Monocyte Chemoattractant Protein 1, Macrophage Inflammatory Protein 1{alpha}, and RANTES Recruit Macrophages to the Kidney in a Mouse Model of Hemolytic-Uremic Syndrome

The macrophage has previously been implicated in contributingto the renal inflammation associated with hemolytic-uremic syndrome(HUS). However, there is currently no in vivo model detailingthe contribution of the renal macrophage to the kidney diseaseassociated with HUS. Therefore, renal macrophage recruitmentand inhibition of infiltrating renal macrophages were evaluatedin an established HUS mouse model. Macrophage recruitment tothe kidney was evident by immunohistochemistry 2 h after administrationof purified Stx2 and peaked at 48 h postinjection. Mice administereda combination of Stx2 and lipopolysaccharide (LPS) showed increasedmacrophage recruitment to the kidney compared to mice treatedwith Stx2 or LPS alone. Monocyte chemoattractants were inducedin the kidney, including monocyte chemoattractant protein 1(MCP-1/CCL2), macrophage inflammatory protein 1 ${alpha}$ (MIP-1 ${alpha}$ /CCL3),and RANTES (CCL5), in a pattern that was coincident with macrophageinfiltration as indicated by immunohistochemistry, protein,and RNA analyses. MCP-1 was the most abundant chemokine, MIP-1 ${alpha}$ was the least abundant, and RANTES levels were intermediate.Mice treated with MCP-1, MIP-1 ${alpha}$ , and RANTES neutralizing antibodieshad a significant decrease in Stx2 plus LPS-induced macrophageaccumulation in the kidney, indicating that these chemokinesare required for macrophage recruitment. Furthermore, mice exposedto these three neutralizing antibodies had decreased fibrindeposition in their kidneys, implying that macrophages contributeto the renal damage associated with HUS.

INTRODUCTION

Top

Introduction

Shiga toxins produced by enterohemorrhagic Escherichia coliare the causative agents of hemolytic-uremic syndrome (HUS),the primary cause of kidney failure in young children. HUS ischaracterized by hemolytic anemia, thrombocytopenia, and acuterenal failure. After colonization of the colonic epithelium,the bacteria secrete Shiga toxins (Stx1 and/or Stx2), whichtranslocate across the basolateral surface of the intestinalepithelium into the bloodstream. The Shiga toxins then travelthrough the systemic circulation to the kidney, where they causecellular damage by inhibiting protein synthesis in their targetcells (30). The degree of sensitivity of cells to Shiga toxinsdepends on the relative expression of the Stx-binding globotriaosylceramide(Gb₃) receptor on each cell type (21).

Previous reports indicate that Shiga toxins do not inhibit proteinsynthesis in human monocytes in vitro but rather induce monocytesto secrete the cytokines tumor necrosis factor alpha (TNF- ${alpha}$ ),interleukin-1ß (IL-1ß), and IL-8 (5, 29,32). Production of these proinflammatory cytokines from monocytes,particularly TNF- ${alpha}$ and IL-1ß, has been shown to causeincreased expression of the Gb₃ receptor on endothelial cellsso that more Stx is able to bind, further exacerbating the diseaseprocess (13, 14, 31). Further evidence that monocytes are involvedin the pathogenesis of HUS has been established by the analysisof HUS patient samples. Several studies have found increasedmonocyte-produced cytokines, specifically, IL-6, IL-8, and TNF- ${alpha}$ ,in the sera of HUS patients, indicating that monocytes/macrophagesare activated during the disease process. Additionally, detectionof IL-6, IL-8, and TNF- ${alpha}$ in the urine of HUS patients in higheramounts than in the serum indicates that these cytokines areproduced locally in the kidney (9, 10, 33). Evidence of monocyteinfiltration into the kidney during HUS was demonstrated bydetection of significantly elevated levels of a potent monocytechemoattractant, monocyte chemoattractant protein 1 (MCP-1),in the urine of HUS patients (33). In addition, biopsy specimensclearly showed the increased presence of macrophages in HUSpatient kidneys (33). These data point to the monocyte/macrophageas an important inflammatory mediator in the progression ofHUS.

