| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article ![]()
Infection and Immunity, April 2007, p. 1661-1666, Vol. 75, No. 4
0019-9567/07/$08.00+0 doi:10.1128/IAI.01342-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Department of Molecular Biology and Microbiology, Tufts University School of Medicine and Howard Hughes Medical Institute, 136 Harrison Avenue, Boston, Massachusetts 02111
Received 21 August 2006/ Returned for modification 20 October 2006/ Accepted 9 November 2006
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Lipopolysaccharide (LPS), found in the outer membrane of gram-negative bacteria, is composed of lipid A, core oligosaccharide, and repeating O-antigen subunits. The O antigen is covalently linked to the outer region of the core oligosaccharide, and it appears to act as a barrier that can protect enteric pathogens against toxic agents encountered in host gastrointestinal tracts (23). For example, galU and galE mutants of Vibrio cholerae, which lacked O antigen, were defective in intestinal colonization, although they had no growth defect in rich medium. These mutants were more sensitive than O-antigen-producing strains to killing by complement and cationic antimicrobial peptides, suggesting that their defect in colonization was attributable to their sensitivity to bactericidal substances elaborated by the host gastrointestinal tract (17).
Like many enteric pathogens, E. coli O157 produces LPS that contains an extensive O antigen. The O157 O-antigen subunit consists of N-acetyl-D-perosamine, L-fucose, D-glucose, and N-acetyl-D-galactose (22). Production of N-acetyl-D-galactose requires that its precursor, galactose, be modified by the enzymes GalE, GalT, GalK, and GalU. Salmonella enterica serovar Typhimurium and E. coli gal mutants do not make O antigen (8, 18, 25).
The inner region of the LPS core oligosaccharide, which is conserved in many enteric bacteria, serves as the receptor for bacteriophage P1. Phage P1 has been a workhorse for genetic manipulation of E. coli K-12 for many decades. P1-mediated generalized transduction enables movement of mutations for generation of isogenic bacterial strains, which is often required for proving the linkage between particular genotypes and phenotypes. In S. enterica serovar Typhimurium, which has an LPS core oligosaccharide similar to that of E. coli K-12, the long O antigen obscures the core oligosaccharide and prevents P1 from adsorbing to the bacteria. O-antigen mutants (
gal,
galE, and
galU) of S. enterica serovar Typhimurium have been shown to be P1 sensitive (18).
P1-mediated generalized transduction of EHEC has not been described previously. Here, we adopted the strategy that was used to facilitate P1 transduction in Salmonella. Wild-type EHEC O157:H7 strains are resistant to P1, but O157:H7 gal mutants were found to be P1 sensitive and permitted P1-mediated movement of genetic markers between EHEC strains. Furthermore, we developed a method that allows a simple reversion to convert P1-sensitive strains to the wild type. Interestingly, we found that the P1-sensitive galETKM O157:H7 mutant was extremely attenuated in the ability to colonize the infant rabbit intestine and had increased sensitivity to bactericidal permeability-increasing protein (BPI).
