylococcal Diseases, August 2005, Newport, RI.)
|
|
|---|
Biomaterials. Catheters of silicon elastomer grafted with poly(vinylpyrrolidone) hydrogel (SEpvp) (Medtronic PS Medical, Goleta, CA) (used for hydrocephalus shunts) and of polyamide grafted with poly(vinylpyrrolidone) (PApvp) (experimental biomaterial) (2) with an external diameter of 2.5 mm and a wall thickness of 0.6 mm were used. SEpvp and PApvp were chosen as model biomaterials because they induce different grades of inflammation in C57BL/6 mice infected with S. epidermidis RP62a; SEpvp provokes a strong proinflammatory response (3), and PApvp provokes only a mild proinflammatory response (2).
S. epidermidis strains.
S. epidermidis RP62a (= ATCC 35984), a well-studied BAI strain (2-4, 6, 8), and S. epidermidis clinical isolate AMC5 were used. Both strains were capable of producing slime, as determined by the method of Christensen et al. (6), and
-toxin, as determined by the method of Hebert and Hancock (17), and were positive for the icaA, atlE, aap, and sarA genes as determined by PCR. The primers used for icaA, atlE, and aap were the primers described by Vandecasteele et al. (42). sarA was detected using primers sarA_d (AGCAAATGCTACATTGCTAATTC) and sarA_r (ATTTGCTTCTGTGATACGGTTG). The MICs of antibiotics for strains RP62a and AMC5 (as determined by E tests) were as follows: rifampin, <0.016 and <0.016 µg/ml, respectively; teicoplanin, 3 and 1.5 µg/ml, respectively; gentamicin, 8 and 0.125 µg/ml, respectively; and vancomycin, 4 and 4 µg/ml, respectively. The following antibiotic tablets were used for antibiogram analysis of challenge bacteria and CFU recovered from the model: spectinomycin (200 µg), penicillin low (5 µg), chloramphenicol (60 µg), vancomycin (5 µg), erythromycin (78 µg), rifampin (30 µg), minocycline (80 µg), and gentamicin (40 µg). RP62a is resistant to spectinomycin and erythromycin. The AMC5 strain is susceptible to all antibiotics tested.
Inoculum preparation. Thirty milliliters of tryptic soy broth inoculated with the S. epidermidis test strain was incubated for 4 h at 37°C on a rotary shaker at 120 rpm. The culture was centrifuged at 2,200 x g for 10 min, and the pelleted bacteria were washed twice with 30 ml of pyrogen-free 0.9% NaCl (saline) (Fresenius Kabi, Sévres, France). Suspensions containing 4 x 106 to 4 x 109 CFU per ml were prepared based on the optical density at 620 nm.
Mouse biomaterial-associated infection model. Mouse BAI studies were performed as described previously (3, 4). In short, mice anesthetized with a mixture of 1 ml fentanylcitrate, 1 ml midazalam, and 2 ml distilled water received 1-cm-long subcutaneous implants in a laminar flow cabinet. The incisions were closed with a single stitch. Inocula (25 µl) were injected along the implants with a repetitive injector (Stepper model 4001-025; Tridak Division, Brookfield, CT).
Mice were anesthetized with FFM mixture between 5 and 21 days after challenge, and standardized biopsies (diameter, 12 mm) of biomaterial implants with subcutaneous tissue and skin were taken. The right side biopsy was used for quantitative culture. The left side biopsy was cut into two halves; one half was used for quantitative culture, and the other half was used for histology. Cardiac puncture was performed to collect blood and terminate the mice. The time intervals between challenge and termination of mice in the different experiments were matched but were not always identical due to variation in the availability of operating rooms in the animal facility. The catheter segments were rinsed twice to remove bacteria loosely associated with the implant and placed in sterile tubes containing 500 µl of saline. The tubes were sonicated for 30 s in a water bath sonicator (Bransonic B-2200 E4) to dislodge adherent bacteria for quantitative culture. The segment itself was placed in 80 ml of Brewer Tween (BT) thioglycolate broth at 37°C for 2 to 14 days to detect low numbers of bacteria or bacteria released from host cells lysed by the Tween. If the BT culture was positive and plate cultures were negative, the biomaterial segment was considered to have had 5 adherent CFU.
The tissue samples were weighed, a volume of saline corresponding to four times the weight of each sample (range, 50 to 300 mg) was added, the samples were homogenized on ice (model 985-370 Tissue Tearor; Biospec Products, Bartlesville, OK), and quantitative cultures were grown. In addition, 0.1 volume of the homogenate was cultured in 80 ml BT for 2 to 14 days at 37°C. If the BT culture was positive and plate cultures were negative, the total homogenate was considered to have contained 10 CFU.
