This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Keepers, T. R.
Right arrow Articles by Obrig, T. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Keepers, T. R.
Right arrow Articles by Obrig, T. G.

 Previous Article  |  Next Article 

Infection and Immunity, March 2007, p. 1229-1236, Vol. 75, No. 3
0019-9567/07/$08.00+0     doi:10.1128/IAI.01663-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Monocyte Chemoattractant Protein 1, Macrophage Inflammatory Protein 1{alpha}, and RANTES Recruit Macrophages to the Kidney in a Mouse Model of Hemolytic-Uremic Syndrome{triangledown}

Tiffany R. Keepers, Lisa K. Gross, and Tom G. Obrig*

Division of Nephrology, University of Virginia, Box 800133, 1 Lane Road OMS 5815, Charlottesville, Virginia 22903

Received 17 October 2006/ Returned for modification 22 November 2006/ Accepted 22 December 2006


arrow
ABSTRACT
 
The macrophage has previously been implicated in contributing to the renal inflammation associated with hemolytic-uremic syndrome (HUS). However, there is currently no in vivo model detailing the contribution of the renal macrophage to the kidney disease associated with HUS. Therefore, renal macrophage recruitment and inhibition of infiltrating renal macrophages were evaluated in an established HUS mouse model. Macrophage recruitment to the kidney was evident by immunohistochemistry 2 h after administration of purified Stx2 and peaked at 48 h postinjection. Mice administered a combination of Stx2 and lipopolysaccharide (LPS) showed increased macrophage recruitment to the kidney compared to mice treated with Stx2 or LPS alone. Monocyte chemoattractants were induced in the kidney, including monocyte chemoattractant protein 1 (MCP-1/CCL2), macrophage inflammatory protein 1{alpha} (MIP-1{alpha}/CCL3), and RANTES (CCL5), in a pattern that was coincident with macrophage infiltration as indicated by immunohistochemistry, protein, and RNA analyses. MCP-1 was the most abundant chemokine, MIP-1{alpha} was the least abundant, and RANTES levels were intermediate. Mice treated with MCP-1, MIP-1{alpha}, and RANTES neutralizing antibodies had a significant decrease in Stx2 plus LPS-induced macrophage accumulation in the kidney, indicating that these chemokines are required for macrophage recruitment. Furthermore, mice exposed to these three neutralizing antibodies had decreased fibrin deposition in their kidneys, implying that macrophages contribute to the renal damage associated with HUS.


arrow
INTRODUCTION
 
Shiga toxins produced by enterohemorrhagic Escherichia coli are the causative agents of hemolytic-uremic syndrome (HUS), the primary cause of kidney failure in young children. HUS is characterized by hemolytic anemia, thrombocytopenia, and acute renal failure. After colonization of the colonic epithelium, the bacteria secrete Shiga toxins (Stx1 and/or Stx2), which translocate across the basolateral surface of the intestinal epithelium into the bloodstream. The Shiga toxins then travel through the systemic circulation to the kidney, where they cause cellular damage by inhibiting protein synthesis in their target cells (30). The degree of sensitivity of cells to Shiga toxins depends on the relative expression of the Stx-binding globotriaosylceramide (Gb3) receptor on each cell type (21).

Previous reports indicate that Shiga toxins do not inhibit protein synthesis in human monocytes in vitro but rather induce monocytes to secrete the cytokines tumor necrosis factor alpha (TNF-{alpha}), interleukin-1ß (IL-1ß), and IL-8 (5, 29, 32). Production of these proinflammatory cytokines from monocytes, particularly TNF-{alpha} and IL-1ß, has been shown to cause increased expression of the Gb3 receptor on endothelial cells so that more Stx is able to bind, further exacerbating the disease process (13, 14, 31). Further evidence that monocytes are involved in the pathogenesis of HUS has been established by the analysis of HUS patient samples. Several studies have found increased monocyte-produced cytokines, specifically, IL-6, IL-8, and TNF-{alpha}, in the sera of HUS patients, indicating that monocytes/macrophages are activated during the disease process. Additionally, detection of IL-6, IL-8, and TNF-{alpha} in the urine of HUS patients in higher amounts than in the serum indicates that these cytokines are produced locally in the kidney (9, 10, 33). Evidence of monocyte infiltration into the kidney during HUS was demonstrated by detection of significantly elevated levels of a potent monocyte chemoattractant, monocyte chemoattractant protein 1 (MCP-1), in the urine of HUS patients (33). In addition, biopsy specimens clearly showed the increased presence of macrophages in HUS patient kidneys (33). These data point to the monocyte/macrophage as an important inflammatory mediator in the progression of HUS.

Thus, we have investigated the role of macrophages in a murine model of HUS. We show that macrophages are recruited to the kidneys of Stx2- and/or lipopolysaccharide (LPS)-treated mice in a time-dependent manner and that this recruitment occurs via the release of the chemokines MCP-1 (CCL2), RANTES (CCL5), and macrophage inflammatory protein 1{alpha} (MIP-1{alpha}) (CCL3) in the kidney. Moreover, neutralization of these chemokines caused decreased renal fibrin deposition, indicating that macrophages, their chemokines, or both are involved in HUS-associated kidney damage.


arrow
MATERIALS AND METHODS
 
Shiga toxin purification. Stx2 was purified by immunoaffinity chromatography from cell lysates (kindly provided by Alison O'Brien) of E. coli DH5{alpha} containing the Stx2-producing pJES120 plasmid (17). Briefly, Stx2 was purified using 11E10 antibody (26) immobilized using an AminoLink Plus kit (Pierce Biotechnology, Inc., Rockford, IL) according to the manufacturer's instructions. Endotoxin was removed using De-toxi-Gel (Pierce Biotechnology) per the manufacturer's instructions. Stx2 was negative for endotoxin by a Limulus amebocyte lysate Pyrotell assay (sensitivity of 0.06 endotoxin units/ml). Stx2 purity was assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and Stx2 activity was measured by use of a Vero cell cytotoxicity assay. Although Stx1 and Stx2 have identical enzymatic functions, Stx2 was chosen for these experiments because Stx2 is more frequently associated with clinical isolates of E. coli O157:H7 from HUS patients than Stx1 (20, 22).