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
galU::aad-7 mutant TEA023 and the
galETKM::aad-7 mutant TEA026, the spectinomycin resistance gene (aad-7) was amplified from the pVi36 plasmid (provided by V. Burrus, University of Sherbrooke) template using primers TE139 (5'-ATGGCTGCCATTAATACGAAAGTCAAAAAAGCC) and TE140 (5'-TTACTTCTTAATGCCCATCTCTTCTTCAAGCCA) and primers TE137 (5'-ATGCTATGGTTATTTCATACCATAAGCCTAATGGAGCCCGGCGGATTTGTCCTACTC) and TE138 (5'-TTACTCAGCAATAAACTGATATTCCGTCAGGCTCTAAGCACTTGTCTCCTGTTTA), respectively. To obtain
galETKM::tetA mutant TEA028, the tetracycline resistance gene (tetA) was amplified from the pAH162 plasmid (11) template using primers TE141 (5'-ATGCTATGGTTATTTCATACCATAAGCCTAATGGAGGATGCCTGGCAGTTCCCTACTC) and TE142 (5'-TTACTCAGCAATAAACTGATATTCCGTCAGGCTTTAGGTGGCGGTACTTGGGTCGA). After electroporation of the PCR products, cells were incubated in SOB (Invitrogen) containing 0.2% L-arabinose for 2 h and then plated on selective media at 37°C. For the
galU::aad-7 mutation, the spectinomycin resistance gene replaced all of the galU gene except the first 33 bp and the last 30 bp of the galU open reading frame. For the
galETKM::aad-7 and
galETKM::tetA mutations, the antibiotic resistance gene replaced all of the galETKM operon except the first 36 bp of the galE gene and the last 30 bp of the galM gene. We constructed the pTHE001 plasmid to generate an insertion mutation in galE. First, a 460-bp internal fragment of the galE gene was amplified by PCR using primers TE013 (5'-GCAAGGATCCGACGTTTGTTGAAGGCGATA) and TE014 (5'-GGCATAAGGGAATTCGGAATGCCTTGCGGA). The PCR product was digested with BamHI and then cloned into the BglII site of the conditional plasmid pGP704 (16). The resulting plasmid, pTHE001, was mobilized using the RP4+ helper strain WM3064 (provided by W. Metcalf, University of Illinois, Urbana-Champaign) into EDL933.
To generate the Gal+ revertant TEA040, we first moved the galE::pTHE001 mutation from TEA007 into the
galETKM::aad-7 strain (TEA026) by P1 transduction, selecting for ampicillin resistance. The resulting strain was then used as a recipient for P1 transduction of the galETKM+ allele from TEA023. Gal+ transductants were selected on M63 agar plates supplemented with 0.2% galactose and 0.1% Casamino Acids.
P1 adsorption and sensitivity assays. P1 adsorption assays were performed using a P1 lysate grown on E. coli K-12 strain MC4100. Approximately 100 µl of an overnight culture was pelleted by centrifugation and resuspended in 100 µl of LB broth. Then 100 µl of the P1 lysate was added to the cells. After 15 min of incubation at 37°C, cells were pelleted by centrifugation at 6,000 rpm in an Eppendorf centrifuge at 4°C for 2 min. The P1 titers of the supernatants were then determined by plaquing, using MC4100 as an indicator strain. To plaque P1, we spotted phage lysates on top agar (LB broth containing 2 mM MgSO4, 10 mM CaCl2, and 0.7% agar) lawns of MC4100.
To test for sensitivity of strains to P1 lysis, each strain was cross-streaked against P1. A single line of P1 (100 µl;
109 PFU/ml) was allowed to dry on an LB agar plate. For each bacterial strain, a single streak was then drawn perpendicular to a line of phage P1. Strains resistant to P1 grew on both sides of the line of P1; susceptible strains were partially lysed following an encounter with P1.
P1 lysate production. P1 lysates of various EHEC strains were generated by growing 1:100 dilutions of overnight cultures of each strain in 2.5 ml of LB broth containing 2 mM MgSO4 and 10 mM CaCl2 and incubating the preparations for 1 h at 37°C with agitation. Then 100 µl of a P1 lysate grown on MC4100 was added to each culture. After 2 to 3 h of incubation at 37°C with agitation, lysis of the cultures was observed. Tubes were transferred to ice, and any remaining intact bacteria were lysed with 0.5 ml chloroform. Lysates were then centrifuged at 13,000 rpm for 1 min, diluted in phosphate-buffered saline (PBS), and spotted on top agar lawns of MC4100 for titration. Lysates were stored at 4°C in the dark with 0.5 ml chloroform.
P1 transduction. Overnight cultures (0.5 ml) of recipient bacteria grown in LB broth were pelleted and resuspended in 100 µl MC (5 mM MgSO4, 50 mM CaCl2). About 50 µl of P1 lysate was added to the cells, which were then incubated at 37°C for 15 to 30 min. LB broth with 10 mM sodium citrate (0.5 to 1 ml) was added to each tube and incubated for 1 h at room temperature. Each tube was centrifuged at 6,000 rpm for 2 min, and the pellets were resuspended in 100 µl 1 M sodium citrate and plated on selective media.