Thus, we have investigated the role of macrophages in a murinemodel of HUS. We show that macrophages are recruited to thekidneys of Stx2- and/or lipopolysaccharide (LPS)-treated micein a time-dependent manner and that this recruitment occursvia the release of the chemokines MCP-1 (CCL2), RANTES (CCL5),and macrophage inflammatory protein 1 ${alpha}$ (MIP-1 ${alpha}$ ) (CCL3) in thekidney. Moreover, neutralization of these chemokines causeddecreased renal fibrin deposition, indicating that macrophages,their chemokines, or both are involved in HUS-associated kidneydamage.

MATERIALS AND METHODS

Top

Materials and Methods

Shiga toxin purification. Stx2 was purified by immunoaffinity chromatography from celllysates (kindly provided by Alison O'Brien) of E. coli DH5 ${alpha}$ containingthe Stx2-producing pJES120 plasmid (17). Briefly, Stx2 was purifiedusing 11E10 antibody (26) immobilized using an AminoLink Pluskit (Pierce Biotechnology, Inc., Rockford, IL) according tothe manufacturer's instructions. Endotoxin was removed usingDe-toxi-Gel (Pierce Biotechnology) per the manufacturer's instructions.Stx2 was negative for endotoxin by a Limulus amebocyte lysatePyrotell assay (sensitivity of 0.06 endotoxin units/ml). Stx2purity was assessed by sodium dodecyl sulfate-polyacrylamidegel electrophoresis, and Stx2 activity was measured by use ofa Vero cell cytotoxicity assay. Although Stx1 and Stx2 haveidentical enzymatic functions, Stx2 was chosen for these experimentsbecause Stx2 is more frequently associated with clinical isolatesof E. coli O157:H7 from HUS patients than Stx1 (20, 22).

Animal studies. Male C57BL/6 mice weighing 22 to 24 g were purchased from CharlesRiver Laboratories (Wilmington, MA). Mice were injected intraperitoneallywith a low sublethal dose of LPS at 300 µg/kg of bodyweight (O55:B5; Sigma Chemical Co., St. Louis, MO), 250 ng/kgStx2 (two times the 50% lethal dose), or a combination of both.These doses were chosen based on previous studies with our mousemodel of HUS (11). At 0, 2, 4, 6, 8, 12, 24, 48, and 72 h afterinjection, two mice per time point were euthanized by CO₂ inhalationand kidneys were removed. Kidneys collected at 0 h and kidneysfrom saline-injected mice were used for controls. Kidneys wereprocessed for RNA, protein, and immunohistochemistry as describedbelow. Time course experiments were repeated at least twice.All animal procedures were done in accordance with Universityof Virginia Animal Care and Use Committee policies.

Real-time reverse transcription-PCR (RT-PCR). One-half mouse kidney was stored in 2 ml RNALater (Ambion, Austin,TX) at 4°C until RNA extraction. Total RNA was isolatedusing an RNeasy Midi kit (QIAGEN, Santa Clarita, CA) accordingto the manufacturer's instructions. Quantitative real-time PCRwas performed using an iScript cDNA synthesis kit, iQ SYBR greensupermix, and a MiniOpticon thermal cycler (Bio-Rad, Hercules,CA) according to the manufacturer's instructions. Data wereevaluated using Opticon Monitor 3 software (Bio-Rad). Data werenormalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase)and calculated as the change (n-fold) in value of the treatmentgroups over the control (saline-injected) groups according tothe 2^–Ct method (12a). The following primer sequenceswere used: GAPDH sense, AGAATGGGAAGCTTGTCATC; GAPDH antisense,GTAGACTCCACGACATACTC (melting temperature [T_m], 61.4°C);MCP-1 sense, TTGACCCGTAAATCTGAAGC; MCP-1 antisense, CGAGTCACACTAGTTCACTG(T_m, 58.1°C); RANTES sense, TCGTGCCCACGTCAAGGAGTATTT; RANTESantisense, ACTAGAGCAAGCGATGACAGGGAA (T_m, 62.7°C); MIP-1 ${alpha}$ sense, TGTTTGCTGCCAAGTAGCCACATC; and MIP-1 ${alpha}$ antisense, AACAGTGTGAACAACTGGGAGGGA(T_m, 61.3°C).