Animal studies. Male C57BL/6 mice weighing 22 to 24 g were purchased from Charles River Laboratories (Wilmington, MA). Mice were injected intraperitoneally with a low sublethal dose of LPS at 300 µg/kg of body weight (O55:B5; Sigma Chemical Co., St. Louis, MO), 250 ng/kg Stx2 (two times the 50% lethal dose), or a combination of both. These doses were chosen based on previous studies with our mouse model of HUS (11). At 0, 2, 4, 6, 8, 12, 24, 48, and 72 h after injection, two mice per time point were euthanized by CO2 inhalation and kidneys were removed. Kidneys collected at 0 h and kidneys from saline-injected mice were used for controls. Kidneys were processed for RNA, protein, and immunohistochemistry as described below. Time course experiments were repeated at least twice. All animal procedures were done in accordance with University of Virginia Animal Care and Use Committee policies.

Real-time reverse transcription-PCR (RT-PCR). One-half mouse kidney was stored in 2 ml RNALater (Ambion, Austin, TX) at 4°C until RNA extraction. Total RNA was isolated using an RNeasy Midi kit (QIAGEN, Santa Clarita, CA) according to the manufacturer's instructions. Quantitative real-time PCR was performed using an iScript cDNA synthesis kit, iQ SYBR green supermix, and a MiniOpticon thermal cycler (Bio-Rad, Hercules, CA) according to the manufacturer's instructions. Data were evaluated using Opticon Monitor 3 software (Bio-Rad). Data were normalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and calculated as the change (n-fold) in value of the treatment groups over the control (saline-injected) groups according to the 2{Delta}{Delta}Ct method (12a). The following primer sequences were used: GAPDH sense, AGAATGGGAAGCTTGTCATC; GAPDH antisense, GTAGACTCCACGACATACTC (melting temperature [Tm], 61.4°C); MCP-1 sense, TTGACCCGTAAATCTGAAGC; MCP-1 antisense, CGAGTCACACTAGTTCACTG (Tm, 58.1°C); RANTES sense, TCGTGCCCACGTCAAGGAGTATTT; RANTES antisense, ACTAGAGCAAGCGATGACAGGGAA (Tm, 62.7°C); MIP-1{alpha} sense, TGTTTGCTGCCAAGTAGCCACATC; and MIP-1{alpha} antisense, AACAGTGTGAACAACTGGGAGGGA (Tm, 61.3°C).

Protein analysis. After removal of mouse kidneys, one-half kidney was placed into 1 ml cold tissue homogenization buffer (50 mM HEPES, 1% Triton X-100, 1:100 dilution protease inhibitor cocktail [Sigma Chemical Co.]). Kidneys were homogenized with a Dounce tissue grinder and sonicated using a Branson Sonifier 250 with output control at 3 for 10 s. After incubation on ice for 30 min, homogenates were centrifuged at 13,500 rpm for 10 min at 4°C. Supernatants were removed from the homogenates and stored at –70°C until protein analysis by enzyme-linked immunosorbent assay (ELISA). Chemokine protein was quantified using DuoSet ELISA development kits (R&D Systems, Minneapolis, MN) according to the manufacturer's instructions. Total kidney protein was quantified via a bicinchoninic acid protein assay (Pierce Biotechnology) of kidney homogenate supernatants. Chemokine protein levels were expressed as picograms of chemokine per microgram of total kidney protein.

Immunohistochemistry. One-half kidney was fixed in 4% paraformaldehyde for 24 h, processed, and embedded in paraffin. Sections were cut at 3 µm thick and placed onto charged slides. For macrophage staining, a monoclonal rat anti-mouse monocyte/macrophage F4/80 clone antibody (Serotec, Raleigh, NC) was employed. Macrophages were counted in 10 fields of cortex per kidney at x400 magnification, and an average was calculated for each mouse. Other antibodies used were polyclonal rabbit anti-mouse RANTES (Serotec), polyclonal rabbit anti-mouse MIP-1{alpha} (Serotec), and polyclonal goat anti-mouse MCP-1 (R&D Systems). For all immunohistochemistry staining, an avidin-biotin horseradish peroxidase system (Vector Laboratories, Burlingame, CA) was used with diaminobenzidine to give a brown-colored end product at the site of detection. Sections were then counterstained in hematoxylin, dehydrated, and mounted. Martius yellow-brilliant crystal scarlet-aniline blue differential staining was performed as previously described (28). Martius yellow and phosphotungstic acid in alcoholic solution stain red blood cells, brilliant crystal scarlet stains muscle and mature fibrin, and aniline blue stains collagen. Glomeruli positive for fibrin staining were quantified by counting three sets of 20 glomeruli per slide and averaging the percent positive for fibrin at each time point.