In vitro competition assays. A 1:1 mixture of a mutant (TEA026) and wild-type strain EDL933 or TEA040 initially containing 5 x 107 bacteria/ml was incubated in LB broth at 37°C with agitation overnight. Each assay mixture was then diluted and plated on LB agar. After overnight growth, bacteria were replica plated on selective media to determine the numbers of mutant and wild-type bacteria. Each assay was performed at least three times.
Competition assays with infant rabbits. We used the infant rabbit model to test the colonization ability of EHEC strains (27). Three-day-old New Zealand White rabbits were orally inoculated with a 1:1 mixture of TEA026 and wild-type strain EDL933 or TEA040 containing 2.5 x 108 bacteria which were washed one time and resuspended in PBS. Seven days after inoculation, rabbits were sacrificed, and their gastrointestinal tracts were removed. Portions of the ileum, midcolon, and cecum were then homogenized, diluted, and plated on MacConkey agar containing sorbitol. After overnight growth, bacteria were replica plated on LB agar containing spectinomycin (100 µg/ml) to determine the number of TEA026 bacteria.
BPI sensitivity assays. We used the BPI-derived peptide P2, which has the antibacterial activity of whole protein (10, 13), to assess EHEC sensitivity. For these assays, bacteria grown overnight in LB broth were washed once in PBS and resuspended in PBS (pH 6.2). Then 5 x 107 bacteria with or without 30 µg P2 (Tufts University Core Facility) were incubated in 0.5 ml PBS (pH 6.2) for 45 min at 37°C. After incubation, each assay mixture was placed on ice, diluted, and plated on LB agar. Each assay was performed in triplicate and repeated in three independent experiments.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
galETKM::aad-7 (TEA026),
galETKM::tetA (TEA028), and
galU::aad-7 (TEA023) deletion mutants and the galE::pTHE001 (TEA007) insertion mutant. To assess whether gal loci influence infection of EHEC by phage P1, we performed cross-streak experiments. A streak of each bacterial strain was drawn perpendicular to a line of P1, and the consequences of encountering phage were assessed. There was no change in the growth of wild-type strain EDL933 in response to P1, indicating that this strain is resistant to phage infection. In contrast, all four gal mutants were lysed by phage P1 (data not shown).
To explore why the gal mutants are more susceptible to P1 infection, we examined whether the mutants showed enhanced adsorption of P1. Phage adsorption to the host bacterium is an essential step in phage infection. In these assays, each gal mutant was incubated with P1 and then centrifuged to pellet any phage adsorbed to the bacteria. Supernatants were then assayed to determine the number of unadsorbed P1 particles. As shown in Table 2, the wild-type strain adsorbed
30% of the phage, suggesting that there may be some nonspecific interactions between EHEC and P1, since the wild-type strain is resistant to P1 infection and therefore is presumed to have inaccessible core oligosaccharides. However, all four gal mutants adsorbed
95% of the P1, which is consistent with the hypothesis that access to P1's receptor is less impeded in these strains.
|
galU::aad-7 (TEA023),
galETKM::aad-7 (TEA026), and galE::pTHE001 (TEA007) strains. To determine if chromosomal markers could be transduced from the EHEC gal mutants, each of the mutants was used to generate a P1 lysate. The
galU::aad-7,
galETKM::aad-7, and galE::pTHE001 mutations could be transferred readily into the O157:H7
galETKM::tetA strain or into E. coli K-12 strain MC4100. For each of these EHEC P1 transduction experiments, between 10 and 100 transductants were obtained. Clearly, O157:H7 gal mutants can be transduced by P1 and can be used to generate P1 lysates. However, the frequencies of transduction between the O157:H7 gal strains were
100-fold lower than the frequency of P1 transduction between K-12 strains. The lower O157:H7 transduction efficiency could be due to the abundance of prophage genes in O157:H7 that may affect replication or production of P1.
Reversion of the gal mutant using P1 transduction.