Positive BT cultures were streaked on blood agar plates and incubated at 37°C. Cultured bacteria were analyzed by the Gram stain and antibiogram methods. In all cases reisolated bacteria had the same antibiograms as the challenge strain.
Blood culture. Twenty-five microliters of blood was cultured in 80 ml of BT for up to 14 days at 37°C. Blood cultures were negative for all samples.
Histological examination. Biopsies were fixed in formaldehyde, embedded in plastic (methylmethacrylate/buthylmethacrylate; Merck Schuchart, Hohenbrunn, Germany), and 3- to 5-µm sections were cut at different levels. These sections were stained with hematoxylin and eosin or with Gram stain and examined by light microscopy.
Statistics. The Fisher's exact test was used to test the significance of differences in the frequencies of positive cultures of biopsies and biomaterial implants from different groups of mice. Differences in numbers of CFU were analyzed with the Mann-Whitney test. For both tests, a P value of <0.05 was considered significant.
|
|
|---|
![]() View larger version (21K): [in a new window] |
FIG. 1. Percentages of culture-positive samples (A) and numbers of CFU cultured from tissue biopsies (T) and biomaterial implants (BM) from C57BL/6 mice with SEpvp implants at 5 days after challenge with graded inocula (B) and at 5 and 14 days after challenge with 2 x 106 and 1 x 107 CFU (C) of S. epidermidis RP62a. The frequencies of positive cultures are indicated at the top. An asterisk indicates that the P value is <0.05. Samples that were positive as determined by liquid broth culture but negative as determined by plate culture are indicated by open circles.
|
Experimental BAI due to S. epidermidis AMC5 in C57BL/6 mice with SEpvp or PApvp implants. For mice carrying SEpvp implants, as well as for mice with PApvp implants, we chose conditions expected to yield approximately 50 to 90% culture-positive tissue samples (Fig. 1) (2). At the early time point (10 days) 67% of the tissues, but none of the implants, of mice carrying SEpvp implants and challenged with 3 x 106 CFU of S. epidermidis AMC5 were culture positive (P = 0.0013) (Fig. 2A). Even with an inoculum of 3 x 107 CFU not more than 25% of the implants yielded growth, whereas all tissue biopsies were culture positive (P = 0.0003). The tissue biopsies yielded significantly higher numbers of CFU than the implants yielded for both inocula tested (Fig. 2A). In mice carrying PApvp implants challenged with 3 x 106 CFU, 92% of the tissues and 25% of the implants yielded positive cultures after 8 days (P = 0.003), and the numbers of CFU cultured from the tissues were significantly higher (Fig. 2B). After challenge with 3 x 107 CFU, 42% of the implants and 67% of the tissues were culture positive after 8 days (difference not significant), and the numbers of CFU retrieved were similar.
![]() View larger version (22K): [in a new window] |
FIG. 2. Frequencies of positive samples and numbers of CFU cultured from tissue biopsies (T) and biomaterial implants (BM) from C57BL/6 mice with SEpvp implants sacrificed at 10 and 18 days (A) and from mice with PApvp implants sacrificed at 8 and 15 days (B) after challenge with 3 x 106 and 3 x 107 CFU of S. epidermidis AMC5. The frequencies of positive cultures are indicated at the top. An asterisk indicates that the P value is <0.05. Samples that were positive as determined by liquid broth culture but negative as determined by plate culture are indicated by open circles.
|
Clinical S. epidermidis isolates differ in the capacity to colonize implants in experimental BAI (31). S. epidermidis RP62a and AMC5 showed similar levels of implant colonization. Both strains colonized the tissue more avidly than they colonized the implants. The physicochemical characteristics of biomaterials may also influence the susceptibility to infection in vivo (37) either due to differences in adherence of the bacteria or due to differences in the nature of the foreign body response or the immune response provoked by the presence of the biomaterial (1, 24). Despite the differences in the inflammatory response known to be induced around SEpvp and PApvp during infection (2, 3), tissue colonization around these materials was very similar.
Experimental BAI due to S. epidermidis RP62a in BALB/c mice with SEpvp implants. Since BALB/c mice are reported to be more susceptible to bacterial infection than C57BL/6 mice (19, 40), we used small S. epidermidis RP62a inocula (1 x 104, 1 x 105, and 1 x 106 CFU). The mice were sacrificed 8 days after challenge. As observed for the C57BL/6 mice, the level of tissue colonization around the SEpvp implants was dependent on inoculum size and was higher than the level of colonization of the implants themselves after challenge with 1 x 105 and 1 x 106 CFU (Fig. 3A and B).