Chemokine neutralization. Monoclonal rat anti-mouse RANTES (clone 53405), polyclonal goat anti-mouse MIP-1{alpha}, and polyclonal goat anti-mouse MCP-1 function neutralizing antibodies and immunoglobulin G (IgG) isotype controls (R&D Systems) were all administered intravenously via tail vein injection at 25 µg per mouse 6 h prior to intraperitoneal administration of 225 ng/kg Stx2 and 300 µg/kg LPS. In the case when more than one antibody was given, mice received 25 µg of each neutralizing antibody mixed together; therefore, mice injected with all three neutralizing antibodies received 75 µg of antibodies total. Additionally, rat IgG and goat IgG control antibodies were mixed together at 25 µg and injected into mice for controls where more than one neutralizing antibody was used. Antibody doses were chosen based on previous work by other groups (4). Kidneys were processed for immunohistochemistry as described above. Kidney sections of mice treated with antibodies were evaluated for immune complex deposition according to the method described by McMahon et al., and it was determined that immune complexes were not deposited in the kidneys of these mice (16).

Statistical analysis. Data are expressed as means ± standard deviations (SD). Statistical analyses were performed using a two-sample t test. A P value of <0.05 was considered significant.


arrow
RESULTS
 
Macrophages infiltrate the kidneys of Stx2- and/or LPS-injected mice. C57BL/6 mice were injected with 250 ng/kg Stx2, 300 µg/kg LPS, or a combination of the two agents and sacrificed throughout a 72-h time course. This time course was chosen because disease progression to death in this model is typically 3 to 4 days (11). F4/80 staining of kidney sections showed an increase in macrophages in the kidney after Stx2 and/or LPS injection (Fig. 1). Macrophages were located primarily in the cortex in the interstitial space between the tubules and the capillaries and were also found in the medulla. No evidence of glomerular macrophages was found in any samples. Macrophage accumulation was evident beginning at 2 h after injection and was the greatest at 48 h after injection of either or both agents (Fig. 2). Treatment of mice with both Stx2 and LPS produced greater macrophage influx than either treatment alone. The chronology of macrophage infiltration suggests the induction of one or more chemoattractants, first early in the time course, as indicated by the peak in macrophages at 2 to 4 h, and then later in the time course, as indicated by the peaks at 12 and 48 h. Therefore, the temporal induction of monocyte-specific chemokines was investigated.


Figure 1
View larger version (131K):
[in this window]
[in a new window]

 
FIG. 1. Macrophages are recruited to the kidneys of Stx2- and/or LPS-injected mice. Kidney sections were stained for macrophages (F4/80) at 48 h after injection of (A) saline, (B) Stx2, (C) LPS, or (D) Stx2 plus LPS. The dark brown-black color indicates F4/80 staining; arrows indicate select areas of macrophage accumulation. Images are representative of three to five mice. All images were taken at x400 magnification.


Figure 2
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 2. Renal macrophage accumulation in LPS-, Stx2-, and Stx2 plus LPS-injected mice throughout the 72-h time course. Data are from duplicate experiments. Macrophages were quantified as described in Materials and Methods, and data are averages (±SD) from three mice. *, P ≤ 0.05 (level increased over that of zero hour control).

Stx2 and/or LPS induces renal macrophage chemokine mRNA expression. Investigation of the chemotactic factors involved in Stx2- and/or LPS-induced monocyte recruitment led to the determination that MCP-1, MIP-1{alpha}, and RANTES were all elevated in kidneys in the mouse model studied. Chemokine mRNA was determined using quantitative real-time RT-PCR as stated in Materials and Methods. MCP-1 mRNA in the kidney peaked at 2 h after injection of Stx2, LPS, or both (Fig. 3A). LPS and Stx2 plus LPS induced 229-fold and 346-fold increases, respectively, in MCP-1 mRNA at 2 h, which gradually declined until 24 h postinjection. Stx2 induced only a 13-fold increase in MCP-1 mRNA at 2 h compared to control levels, and mRNA was not elevated at any other time point. RANTES mRNA peaked later than MCP-1 mRNA levels (Fig. 3B). Stx2 plus LPS induced a 138-fold increase in RANTES mRNA at 6 h and a 127-fold increase in RANTES mRNA at 8 h subsequent to injection. LPS alone induced a 112-fold increase in RANTES mRNA at 6 h postinjection. Injection of mice with Stx2 alone induced a sixfold increase in RANTES mRNA at 48 h postinjection. The timing of MIP-1{alpha} mRNA induction was similar to that of MCP-1 in all treatment groups (Fig. 3C). LPS and Stx2 plus LPS induced a 144-fold increase and a 135-fold increase, respectively, in MIP-1{alpha} mRNA at 2 h postinjection. Stx2 alone did not cause a significant increase in renal MIP-1{alpha} mRNA levels.


Figure 3
View larger version (18K):
[in this window]
[in a new window]

 
FIG. 3. Chemokine mRNA is induced in the kidneys of Stx2- and/or LPS-injected mice. Levels of (A) MCP-1, (B) RANTES, and (C) MIP-1{alpha} in mice injected with Stx2 and/or LPS were determined by quantitative real-time RT-PCR. Data are expressed as increase (n-fold) in mRNA over the 72-h time course compared to saline controls (see Materials and Methods for details). Data are representative of two mice per time point, and PCR was performed three times for each chemokine and mouse.