Protein analysis. After removal of mouse kidneys, one-half kidney was placed into1 ml cold tissue homogenization buffer (50 mM HEPES, 1% TritonX-100, 1:100 dilution protease inhibitor cocktail [Sigma ChemicalCo.]). Kidneys were homogenized with a Dounce tissue grinderand sonicated using a Branson Sonifier 250 with output controlat 3 for 10 s. After incubation on ice for 30 min, homogenateswere centrifuged at 13,500 rpm for 10 min at 4°C. Supernatantswere removed from the homogenates and stored at –70°Cuntil protein analysis by enzyme-linked immunosorbent assay(ELISA). Chemokine protein was quantified using DuoSet ELISAdevelopment kits (R&D Systems, Minneapolis, MN) accordingto the manufacturer's instructions. Total kidney protein wasquantified via a bicinchoninic acid protein assay (Pierce Biotechnology)of kidney homogenate supernatants. Chemokine protein levelswere expressed as picograms of chemokine per microgram of totalkidney protein.

Immunohistochemistry. One-half kidney was fixed in 4% paraformaldehyde for 24 h, processed,and embedded in paraffin. Sections were cut at 3 µm thickand placed onto charged slides. For macrophage staining, a monoclonalrat anti-mouse monocyte/macrophage F4/80 clone antibody (Serotec,Raleigh, NC) was employed. Macrophages were counted in 10 fieldsof cortex per kidney at x400 magnification, and an average wascalculated for each mouse. Other antibodies used were polyclonalrabbit anti-mouse RANTES (Serotec), polyclonal rabbit anti-mouseMIP-1 ${alpha}$ (Serotec), and polyclonal goat anti-mouse MCP-1 (R&DSystems). For all immunohistochemistry staining, an avidin-biotinhorseradish peroxidase system (Vector Laboratories, Burlingame,CA) was used with diaminobenzidine to give a brown-colored endproduct at the site of detection. Sections were then counterstainedin hematoxylin, dehydrated, and mounted. Martius yellow-brilliantcrystal scarlet-aniline blue differential staining was performedas previously described (28). Martius yellow and phosphotungsticacid in alcoholic solution stain red blood cells, brilliantcrystal scarlet stains muscle and mature fibrin, and anilineblue stains collagen. Glomeruli positive for fibrin stainingwere quantified by counting three sets of 20 glomeruli per slideand averaging the percent positive for fibrin at each time point.

Chemokine neutralization. Monoclonal rat anti-mouse RANTES (clone 53405), polyclonal goatanti-mouse MIP-1 ${alpha}$ , and polyclonal goat anti-mouse MCP-1 functionneutralizing antibodies and immunoglobulin G (IgG) isotype controls(R&D Systems) were all administered intravenously via tailvein injection at 25 µg per mouse 6 h prior to intraperitonealadministration of 225 ng/kg Stx2 and 300 µg/kg LPS. Inthe case when more than one antibody was given, mice received25 µg of each neutralizing antibody mixed together; therefore,mice injected with all three neutralizing antibodies received75 µg of antibodies total. Additionally, rat IgG and goatIgG control antibodies were mixed together at 25 µg andinjected into mice for controls where more than one neutralizingantibody was used. Antibody doses were chosen based on previouswork by other groups (4). Kidneys were processed for immunohistochemistryas described above. Kidney sections of mice treated with antibodieswere evaluated for immune complex deposition according to themethod described by McMahon et al., and it was determined thatimmune complexes were not deposited in the kidneys of thesemice (16).

Statistical analysis. Data are expressed as means ± standard deviations (SD).Statistical analyses were performed using a two-sample t test.A P value of <0.05 was considered significant.

RESULTS

Top

Results

Macrophages infiltrate the kidneys of Stx2- and/or LPS-injected mice. C57BL/6 mice were injected with 250 ng/kg Stx2, 300 µg/kgLPS, or a combination of the two agents and sacrificed throughouta 72-h time course. This time course was chosen because diseaseprogression to death in this model is typically 3 to 4 days(11). F4/80 staining of kidney sections showed an increase inmacrophages in the kidney after Stx2 and/or LPS injection (Fig.1). Macrophages were located primarily in the cortex in theinterstitial space between the tubules and the capillaries andwere also found in the medulla. No evidence of glomerular macrophageswas found in any samples. Macrophage accumulation was evidentbeginning at 2 h after injection and was the greatest at 48h after injection of either or both agents (Fig. 2). Treatmentof mice with both Stx2 and LPS produced greater macrophage influxthan either treatment alone. The chronology of macrophage infiltrationsuggests the induction of one or more chemoattractants, firstearly in the time course, as indicated by the peak in macrophagesat 2 to 4 h, and then later in the time course, as indicatedby the peaks at 12 and 48 h. Therefore, the temporal inductionof monocyte-specific chemokines was investigated.