We devised a simple strategy to change Gal strains back to Gal+ strains in order to enable study of Gal+ EHEC strains that have been engineered using P1. We were unable to revert the
galETKM::aad-7 mutant (TEA026) by transducing the galETKM+ allele from TEA023, perhaps because the frequency of transduction was too low to obtain a revertant. Therefore, we utilized a two-step reversion method. We first moved the galE::pTHE001 mutation from TEA007 into the galETKM strain (TEA026). This strain was then used as a recipient for P1 transduction of the galETKM+ allele from a donor lysate grown on the
galU strain (TEA023). Gal+ transductants were selected on agar plates containing M63 minimal medium supplemented with 0.2% galactose and 0.1% Casamino Acids and were verified to be Gal+ strains on MacConkey agar containing 1% galactose. This transduction was as efficient as transfer of other EHEC chromosomal markers. We chose one Gal+ revertant strain (TEA040) to test for P1 sensitivity. Like the isogenic wild-type strain, this Gal+ revertant had a reduced capacity to adsorb P1 phage compared to the gal mutants (Table 2), was resistant to P1 lysis in a P1 cross-streak experiment, and was not able to serve as a recipient for P1 transduction (data not shown).
O157:H7 galETKM mutant is dramatically impaired in colonization of the infant rabbit intestine.
Previous studies have shown that galE mutants of S. enterica serovars are defective in intestinal colonization (9, 12). We were interested in determining whether the EHEC galETKM deletion resulted in a similar defect in intestinal colonization. To do this, we tested the galETKM::aad-7 deletion mutant (TEA026) in a competition assay with the isogenic wild-type strain (EDL933) using the EHEC-infant rabbit model. We found that the galETKM deletion mutant (TEA026) was
500-fold less able to colonize the infant rabbit ileum, cecum, and midcolon (Fig. 1A). To demonstrate that this dramatic defect in intestinal colonization was due to the galETKM deletion, we performed a competition experiment with the Gal+ reverted strain and its
galETKM::aad-7 parent strain. The Gal+ revertant (TEA040) outcompeted the galETKM mutant (TEA023) to an extent similar to the extent observed for the wild type (Fig. 1B), strongly suggesting that the galETKM deletion accounts for the colonization defect of TEA026. In vitro competition assays in which the galETKM strain and the wild type or the Gal+ revertant were grown in LB broth at 37°C revealed that the galETKM mutation resulted in a slight (
2-fold) but statistically significant growth defect in rich medium (Fig. 1). This minor in vitro growth defect could not account for the drastic colonization defect of the gal mutant. Overall, these findings suggest that the O157 O antigen is critical for EHEC intestinal colonization.
|
Conclusions. EHEC strains, especially E. coli O157 strains, are significant causes of disease in many developed nations, yet there are no methods for transducing markers in this important group of pathogenic E. coli. It has been known for a long time that S. enterica serovar Typhimurium gal mutants have little or no O antigen, which makes these strains sensitive to P1 (18). Our findings strongly suggest that the O157 O antigen obscures the EHEC core oligosaccharide, the P1 receptor, in a similar fashion, since we found that O157:H7 gal mutants are sensitive to P1 infection. We also developed a relatively simple P1 transduction-based means to revert gal mutants to a Gal+ phenotype. Although we describe a method to genetically manipulate O157:H7 with P1, this technique can likely be adapted for use with other EHEC serotypes and probably with other pathogenic E. coli strains (such as enteropathogenic E. coli and uropathogenic E. coli) as well. Figure 2 outlines a general scheme for using P1 transduction for genetic manipulation of EHEC. This figure shows the method that our lab routinely uses to generate isogenic EHEC strains. This ability to move chromosomal markers enables generation of isogenic strains containing single or multiple mutations. Given the relative ease of the P1 transduction technique outlined here, it should be possible to backcross mutations generated with the lambda red system into genetically identical backgrounds.