Stx2 and/or LPS causes increased renal macrophage chemokine protein expression. Increased renal protein corresponded to the elevated mRNA after Stx2 and/or LPS injection. MCP-1 was highly elevated in kidney tissue homogenate supernatants, as determined by ELISA, with a peak expression at 2 h after Stx2 and/or LPS injection, which slowly diminished to control levels by 72 h (Fig. 4A). RANTES protein peaked at 4 to 12 h after administration of Stx2 and/or LPS (Fig. 4B). MIP-1{alpha} renal protein expression was similar to that of MCP-1, as MIP-1{alpha} peaked at 2 h after Stx2 and/or LPS administration and returned to saline levels by 48 h postinjection (Fig. 4C). Additionally, MIP-1{alpha}, MCP-1, and RANTES renal protein levels were greater in mice injected with the combination of Stx2 plus LPS than in mice injected with either agent alone. Notably, the most abundant chemokine was MCP-1, with a peak renal protein level at 1,121.8 ± 165.6 pg/µg, compared to 503.5 ± 112.4 pg/µg RANTES and 126.6 ± 8.6 pg/µg MIP-1{alpha} in mice exposed to Stx2 plus LPS.


Figure 4
View larger version (21K):
[in this window]
[in a new window]

 
FIG. 4. Renal chemokine protein is elevated after Stx2 and/or LPS injection. Levels of (A) MCP-1 protein, (B) RANTES protein, and (C) MIP-1 {alpha} protein in the kidneys of mice injected with Stx2 and/or LPS were determined by ELISA. Chemokine levels were normalized to total kidney protein and are expressed as picograms of chemokine per microgram of total protein. Data are from duplicate experiments and are the averages (±SD) from two mice. *, P ≤ 0.05 (level increased over that of zero hour control); #, P ≤ 0.05 (Stx2 plus LPS level increased over that of LPS alone).

Immunohistochemistry confirmed protein expression and determined the location of the chemokine expression in the kidney. MCP-1 protein was present only in the renal cortex and had a punctate staining pattern in the inner portion of proximal tubules (Fig. 5A and B). RANTES protein exhibited a diffuse staining pattern of the tubules throughout the medulla and cortex (Fig. 5C and D). MIP-1{alpha} staining patterns were similar to that of MCP-1, revealing punctate staining of the inner portion of the tubules in both the medulla and the cortex (Fig. 5E and F). It is noteworthy that no staining was found in the glomeruli for any of the chemokines.


Figure 5
View larger version (130K):
[in this window]
[in a new window]

 
FIG. 5. Chemokines are localized to the tubules of kidneys of Stx2 plus LPS-injected mice. Shown are renal MCP-1 immunohistochemistry of mice injected with (A) saline or (B) Stx2 plus LPS (2 h postinjection for the latter), renal RANTES immunohistochemistry of mice injected with (C) saline or (D) Stx2 plus LPS (6 h postinjection for the latter), and renal MIP-1{alpha} immunohistochemistry of mice injected with (E) saline or (F) Stx2 plus LPS (2 h postinjection for the latter). The brown color and the arrows indicate positive chemokine staining. Data are representative of three mice. Experiments were performed in duplicate. All images were taken at x400 magnification.

Chemokine neutralization in Stx2-plus-LPS-injected mice reduces renal macrophage infiltration and fibrin deposition. In order to determine which chemokines were involved in the induced macrophage infiltration, mice were injected intravenously with 25 µg of each neutralizing antibody to MCP-1, MIP-1{alpha}, and/or RANTES 6 h prior to intraperitoneal injection of Stx2 plus LPS. At 48 h after Stx2 plus LPS injection, kidneys were removed and macrophages were counted (Fig. 6A). Administration of anti-MCP-1, anti-MIP-1{alpha}, or anti-RANTES antibody alone resulted in a modest reduction (21 to 30%) in infiltrating macrophages compared to levels for IgG controls. Similarly, administration of anti-MIP-1{alpha} plus anti-RANTES or anti-MCP-1 plus anti-MIP-1{alpha} antibodies resulted in 22.7% and 28.7% reduction in renal macrophages, respectively. However, administration of anti-MCP-1 plus anti-RANTES resulted in a 67.9% ± 14.4% reduction in macrophage recruitment. Finally, administration of all three antibodies resulted in a 71.9% ± 17.8% decrease in macrophage infiltration. The anti-MCP-1 plus anti-RANTES and the anti-MCP-1 plus anti-RANTES plus anti-MIP-1{alpha} groups both had a statistically significant decrease in renal macrophages compared to levels for the other treatment groups. These data indicate that MCP-1 and RANTES are the major contributors to renal macrophage accumulation in this mouse model. Additionally, mice treated with all three chemokine neutralizing antibodies and injected with only Stx2 had a greater than 80% reduction in infiltrating renal macrophages (data not shown).


Figure 6
View larger version (102K):
[in this window]
[in a new window]

 
FIG. 6. Chemokine neutralization in mice injected with Stx2 plus LPS inhibits macrophage infiltration and fibrin deposition. Mice were injected with neutralizing antibodies 6 h prior to Stx2 plus LPS injection, and kidneys were removed 48 h after Stx2 plus LPS injection. (A) Inhibition of macrophage recruitment to the kidneys of mice with chemokine-neutralizing antibodies (25 µg of each antibody alone or mixed as indicated). Data are percent inhibition of macrophage accumulation compared to the level for the IgG control (25 µg rat IgG and 25 µg goat IgG)-injected mice. Data are the averages from three to five mice and represent two separate experiments. *, P < 0.001 (inhibition greater than that for the first five treatment groups). (B) Fibrin deposition in the glomeruli of mice injected with Stx2 plus LPS and neutralizing antibodies to MCP-1, RANTES, and/or MIP-1{alpha} (25 µg of each antibody alone or mixed as indicated). Data are the averages from three to five mice and represent two separate experiments. *, P < 0.01 (increased over level for the IgG control [25 µg rat IgG and 25 µg goat IgG]). Also shown is differential staining for fibrin deposition in the glomeruli (arrow) and renal cortex (arrowhead) of mice 48 h after Stx2 plus LPS injection and injection of (C) IgG control antibodies or (D) neutralizing antibodies to MCP-1, RANTES, and MIP-1{alpha}. Bright red staining indicates fibrin deposition, and red blood cells are stained yellow. Both images were taken at x200 magnification.