View larger version (131K):
[in this window]
[in a new window]

FIG. 1. Macrophages are recruited to the kidneys of Stx2- and/or LPS-injected mice. Kidney sections were stained for macrophages (F4/80) at 48 h after injection of (A) saline, (B) Stx2, (C) LPS, or (D) Stx2 plus LPS. The dark brown-black color indicates F4/80 staining; arrows indicate select areas of macrophage accumulation. Images are representative of three to five mice. All images were taken at x400 magnification.

View larger version (24K):
[in this window]
[in a new window]

FIG. 2. Renal macrophage accumulation in LPS-, Stx2-, and Stx2 plus LPS-injected mice throughout the 72-h time course. Data are from duplicate experiments. Macrophages were quantified as described in Materials and Methods, and data are averages (±SD) from three mice. *, P $≤$ 0.05 (level increased over that of zero hour control).

Stx2 and/or LPS induces renal macrophage chemokine mRNA expression. Investigation of the chemotactic factors involved in Stx2- and/orLPS-induced monocyte recruitment led to the determination thatMCP-1, MIP-1 ${alpha}$ , and RANTES were all elevated in kidneys in themouse model studied. Chemokine mRNA was determined using quantitativereal-time RT-PCR as stated in Materials and Methods. MCP-1 mRNAin the kidney peaked at 2 h after injection of Stx2, LPS, orboth (Fig. 3A). LPS and Stx2 plus LPS induced 229-fold and 346-foldincreases, respectively, in MCP-1 mRNA at 2 h, which graduallydeclined until 24 h postinjection. Stx2 induced only a 13-foldincrease in MCP-1 mRNA at 2 h compared to control levels, andmRNA was not elevated at any other time point. RANTES mRNA peakedlater than MCP-1 mRNA levels (Fig. 3B). Stx2 plus LPS induceda 138-fold increase in RANTES mRNA at 6 h and a 127-fold increasein RANTES mRNA at 8 h subsequent to injection. LPS alone induceda 112-fold increase in RANTES mRNA at 6 h postinjection. Injectionof mice with Stx2 alone induced a sixfold increase in RANTESmRNA at 48 h postinjection. The timing of MIP-1 ${alpha}$ mRNA inductionwas similar to that of MCP-1 in all treatment groups (Fig. 3C).LPS and Stx2 plus LPS induced a 144-fold increase and a 135-foldincrease, respectively, in MIP-1 ${alpha}$ mRNA at 2 h postinjection.Stx2 alone did not cause a significant increase in renal MIP-1 ${alpha}$ mRNA levels.

View larger version (18K):
[in this window]
[in a new window]

FIG. 3. Chemokine mRNA is induced in the kidneys of Stx2- and/or LPS-injected mice. Levels of (A) MCP-1, (B) RANTES, and (C) MIP-1 ${alpha}$ in mice injected with Stx2 and/or LPS were determined by quantitative real-time RT-PCR. Data are expressed as increase (n-fold) in mRNA over the 72-h time course compared to saline controls (see Materials and Methods for details). Data are representative of two mice per time point, and PCR was performed three times for each chemokine and mouse.

Stx2 and/or LPS causes increased renal macrophage chemokine protein expression. Increased renal protein corresponded to the elevated mRNA afterStx2 and/or LPS injection. MCP-1 was highly elevated in kidneytissue homogenate supernatants, as determined by ELISA, witha peak expression at 2 h after Stx2 and/or LPS injection, whichslowly diminished to control levels by 72 h (Fig. 4A). RANTESprotein peaked at 4 to 12 h after administration of Stx2 and/orLPS (Fig. 4B). MIP-1 ${alpha}$ renal protein expression was similar tothat of MCP-1, as MIP-1 ${alpha}$ peaked at 2 h after Stx2 and/or LPSadministration and returned to saline levels by 48 h postinjection(Fig. 4C). Additionally, MIP-1 ${alpha}$ , MCP-1, and RANTES renal proteinlevels were greater in mice injected with the combination ofStx2 plus LPS than in mice injected with either agent alone.Notably, the most abundant chemokine was MCP-1, with a peakrenal protein level at 1,121.8 ± 165.6 pg/µg, comparedto 503.5 ± 112.4 pg/µg RANTES and 126.6 ±8.6 pg/µg MIP-1 ${alpha}$ in mice exposed to Stx2 plus LPS.