|
O antigens likely act as important barriers against extracellular assaults mounted by the host immune system. O-antigen mutants of enteric bacteria like V. cholerae, Klebsiella serotype O1:K20, and Shigella flexneri are more susceptible to antimicrobial peptides and complement killing (14, 17, 29). S. enterica serovar Typhi, Brucella melitensis, and V. cholerae O-antigen mutants have been shown to be impaired in intestinal colonization as well (3, 9, 17, 26). In fact, the only oral live attenuated vaccine against S. enterica serovar Typhi used in the United States is a galE mutant. Given the pronounced attenuation of the O157:H7
galETKM::aad-7 mutant, perhaps EHEC gal mutants could also be developed into useful vaccines.
| ACKNOWLEDGMENTS |
|---|
We thank the NIH and Howard Hughes Medical Institute for funding this work.
| FOOTNOTES |
|---|
Published ahead of print on 11 December 2006. ![]()
| REFERENCES |
|---|
|
|
|---|
| 1. | Bilge, S. S., J. C. Vary, Jr., S. F. Dowell, and P. I. Tarr. 1996. Role of the Escherichia coli O157:H7 O side chain in adherence and analysis of an rfb locus. Infect. Immun. 64:4795-4801.[Abstract] |
| 2. | Canny, G., O. Levy, G. T. Furuta, S. Narravula-Alipati, R. B. Sisson, C. N. Serhan, and S. P. Colgan. 2002. Lipid mediator-induced expression of bactericidal/permeability-increasing protein (BPI) in human mucosal epithelia. Proc. Natl. Acad. Sci. USA. 99:3902-3907. |
| 3. | Chiang, S. L., and J. J. Mekalanos. 1999. rfb mutations in Vibrio cholerae do not affect surface production of toxin-coregulated pili but still inhibit intestinal colonization. Infect. Immun. 67:976-980. |
| 4. | Cockerill, F. III, G. Beebakhee, R. Soni, and P. Sherman. 1996. Polysaccharide side chains are not required for attaching and effacing adhesion of Escherichia coli O157:H7. Infect. Immun. 64:3196-3200.[Abstract] |
| 5. | Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645. |
| 6. | Feng, P. 2001. Escherichia coli, p. 143-162. In R. G. Labbe and S. Garcia (ed.), Guide to foodborne pathogens. John Wiley and Sons, Inc., New York, NY. |
| 7. | Gazzano-Santoro, H., J. B. Parent, L. Grinna, A. Horwitz, T. Parsons, G. Theofan, P. Elsbach, J. Weiss, and P. J. Conlon. 1992. High-affinity binding of the bactericidal/permeability-increasing protein and a recombinant amino-terminal fragment to the lipid A region of lipopolysaccharide. Infect. Immun. 60:4754-4761. |
| 8. | Genevaux, P., P. Bauda, M. S. DuBow, and B. Oudega. 1999. Identification of Tn10 insertions in the rfaG, rfaP, and galU genes involved in lipopolysaccharide core biosynthesis that affect Escherichia coli adhesion. Arch. Microbiol. 172:1-8.[CrossRef][Medline] |
| 9. | Gilman, R. H., R. B. Hornick, W. E. Woodard, H. L. DuPont, M. J. Snyder, M. M. Levine, and J. P. Libonati. 1977. Evaluation of a UDP-glucose-4-epimeraseless mutant of Salmonella typhi as a liver oral vaccine. J. Infect. Dis. 136:717-723.[Medline] |
| 10. | Gray, B. H., and J. R. Haseman. 1994. Bactericidal activity of synthetic peptides based on the structure of the 55-kilodalton bactericidal protein from human neutrophils. Infect. Immun. 62:2732-2739. |
| 11. | Haldimann, A., and B. L. Wanner. 2001. Conditional-replication, integration, excision, and retrieval plasmid-host systems for gene structure-function studies of bacteria. J. Bacteriol. 183:6384-6393. |
| 12. | Hohmann, A., G. Schmidt, and D. Rowley. 1979. Intestinal and serum antibody responses in mice after oral immunization with Salmonella, Escherichia coli, and Salmonella-Escherichia coli hybrid strains. Infect. Immun. 25:27-33. |