In addition to macrophage staining, kidney sections from these chemokine-neutralized mice were also stained for fibrin deposition. Increased fibrin deposition is an indication of kidney damage and decreased renal filtration. After sections were stained using the Martius yellow-brilliant crystal scarlet-aniline blue differential stain as described in Materials and Methods, mice were evaluated according to the glomeruli positive for fibrin as indicated by bright red staining. There was a significant reduction in fibrin deposition in the glomeruli and in the cortex when all three chemokine-neutralizing antibodies were administered prior to Stx2 plus LPS injection of the mice (Fig. 6B). The reduction in fibrin deposition was evident not only in the glomeruli but also in the cortex and medulla of mice administered all three chemokine-neutralizing antibodies (Fig. 6C and D). This decrease in fibrin deposition as well as the decrease in macrophage infiltration suggests that macrophages are involved, at least in part, in causing the kidney damage associated with HUS.


arrow
DISCUSSION
 
We have previously established a mouse model of HUS that exhibits the triad of hemolytic anemia, thrombocytopenia, and renal failure that defines the disease (11). In the present report, we use this mouse model to investigate the role of the macrophage during the development of HUS. We describe here the progression of macrophage infiltration into the kidneys of mice injected with Stx2, LPS, or both, as well as the associated chemokines and their relevance in this model. Furthermore, we show that the combination of Stx2 plus LPS induces a greater influx of macrophages and higher chemokine expression in the kidney than either Stx2 alone or LPS alone. These data indicate that these two agents produce an additive effect when administered together.

After determining that macrophages were recruited to the kidneys of mice injected with Stx2 and/or LPS in a time-dependent manner, we sought to determine the chemokines responsible for this infiltration. Previous studies have shown that mice or rats injected with LPS have increased macrophage infiltration and increased levels of renal MCP-1 and RANTES (6, 36). Additionally, mouse models of sepsis, a disease in which macrophages are involved, have shown increased levels of MCP-1, RANTES, and MIP-1{alpha} in organs including the kidney, liver, and lungs (15, 18). Analysis of our model revealed that these three chemokines were upregulated in the kidneys after Stx2 and/or LPS injection. It is noteworthy that while administration of Stx2 alone did not greatly alter renal mRNA levels of any chemokine, it did cause significantly increased protein expression. It is likely that posttranslational control or storage of the chemokines in renal cells allows for rapid secretion of these chemokines upon exposure to Stx2 without upregulation of gene transcription (3, 23, 24). These data suggest that Stx2 and LPS induce renal cells to produce MCP-1 and MIP-1{alpha}, resulting in the initial macrophage infiltration, and to produce RANTES later in the time course, resulting in the continued macrophage infiltration of the kidney.

Immunohistochemistry for these chemokines revealed that all three chemokines were located in tubular cells and that none were in the glomeruli. These data correlated with the fact that macrophages were located only in the tubular interstitium and did not infiltrate the glomeruli. It is not surprising that these chemokines are produced by tubular epithelial cells, considering previous studies documenting the ability of these cells to produce various cytokines and chemokines, including MCP-1, RANTES, and MIP-1{alpha} (1, 37). Additionally, renal tubular cells have been shown to be a primary target of Stx in animal models and in cell culture, inducing both apoptosis and cytokine secretion (8, 12, 19, 34, 35).

MCP-1 and RANTES were the most abundant renal chemokines induced by Stx2 plus LPS. Thus, it was hypothesized that MCP-1 and RANTES were the primary inducers of the Stx2 plus LPS-induced renal macrophage infiltration. To test this hypothesis, mice were treated with neutralizing antibodies to MCP-1, RANTES, and MIP-1{alpha} in all possible combinations prior to Stx2 plus LPS injection. A previous study by Fillion et al. demonstrated that neutralizing antibodies to MCP-1, RANTES, and MIP-1{alpha} reduced macrophages in the lungs of pneumococcus-infected mice by 33% only when administered together, not separately (4). In contrast, we found that administration of these chemokines separately resulted in a modest reduction (20 to 30%) in Stx2 plus LPS-induced renal macrophage accumulation. Furthermore, neutralizing both RANTES and MCP-1 proved to be as effective at significantly reducing renal macrophages as neutralizing RANTES, MCP-1, and MIP-1{alpha}. These data are a strong indication that MCP-1 and RANTES are the primary chemoattractants involved in Stx2 plus LPS-induced renal macrophage infiltration. A complete inhibition of macrophage infiltration was not observed; however, it is likely that, at the doses used, the chemokines are not completely neutralized by the antibodies. Alternatively, other chemokines may be involved in the macrophage infiltration seen in our model. Of note, gene array analysis done by our lab has shown that the RNA of the macrophage chemokine IP-10/CXCL10 is upregulated in mouse kidneys (see the supplementary material in reference 11). The role of this chemokine in our HUS mouse model is currently under investigation.