View larger version (21K):
[in this window]
[in a new window]

FIG. 4. Renal chemokine protein is elevated after Stx2 and/or LPS injection. Levels of (A) MCP-1 protein, (B) RANTES protein, and (C) MIP-1 ${alpha}$ protein in the kidneys of mice injected with Stx2 and/or LPS were determined by ELISA. Chemokine levels were normalized to total kidney protein and are expressed as picograms of chemokine per microgram of total protein. Data are from duplicate experiments and are the averages (±SD) from two mice. *, P $≤$ 0.05 (level increased over that of zero hour control); #, P $≤$ 0.05 (Stx2 plus LPS level increased over that of LPS alone).

Immunohistochemistry confirmed protein expression and determinedthe location of the chemokine expression in the kidney. MCP-1protein was present only in the renal cortex and had a punctatestaining pattern in the inner portion of proximal tubules (Fig.5A and B). RANTES protein exhibited a diffuse staining patternof the tubules throughout the medulla and cortex (Fig. 5C and D).MIP-1 ${alpha}$ staining patterns were similar to that of MCP-1, revealingpunctate staining of the inner portion of the tubules in boththe medulla and the cortex (Fig. 5E and F). It is noteworthythat no staining was found in the glomeruli for any of the chemokines.

View larger version (130K):
[in this window]
[in a new window]

FIG. 5. Chemokines are localized to the tubules of kidneys of Stx2 plus LPS-injected mice. Shown are renal MCP-1 immunohistochemistry of mice injected with (A) saline or (B) Stx2 plus LPS (2 h postinjection for the latter), renal RANTES immunohistochemistry of mice injected with (C) saline or (D) Stx2 plus LPS (6 h postinjection for the latter), and renal MIP-1 ${alpha}$ immunohistochemistry of mice injected with (E) saline or (F) Stx2 plus LPS (2 h postinjection for the latter). The brown color and the arrows indicate positive chemokine staining. Data are representative of three mice. Experiments were performed in duplicate. All images were taken at x400 magnification.

Chemokine neutralization in Stx2-plus-LPS-injected mice reduces renal macrophage infiltration and fibrin deposition. In order to determine which chemokines were involved in theinduced macrophage infiltration, mice were injected intravenouslywith 25 µg of each neutralizing antibody to MCP-1, MIP-1 ${alpha}$ ,and/or RANTES 6 h prior to intraperitoneal injection of Stx2plus LPS. At 48 h after Stx2 plus LPS injection, kidneys wereremoved and macrophages were counted (Fig. 6A). Administrationof anti-MCP-1, anti-MIP-1 ${alpha}$ , or anti-RANTES antibody alone resultedin a modest reduction (21 to 30%) in infiltrating macrophagescompared to levels for IgG controls. Similarly, administrationof anti-MIP-1 ${alpha}$ plus anti-RANTES or anti-MCP-1 plus anti-MIP-1 ${alpha}$ antibodies resulted in 22.7% and 28.7% reduction in renal macrophages,respectively. However, administration of anti-MCP-1 plus anti-RANTESresulted in a 67.9% ± 14.4% reduction in macrophage recruitment.Finally, administration of all three antibodies resulted ina 71.9% ± 17.8% decrease in macrophage infiltration.The anti-MCP-1 plus anti-RANTES and the anti-MCP-1 plus anti-RANTESplus anti-MIP-1 ${alpha}$ groups both had a statistically significantdecrease in renal macrophages compared to levels for the othertreatment groups. These data indicate that MCP-1 and RANTESare the major contributors to renal macrophage accumulationin this mouse model. Additionally, mice treated with all threechemokine neutralizing antibodies and injected with only Stx2had a greater than 80% reduction in infiltrating renal macrophages(data not shown).