![]() View larger version (20K): [in a new window] |
FIG. 3. Frequencies of positive samples (A and C) and numbers of CFU (B and D) cultured from tissue biopsies (T) and biomaterial implants (BM) from BALB/c mice with SEpvp implants at 8 days after challenge with 1 x 104, 1 x 105, and 1 x 106 CFU S. epidermidis RP62a (A and B) and at 6, 14, and 21 days after challenge with 1 x 106 CFU S. epidermidis RP62a (C and D). An asterisk indicates that the P value is <0.05. Samples that were positive as determined by liquid broth culture but negative as determined by plate culture are indicated by open circles.
|
Histology. To investigate where the bacteria were located, we selected biopsies for histology which had yielded high numbers of CFU and were expected to contain sufficient bacteria for microscopic analysis. Sections were collected from different levels in the biopsies. The images in Fig. 4 are representative of the biopsies examined from mice challenged with S. epidermidis AMC5 and RP62a.
![]() View larger version (104K): [in a new window] |
FIG. 4. Gram-stained (A to D and F to I) and hematoxylin- and eosin-stained (E and J) sections of peri-implant tissue from C57BL/6 mice with SEpvp implants (A to E) challenged with 107 CFU of S. epidermidis AMC5 and with PApvp implants (F to J) challenged with 3 x 107 CFU of S. epidermidis AMC5 and sacrificed after 8 days. The arrows in panels A and F indicate the biomaterial-tissue interface, and the arrows in panels D and I indicate bacteria.
|
In the tissue of mice carrying PApvp implants and challenged with 3 x 107 CFU of S. epidermidis AMC5, signs of active inflammation were observed 8 days after challenge (Fig. 4F to J). Fibroblasts, neutrophils, monocytes, and plasma cells were present (Fig. 4J). At the tissue-implant interface no bacteria were observed (Fig. 4F and G), but large numbers of gram-positive cocci colocalized with cells in peri-implant tissue that was >30 cell layers from the implant (Fig. 4H and I). Under conditions that compromise the intracellular microbicidal mechanisms, S. epidermidis survives intracellularly in various types of phagocytic cells (11, 43). Our results imply that the presence of the implants indeed compromised the local immunity, providing S. epidermidis with a niche in the peri-implant tissue.
To assess whether our findings with the mouse model are relevant for the human situation, we recently collected central venous catheters and surrounding tissue from deceased patients. We cultured bacteria more often from the pericatheter tissue than from the catheters and the numbers of bacteria were higher, and we also cultured bacteria from tissue not directly bordering the catheters (5). These findings support the hypothesis that peri-implant tissue is a niche for bacteria causing persistent biomaterial-associated infections in humans and imply that the mouse model is a proper model for studying these infections.
Our findings may have important implications for patients with an implanted biomedical device. If S. epidermidis is indeed able to survive and replicate in peri-implant tissue in humans and possibly intracellularly, antibiotic treatment protocols might need adjustment. S. epidermidis BAI is often treated with vancomycin, but vancomycin has relatively poor tissue penetration (38) and is inefficient in reaching intracellular bacteria (32). When vancomycin-rifampin combinations are used for therapy, S. epidermidis in tissue or even inside host cells is reached and affected predominantly only by the rifampin. As S. epidermidis readily develops resistance to rifampin monotherapy (39), the use of a second antibiotic with good tissue and host cell penetration may be warranted.
Conclusions. In our mouse BAI model, peri-implant tissue proved to be a major niche for S. epidermidis. After challenge with low doses, S. epidermidis was recovered only from the peri-implant tissue and not from the implants themselves. At higher challenge doses, bacteria were found in association with the biomaterial, but higher numbers of CFU were cultured from the surrounding tissue. Moreover, bacteria persisted longer in the tissue than on the biomaterial implants. This was observed for two strains of S. epidermidis, RP62a and AMC5, for two different biomaterials, SEpvp and PApvp, and in two different mouse genetic backgrounds, C57BL/6 and BALB/c. Thus, contrary to the general contention, the biomaterial implant itself was not the major site of colonization, but S. epidermidis resided predominantly in the peri-implant tissue.
This study was financially supported in part by Emergent Europe (formerly Microscience Ltd.), Wokingham, United Kingdom.
We do not have a commercial or other association that might pose a conflict of interest.
Published ahead of print on 11 December 2006. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»