To determine whether macrophage inhibition had any effect on kidney function, kidneys from mice administered anti-MCP-1, anti-RANTES, and anti-MIP-1{alpha} antibodies prior to Stx2 plus LPS injection were evaluated for fibrin deposition. Fibrin-rich thrombi in the renal microvasculature are associated with HUS and diminished kidney function in these patients (2, 27, 30). Furthermore, it has been shown, by using a model of experimental glomerulonephritis in the rabbit, that macrophages can induce glomerular fibrin deposition (7). We have also shown previously in our HUS mouse model that an increase in renal fibrin deposition is associated with an increase in serum creatinine and a decrease in kidney function (11). Using a differential stain for fibrin, we found that mice administered all three chemokine-neutralizing antibodies and Stx2 plus LPS had significantly decreased glomerular and total kidney fibrin deposition. This likely indicates that the recruited macrophages or the chemokines RANTES, MIP-1{alpha}, and MCP-1 contribute to diminished renal function and to the pathology of the HUS disease state. In support of this conclusion, Palermo et al. found that depleting mice of splenic and liver macrophages reduced Stx2 plus LPS-induced mortality (25).

In summary, we have demonstrated that macrophages infiltrate the kidneys of an HUS mouse model primarily via the chemokines MCP-1 and RANTES. Currently, we are investigating whether it is the macrophages or the chemokines that contribute to the increased fibrin deposition found in our model. Additionally, we are evaluating whether depletion of macrophages or monocytes from the circulation will have any effect on renal disease and survival. Although we have not specifically investigated the usefulness of chemokine neutralization as a therapy for HUS in a more clinical setting, experiments that would test the efficacy of such treatment after Stx2 and LPS exposure are a priority for our laboratory. Nonetheless, the data presented here suggest that neutralizing these macrophage chemokines may be a useful therapeutic for ameliorating the kidney damage associated with HUS.


arrow
ACKNOWLEDGMENTS
 
This research was supported by funding from USPHS grant AI24431 (T.G.O.).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Division of Nephrology, University of Virginia, Box 800133, 1 Lane Road OMS 5815, Charlottesville, VA 22903. Phone: (434) 982-1063. Fax: (434) 924-5848. E-mail: to3e{at}virginia.edu. Back