View larger version (102K):
[in this window]
[in a new window]

FIG. 6. Chemokine neutralization in mice injected with Stx2 plus LPS inhibits macrophage infiltration and fibrin deposition. Mice were injected with neutralizing antibodies 6 h prior to Stx2 plus LPS injection, and kidneys were removed 48 h after Stx2 plus LPS injection. (A) Inhibition of macrophage recruitment to the kidneys of mice with chemokine-neutralizing antibodies (25 µg of each antibody alone or mixed as indicated). Data are percent inhibition of macrophage accumulation compared to the level for the IgG control (25 µg rat IgG and 25 µg goat IgG)-injected mice. Data are the averages from three to five mice and represent two separate experiments. *, P < 0.001 (inhibition greater than that for the first five treatment groups). (B) Fibrin deposition in the glomeruli of mice injected with Stx2 plus LPS and neutralizing antibodies to MCP-1, RANTES, and/or MIP-1 ${alpha}$ (25 µg of each antibody alone or mixed as indicated). Data are the averages from three to five mice and represent two separate experiments. *, P < 0.01 (increased over level for the IgG control [25 µg rat IgG and 25 µg goat IgG]). Also shown is differential staining for fibrin deposition in the glomeruli (arrow) and renal cortex (arrowhead) of mice 48 h after Stx2 plus LPS injection and injection of (C) IgG control antibodies or (D) neutralizing antibodies to MCP-1, RANTES, and MIP-1 ${alpha}$ . Bright red staining indicates fibrin deposition, and red blood cells are stained yellow. Both images were taken at x200 magnification.

In addition to macrophage staining, kidney sections from thesechemokine-neutralized mice were also stained for fibrin deposition.Increased fibrin deposition is an indication of kidney damageand decreased renal filtration. After sections were stainedusing the Martius yellow-brilliant crystal scarlet-aniline bluedifferential stain as described in Materials and Methods, micewere evaluated according to the glomeruli positive for fibrinas indicated by bright red staining. There was a significantreduction in fibrin deposition in the glomeruli and in the cortexwhen all three chemokine-neutralizing antibodies were administeredprior to Stx2 plus LPS injection of the mice (Fig. 6B). Thereduction in fibrin deposition was evident not only in the glomerulibut also in the cortex and medulla of mice administered allthree chemokine-neutralizing antibodies (Fig. 6C and D). Thisdecrease in fibrin deposition as well as the decrease in macrophageinfiltration suggests that macrophages are involved, at leastin part, in causing the kidney damage associated with HUS.

DISCUSSION

Top

Discussion

We have previously established a mouse model of HUS that exhibitsthe triad of hemolytic anemia, thrombocytopenia, and renal failurethat defines the disease (11). In the present report, we usethis mouse model to investigate the role of the macrophage duringthe development of HUS. We describe here the progression ofmacrophage infiltration into the kidneys of mice injected withStx2, LPS, or both, as well as the associated chemokines andtheir relevance in this model. Furthermore, we show that thecombination of Stx2 plus LPS induces a greater influx of macrophagesand higher chemokine expression in the kidney than either Stx2alone or LPS alone. These data indicate that these two agentsproduce an additive effect when administered together.

After determining that macrophages were recruited to the kidneysof mice injected with Stx2 and/or LPS in a time-dependent manner,we sought to determine the chemokines responsible for this infiltration.Previous studies have shown that mice or rats injected withLPS have increased macrophage infiltration and increased levelsof renal MCP-1 and RANTES (6, 36). Additionally, mouse modelsof sepsis, a disease in which macrophages are involved, haveshown increased levels of MCP-1, RANTES, and MIP-1 ${alpha}$ in organsincluding the kidney, liver, and lungs (15, 18). Analysis ofour model revealed that these three chemokines were upregulatedin the kidneys after Stx2 and/or LPS injection. It is noteworthythat while administration of Stx2 alone did not greatly alterrenal mRNA levels of any chemokine, it did cause significantlyincreased protein expression. It is likely that posttranslationalcontrol or storage of the chemokines in renal cells allows forrapid secretion of these chemokines upon exposure to Stx2 withoutupregulation of gene transcription (3, 23, 24). These data suggestthat Stx2 and LPS induce renal cells to produce MCP-1 and MIP-1 ${alpha}$ ,resulting in the initial macrophage infiltration, and to produceRANTES later in the time course, resulting in the continuedmacrophage infiltration of the kidney.

Immunohistochemistry for these chemokines revealed that allthree chemokines were located in tubular cells and that nonewere in the glomeruli. These data correlated with the fact thatmacrophages were located only in the tubular interstitium anddid not infiltrate the glomeruli. It is not surprising thatthese chemokines are produced by tubular epithelial cells, consideringprevious studies documenting the ability of these cells to producevarious cytokines and chemokines, including MCP-1, RANTES, andMIP-1 ${alpha}$ (1, 37). Additionally, renal tubular cells have been shownto be a primary target of Stx in animal models and in cell culture,inducing both apoptosis and cytokine secretion (8, 12, 19, 34,35).