| 13. | Little, R. G., D. N. Kelner, E. Lim, D. J. Burke, and P. J. Conlon. 1994. Functional domains of recombinant bactericidal/permeability increasing protein (rBPI23). J. Biol. Chem. 269:1865-1872. |
| 14. | McCallum, K. L., G. Schoenhals, D. Laakso, B. Clarke, and C. Whitfield. 1989. A high-molecular-weight fraction of smooth lipopolysaccharide in Klebsiella serotype O1:K20 contains a unique O-antigen epitope and determines resistance to nonspecific serum killing. Infect. Immun. 57:3816-3822. |
| 15. | Mead, P. S., L. Slutsker, V. Dietz, L. F. McCaig, J. S. Bresee, C. Shapiro, P. M. Griffin, and R. V. Tauxe. 1999. Food-related illness and death in the United States. Emerg. Infect. Dis. 5:607-625.[Medline] |
| 16. | Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 170:2575-2583. |
| 17. | Nesper, J., C. M. Lauriano, K. E. Klose, D. Kapfhammer, A. Kraiss, and J. Reidl. 2001. Characterization of Vibrio cholerae O1 El tor galU and galE mutants: influence on lipopolysaccharide structure, colonization, and biofilm formation. Infect. Immun. 69:435-445. |
| 18. | Ornellas, E. P., and B. A. Stocker. 1974. Relation of lipopolysaccharide character to P1 sensitivity in Salmonella typhimurium. Virology 60:491-502.[CrossRef][Medline] |
| 19. | Paton, A. W., E. Voss, P. A. Manning, and J. C. Paton. 1998. Antibodies to lipopolysaccharide block adherence of Shiga toxin-producing Escherichia coli to human intestinal epithelial (Henle 407) cells. Microb. Pathog. 24:57-63.[CrossRef][Medline] |
| 20. | Paton, J. C., and A. W. Paton. 1998. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin. Microbiol. Rev. 11:450-479. |
| 21. | Perna, N. T., G. Plunkett III, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529-533.[CrossRef][Medline] |
| 22. | Perry, M. B., L. MacLean, and D. W. Griffith. 1986. Structure of the O-chain polysaccharide of the phenol-phase soluble lipopolysaccharide of Escherichia coli 0:157:H7. Biochem. Cell Biol. 64:21-28.[Medline] |
| 23. | Peschel, A. 2002. How do bacteria resist human antimicrobial peptides? Trends Microbiol. 10:179-186.[CrossRef][Medline] |
| 24. | Pluschke, G., and M. Achtman. 1984. Degree of antibody-independent activation of the classical complement pathway by K1 Escherichia coli differs with O antigen type and correlates with virulence of meningitis in newborns. Infect. Immun. 43:684-692. |
| 25. | Raetz, C. R. H. 1996. Bacterial lipopolysaccharides: a remarkable family of bioactive macroamphiles, p. 1035-1063. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. ASM Press, Washington, DC. |
| 26. | Rajashekara, G., D. A. Glover, M. Banai, D. O'Callaghan, and G. A. Splitter. 2006. Attenuated bioluminescent Brucella melitensis mutants GR019 (virB4), GR024 (galE), and GR026 (BMEI1090-BMEI1091) confer protection in mice. Infect. Immun. 74:2925-2936. |
| 27. | Ritchie, J. M., C. M. Thorpe, A. B. Rogers, and M. K. Waldor. 2003. Critical roles for stx2, eae, and tir in enterohemorrhagic Escherichia coli-induced diarrhea and intestinal inflammation in infant rabbits. Infect. Immun. 71:7129-7139. |
| 28. | Singer, M., T. A. Baker, G. Schnitzler, S. M. Deischel, M. Goel, W. Dove, K. J. Jaacks, A. D. Grossman, J. W. Erickson, and C. A. Gross. 1989. A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Mol. Biol. Rev. 53:1-24. |
| 29. | West, N. P., P. Sansonetti, J. Mounier, R. M. Exley, C. Parsot, S. Guadagnini, M. C. Prevost, A. Prochnicka-Chalufour, M. Delepierre, M. Tanguy, and C. M. Tang. 2005. Optimization of virulence functions through glucosylation of Shigella LPS. Science 307:1313-1317. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|