{triangledown} Published ahead of print on 12 January 2007. Back

Editor: A. D. O'Brien


arrow
REFERENCES
 
    1
  1. Anders, H.-J., V. Vielhauer, and D. Schlondorff. 2003. Chemokines and chemokine receptors are involved in the resolution or progression of renal disease. Kidney Int. 63:401-415.[CrossRef][Medline]
  2. 2
  3. Blackall, D. P., and M. B. Marques. 2004. Hemolytic uremic syndrome revisited: Shiga toxin, factor H, and fibrin generation. Am. J. Clin. Pathol. 121(Suppl.):S81-S88.
  4. 3
  5. Comerford, I., and R. J. Nibbs. 2005. Post-translational control of chemokines: a role for decoy receptors? Immunol. Lett. 96:163-174.[CrossRef][Medline]
  6. 4
  7. Fillion, I., N. Ouellet, M. Simard, Y. Bergeron, S. Sato, and M. G. Bergeron. 2001. Role of chemokines and formyl peptides in pneumococcal pneumonia-induced monocyte/macrophage recruitment. J. Immunol. 166:7353-7361.[Abstract/Free Full Text]
  8. 5
  9. Guessous, F., M. Marcinkiewicz, R. Polanowska-Grabowska, T. R. Keepers, T. Obrig, and A. R. Gear. 2005. Shiga toxin 2 and lipopolysaccharide cause monocytic THP-1 cells to release factors which activate platelet function. Thromb. Haemostasis 94:1019-1027.[Medline]
  10. 6
  11. Haberstroh, U., J. Pocock, C. Gomez-Guerrero, U. Helmchen, A. Hamann, J. C. Gutierrez-Ramos, R. A. Stahl, and F. Thaiss. 2002. Expression of the chemokines MCP-1/CCL2 and RANTES/CCL5 is differentially regulated by infiltrating inflammatory cells. Kidney Int. 62:1264-1276.[CrossRef][Medline]
  12. 7
  13. Holdsworth, S. R., and P. G. Tipping. 1985. Macrophage-induced glomerular fibrin deposition in experimental glomerulonephritis in the rabbit. J. Clin. Investig. 76:1367-1374.[Medline]
  14. 8
  15. Hughes, A. K., P. K. Stricklett, and D. E. Kohan. 1998. Shiga toxin-1 regulation of cytokine production by human proximal tubule cells. Kidney Int. 54:1093-1106.[CrossRef][Medline]
  16. 9
  17. Inward, C. D., M. Varagunam, D. Adu, D. V. Milford, and C. M. Taylor. 1997. Cytokines in haemolytic uraemic syndrome associated with verocytotoxin-producing Escherichia coli infection. Arch. Dis. Child 77:145-147.[Abstract/Free Full Text]
  18. 10
  19. Karpman, D., A. Andreasson, H. Thysell, B. S. Kaplan, and C. Svanborg. 1995. Cytokines in childhood hemolytic uremic syndrome and thrombotic thrombocytopenic purpura. Pediatr. Nephrol. 9:694-699.[CrossRef][Medline]
  20. 11
  21. Keepers, T. R., M. A. Psotka, L. K. Gross, and T. G. Obrig. 2006. A murine model of HUS: Shiga toxin with lipopolysaccharide mimics the renal damage and physiologic response of human disease. J. Am. Soc. Nephrol. 17:3404-3414.[Abstract/Free Full Text]
  22. 12
  23. Kiyokawa, N., T. Taguchi, T. Mori, H. Uchida, N. Sato, T. Takeda, and J. Fujimoto. 1998. Induction of apoptosis in normal human renal tubular epithelial cells by Escherichia coli Shiga toxins 1 and 2. J. Infect. Dis. 178:178-184.[Medline]
  24. 12a
  25. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-{Delta}{Delta}C(t)) method. Methods 25:402-408.[CrossRef][Medline]
  26. 13
  27. Louise, C. B., and T. G. Obrig. 1992. Shiga toxin-associated hemolytic uremic syndrome: combined cytotoxic effects of Shiga toxin and lipopolysaccharide (endotoxin) on human vascular endothelial cells in vitro. Infect. Immun. 60:1536-1543.[Abstract/Free Full Text]
  28. 14
  29. Louise, C. B., and T. G. Obrig. 1991. Shiga toxin-associated hemolytic-uremic syndrome: combined cytotoxic effects of Shiga toxin, interleukin-1 beta, and tumor necrosis factor alpha on human vascular endothelial cells in vitro. Infect. Immun. 59:4173-4179.[Abstract/Free Full Text]
  30. 15
  31. Matsukawa, A., C. M. Hogaboam, N. W. Lukacs, P. M. Lincoln, R. M. Strieter, and S. L. Kunkel. 2000. Endogenous MCP-1 influences systemic cytokine balance in a murine model of acute septic peritonitis. Exp. Mol. Pathol. 68:77-84.[CrossRef][Medline]
  32. 16
  33. McMahon, J. T., J. L. Myles, and R. R. Tubbs. 2002. Demonstration of immune complex deposits using fluorescence microscopy of hematoxylin and eosin-stained sections of Hollande's fixed renal biopsies. Mod. Pathol. 15:988-997.[CrossRef]
  34. 17
  35. Melton-Celsa, A. R., and A. D. O'Brien. 2000. Shiga toxins of Shigella dysenteriae and Escherichia coli, p. 385-406. In K. Aktories and I. Just (ed.), Handbook of experimental pharmacology. Springer, Freiburg, Germany.
  36. 18
  37. Ness, T. L., K. J. Carpenter, J. L. Ewing, C. J. Gerard, C. M. Hogaboam, and S. L. Kunkel. 2004. CCR1 and CC chemokine ligand 5 interactions exacerbate innate immune responses during sepsis. J. Immunol. 173:6938-6948.[Abstract/Free Full Text]
  38. 19
  39. Nestoridi, E., R. I. Kushak, D. Duguerre, E. F. Grabowski, and J. R. Ingelfinger. 2005. Up-regulation of tissue factor activity on human proximal tubular epithelial cells in response to Shiga toxin. Kidney Int. 67:2254-2266.[CrossRef][Medline]
  40. 20
  41. O'Brien, A. D., V. L. Tesh, A. Donohue-Rolfe, M. P. Jackson, S. Olsnes, K. Sandvig, A. A. Lindberg, and G. T. Keusch. 1992. Shiga toxin: biochemistry, genetics, mode of action, and role in pathogenesis. Curr. Top. Microbiol. Immunol. 180:65-94.[Medline]
  42. 21
  43. Obrig, T. G., P. J. Del Vecchio, J. E. Brown, T. P. Moran, B. M. Rowland, T. K. Judge, and S. W. Rothman. 1988. Direct cytotoxic action of Shiga toxin on human vascular endothelial cells. Infect. Immun. 56:2373-2378.[Abstract/Free Full Text]
  44. 22
  45. Ostroff, S. M., P. I. Tarr, M. A. Neill, J. H. Lewis, N. Hargrett-Bean, and J. M. Kobayashi. 1989. Toxin genotypes and plasmid profiles as determinants of systemic sequelae in Escherichia coli O157:H7 infections. J. Infect. Dis. 160:994-998.[Medline]
  46. 23
  47. Oynebraten, I., O. Bakke, P. Brandtzaeg, F. E. Johansen, and G. Haraldsen. 2004. Rapid chemokine secretion from endothelial cells originates from 2 distinct compartments. Blood 104:314-320.[Abstract/Free Full Text]
  48. 24
  49. Oynebraten, I., N. Barois, K. Hagelsteen, F. E. Johansen, O. Bakke, and G. Haraldsen. 2005. Characterization of a novel chemokine-containing storage granule in endothelial cells: evidence for preferential exocytosis mediated by protein kinase A and diacylglycerol. J. Immunol. 175:5358-5369.[Abstract/Free Full Text]
  50. 25
  51. Palermo, M. S., M. F. Alves Rosa, N. Van Rooijen, and M. A. Isturiz. 1999. Depletion of liver and splenic macrophages reduces the lethality of Shiga toxin-2 in a mouse model. Clin. Exp. Immunol. 116:462-467.[CrossRef][Medline]
  52. 26
  53. Perera, L. P., L. R. Marques, and A. D. O'Brien. 1988. Isolation and characterization of monoclonal antibodies to Shiga-like toxin II of enterohemorrhagic Escherichia coli and use of the monoclonal antibodies in a colony enzyme-linked immunosorbent assay. J. Clin. Microbiol. 26:2127-2131.[Abstract/Free Full Text]
  54. 27
  55. Proesmans, W. 2001. The role of coagulation and fibrinolysis in the pathogenesis of diarrhea-associated hemolytic uremic syndrome. Semin. Thromb. Hemost. 27:201-205.[CrossRef][Medline]
  56. 28
  57. Pusey, W., and C. A. Edwards. 1978. A modification of the martius yellow-scarlet red-aniline blue method for fibrin. Stain Technol. 53:58-59.[Medline]
  58. 29
  59. Ramegowda, B., and V. L. Tesh. 1996. Differentiation-associated toxin receptor modulation, cytokine production, and sensitivity to Shiga-like toxins in human monocytes and monocytic cell lines. Infect. Immun. 64:1173-1180.[Abstract]
  60. 30
  61. Tarr, P. I., C. A. Gordon, and W. L. Chandler. 2005. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet 365:1073-1086.[Medline]
  62. 31
  63. van de Kar, N. C., L. A. Monnens, M. A. Karmali, and V. W. van Hinsbergh. 1992. Tumor necrosis factor and interleukin-1 induce expression of the verocytotoxin receptor globotriaosylceramide on human endothelial cells: implications for the pathogenesis of the hemolytic uremic syndrome. Blood 80:2755-2764.[Abstract/Free Full Text]
  64. 32
  65. van Setten, P. A., L. A. Monnens, R. G. Verstraten, L. P. van den Heuvel, and V. W. van Hinsbergh. 1996. Effects of verocytotoxin-1 on nonadherent human monocytes: binding characteristics, protein synthesis, and induction of cytokine release. Blood 88:174-183.[Abstract/Free Full Text]
  66. 33
  67. van Setten, P. A., V. W. van Hinsbergh, L. P. van den Heuvel, F. Preyers, H. B. Dijkman, K. J. Assmann, T. J. van der Velden, and L. A. Monnens. 1998. Monocyte chemoattractant protein-1 and interleukin-8 levels in urine and serum of patents with hemolytic uremic syndrome. Pediatr. Res. 43:759-767.[Medline]
  68. 34
  69. Wadolkowski, E. A., L. M. Sung, J. A. Burris, J. E. Samuel, and A. D. O'Brien. 1990. Acute renal tubular necrosis and death of mice orally infected with Escherichia coli strains that produce Shiga-like toxin type II. Infect. Immun. 58:3959-3965.[Abstract/Free Full Text]
  70. 35
  71. Yamamoto, E. T., M. Mizuno, K. Nishikawa, S. Miyazawa, L. Zhang, S. Matsuo, and Y. Natori. 2005. Shiga toxin 1 causes direct renal injury in rats. Infect. Immun. 73:7099-7106.[Abstract/Free Full Text]
  72. 36
  73. Zager, R. A., A. C. M. Johnson, S. Y. Hanson, and S. Lund. 2006. Acute nephrotoxic and obstructive injury primes the kidney to endotoxin-driven cytokine/chemokine production. Kidney Int. 69:1181-1188.[CrossRef][Medline]
  74. 37
  75. Zheng, G., Y. Wang, D. Mahajan, X. Qin, S. I. Alexander, and D. C. Harris. 2005. The role of tubulointerstitial inflammation. Kidney Int. Suppl. 94:S96-S100.[CrossRef]