MCP-1 and RANTES were the most abundant renal chemokines inducedby Stx2 plus LPS. Thus, it was hypothesized that MCP-1 and RANTESwere the primary inducers of the Stx2 plus LPS-induced renalmacrophage infiltration. To test this hypothesis, mice weretreated with neutralizing antibodies to MCP-1, RANTES, and MIP-1 ${alpha}$ in all possible combinations prior to Stx2 plus LPS injection.A previous study by Fillion et al. demonstrated that neutralizingantibodies to MCP-1, RANTES, and MIP-1 ${alpha}$ reduced macrophages inthe lungs of pneumococcus-infected mice by 33% only when administeredtogether, not separately (4). In contrast, we found that administrationof these chemokines separately resulted in a modest reduction(20 to 30%) in Stx2 plus LPS-induced renal macrophage accumulation.Furthermore, neutralizing both RANTES and MCP-1 proved to beas effective at significantly reducing renal macrophages asneutralizing RANTES, MCP-1, and MIP-1 ${alpha}$ . These data are a strongindication that MCP-1 and RANTES are the primary chemoattractantsinvolved in Stx2 plus LPS-induced renal macrophage infiltration.A complete inhibition of macrophage infiltration was not observed;however, it is likely that, at the doses used, the chemokinesare not completely neutralized by the antibodies. Alternatively,other chemokines may be involved in the macrophage infiltrationseen in our model. Of note, gene array analysis done by ourlab has shown that the RNA of the macrophage chemokine IP-10/CXCL10is upregulated in mouse kidneys (see the supplementary materialin reference 11). The role of this chemokine in our HUS mousemodel is currently under investigation.

To determine whether macrophage inhibition had any effect onkidney function, kidneys from mice administered anti-MCP-1,anti-RANTES, and anti-MIP-1 ${alpha}$ antibodies prior to Stx2 plus LPSinjection were evaluated for fibrin deposition. Fibrin-richthrombi in the renal microvasculature are associated with HUSand diminished kidney function in these patients (2, 27, 30).Furthermore, it has been shown, by using a model of experimentalglomerulonephritis in the rabbit, that macrophages can induceglomerular fibrin deposition (7). We have also shown previouslyin our HUS mouse model that an increase in renal fibrin depositionis associated with an increase in serum creatinine and a decreasein kidney function (11). Using a differential stain for fibrin,we found that mice administered all three chemokine-neutralizingantibodies and Stx2 plus LPS had significantly decreased glomerularand total kidney fibrin deposition. This likely indicates thatthe recruited macrophages or the chemokines RANTES, MIP-1 ${alpha}$ , andMCP-1 contribute to diminished renal function and to the pathologyof the HUS disease state. In support of this conclusion, Palermoet al. found that depleting mice of splenic and liver macrophagesreduced Stx2 plus LPS-induced mortality (25).

In summary, we have demonstrated that macrophages infiltratethe kidneys of an HUS mouse model primarily via the chemokinesMCP-1 and RANTES. Currently, we are investigating whether itis the macrophages or the chemokines that contribute to theincreased fibrin deposition found in our model. Additionally,we are evaluating whether depletion of macrophages or monocytesfrom the circulation will have any effect on renal disease andsurvival. Although we have not specifically investigated theusefulness of chemokine neutralization as a therapy for HUSin a more clinical setting, experiments that would test theefficacy of such treatment after Stx2 and LPS exposure are apriority for our laboratory. Nonetheless, the data presentedhere suggest that neutralizing these macrophage chemokines maybe a useful therapeutic for ameliorating the kidney damage associatedwith HUS.

ACKNOWLEDGMENTS

This research was supported by funding from USPHS grant AI24431(T.G.O.).

FOOTNOTES

* Corresponding author. Mailing address: Division of Nephrology, University of Virginia, Box 800133, 1 Lane Road OMS 5815, Charlottesville, VA 22903. Phone: (434) 982-1063. Fax: (434) 924-5848. E-mail: to3e{at}virginia.edu.

Published ahead of print on 12 January 2007.

Editor: A. D. O'Brien

REFERENCES

Top