Infection and Immunity, March 2007, p. 1229-1236, Vol. 75, No. 3
0019-9567/07/$08.00+0     doi:10.1128/IAI.01663-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Cherla, R. P., Lee, S.-Y., Mulder, R. A., Lee, M.-S., Tesh, V. L. (2009). Shiga Toxin 1-Induced Proinflammatory Cytokine Production Is Regulated by the Phosphatidylinositol 3-Kinase/Akt/Mammalian Target of Rapamycin Signaling Pathway. Infect. Immun. 77: 3919-3931 [Abstract] [Full Text]  
  • Raby, A.-C., Le Bouder, E., Colmont, C., Davies, J., Richards, P., Coles, B., George, C. H., Jones, S. A., Brennan, P., Topley, N., Labeta, M. O. (2009). Soluble TLR2 Reduces Inflammation without Compromising Bacterial Clearance by Disrupting TLR2 Triggering. J. Immunol. 183: 506-517 [Abstract] [Full Text]  
  • Psotka, M. A., Obata, F., Kolling, G. L., Gross, L. K., Saleem, M. A., Satchell, S. C., Mathieson, P. W., Obrig, T. G. (2009). Shiga Toxin 2 Targets the Murine Renal Collecting Duct Epithelium. Infect. Immun. 77: 959-969 [Abstract] [Full Text]  
  • Borchers, M. T., Wesselkamper, S. C., Eppert, B. L., Motz, G. T., Sartor, M. A., Tomlinson, C. R., Medvedovic, M., Tichelaar, J. W. (2008). Nonredundant Functions of {alpha}{beta} and {gamma}{delta} T Cells in Acrolein-Induced Pulmonary Pathology. Toxicol Sci 105: 188-199 [Abstract] [Full Text]  
  • Zanchi, C., Zoja, C., Morigi, M., Valsecchi, F., Liu, X. Y., Rottoli, D., Locatelli, M., Buelli, S., Pezzotta, A., Mapelli, P., Geelen, J., Remuzzi, G., Hawiger, J. (2008). Fractalkine and CX3CR1 Mediate Leukocyte Capture by Endothelium in Response to Shiga Toxin. J. Immunol. 181: 1460-1469 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Keepers, T. R.
Right arrow Articles by Obrig, T. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Keepers, T. R.
Right arrow Articles by Obrig, T. G.