This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Enjalbert, B.
Right arrow Articles by Brown, A. J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Enjalbert, B.
Right arrow Articles by Brown, A. J. P.

 Previous Article  |  Next Article 

Infection and Immunity, May 2007, p. 2143-2151, Vol. 75, No. 5
0019-9567/07/$08.00+0     doi:10.1128/IAI.01680-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Niche-Specific Activation of the Oxidative Stress Response by the Pathogenic Fungus Candida albicans{triangledown}

Brice Enjalbert, Donna M. MacCallum, Frank C. Odds, and Alistair J. P. Brown*

Aberdeen Fungal Group, School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Aberdeen AB25 2ZD, United Kingdom

Received 20 October 2006/ Returned for modification 23 November 2006/ Accepted 22 February 2007


arrow
ABSTRACT
 
Candida albicans is a major opportunistic pathogen of humans. The pathogenicity of this fungus depends upon its ability to deal effectively with the host defenses and, in particular, the oxidative burst of phagocytic cells. We have explored the activation of the oxidative stress response in C. albicans in ex vivo infection models and during systemic infection of a mammalian host. We have generated C. albicans strains that contain specific green fluorescent protein (GFP) promoter fusions and hence act as biosensors of environmental oxidative stress at the single-cell level. Having confirmed that CTA1-, TRX1-, and TTR1/GRX2-GFP reporters respond specifically to oxidative stress, and not to heat shock, nitrosative, or osmotic stresses, we used these reporters to show that individual C. albicans cells activate an oxidative stress response following phagocytosis by neutrophils, but not by macrophages. Significantly, only a small proportion of C. albicans cells (about 4%) activated an oxidative stress response during systemic infection of the mouse kidney. The response of these cells was generally equivalent to exposure to 0.4 mM hydrogen peroxide in vitro. We conclude that most C. albicans cells are exposed to an oxidative stress when they come into contact with neutrophils in the bloodstream of the host but that oxidative killing is no longer a significant threat once an infection has been established in the kidney.


arrow
INTRODUCTION
 
Candida albicans is a frequent cause of superficial infections, such as vaginitis, diaper rash, and oral thrush. However, C. albicans infection can also cause deep-seated, life-threatening systemic infections in severely immunocompromised patients (8, 32). As well as regulating its cell morphology and other cellular virulence factors, C. albicans is thought to adapt its metabolism and stress responses to the diverse microenvironments it encounters in the host (7, 28).

Aerobic organisms are constantly exposed to reactive oxygen species that are generated as normal by-products of respiratory metabolism (17). However, oxidative stress responses are thought to be particularly important for pathogenic fungi, because oxidative stress has been predicted to be the stress condition they are most likely to encounter in vivo (for review, see reference 10). Therefore, considerable emphasis has been placed on the oxidative stress response in C. albicans (1, 3, 9, 10, 15, 37, 42).

Host phagocytic cells use reactive oxygen species as part of their armory to neutralize foreign microorganisms (16). Reactive oxygen species such as the superoxide anion (O2), hydrogen peroxide (H2O2), and the hydroxyl radical (HO) react with lipids, DNA, and proteins, leading to lethal microbial cell damage. To survive these assaults, C. albicans expresses enzymes that catalyze the detoxification of reactive oxygen species, such as superoxide dismutase (which converts superoxide into O2 and H2O2) and catalase (which converts the reactive H2O2 in neutral H2O and O2). C. albicans also generates scavengers of reactive oxygen species, such as glutaredoxin (a glutathione-dependent stress protectant) and thioredoxin (to reduce disulfide bonds created by the oxidative stress).

Genome-wide microarray studies have shown that many of these functions are induced at the transcriptional level when C. albicans responds to oxidative stresses in vitro (13, 15), e.g., genes involved in H2O2 and free radical detoxification (CTA1 and SOD2) and in the thioredoxin (TSA1, TRX1, and TTR1, also known as GRX2 in Saccharomyces cerevisiae) and glutaredoxin (GPX1 and GSH1) systems are transcriptionally induced in response to oxidative stress. Furthermore, the transcription factor Cap1, which is important for oxidative stress tolerance (1, 15, 42), is strongly induced in response to oxidative stress in vitro.

Some oxidative stress functions are induced in C. albicans when cells are exposed to human blood or following phagocytosis by granulocytes or neutrophils (19, 20, 35). This observation is consistent with the idea that reactive oxygen species play a significant role in the antimicrobial defenses of host phagocytic cells. However, C. albicans only displays a weak oxidative stress response following phagocytosis by macrophages (25). Nevertheless, the significance of oxidative stress responses in the virulence of C. albicans has been emphasized by the observation that mutations that inactivate such responses attenuate the virulence of this pathogen (20, 24, 27, 39-41). Therefore, in this study we have used single-cell profiling (4, 5) to examine the extent to which individual C. albicans cells activate an oxidative stress response within specific microenvironments relevant to the infection process. We show that while C. albicans cells are exposed to a significant oxidative stress following phagocytosis by neutrophils, few fungal cells are exposed to an oxidative stress after exposure to macrophages or once a kidney infection is established. We conclude that an oxidative stress response is a niche-specific phenomenon during the establishment and progression of a C. albicans systemic infection.


arrow
MATERIALS AND METHODS
 
Strain construction. C. albicans strain CAI-4 was used throughout (ura3::{lambda}imm434/ura3::{lambda} imm434) (18). Control plasmids pGFP and pACT1-GFP have been described previously (4). To generate pCTA1-GFP, the C. albicans CTA1 promoter (–1000 to –1, relative to the start codon) was PCR amplified with the primers CTA1 Xho1 5' (5' ATATCTCGAGAAAATCCTGGGTCACAGAAATATGG 3') and CTA1 Mlu1 3' (5' ATATACGCGTAATAAATAATTTATATATAAATAGG 3') and cloned between the XhoI and MluI sites of pGFP. To generate pTTR1-GFP, the TTR1/GRX2 promoter (–1000 to –1) was PCR amplified with the primers TTR1 Xho1 5' (5' ATATCTCGAGAACGGTGAGAAAGATCGTGGATTTGGTC 3') and TTR1 Mlu1 3' (5' ATATACGCGTCAAAAGAAAGAAAGAAAAGAAAAAAAAGGGGC 3') and cloned between the XhoI and MluI sites of pGFP. Similarly, to generate pTRX1-GFP, the TRX1 promoter region (–1000 to –1) was PCR amplified with the primers TRX1 Xho1 5' (5' ATATCTCGAGATGTACTTGAGGAGTAAAGTATAGAAAAACAG 3') and TRX1 Mlu1 3' (5' ATATACGCGTCTTTGAAAAAAAATATAACTATGTGTTAAGTG 3') and cloned into pGFP. Plasmids were linearized with StuI and integrated at the RPS1 locus in the strain CAI-4. This is a standard approach for the analysis of reporter genes in C. albicans (4, 5, 29). The genotypes of transformants were confirmed by PCR and Southern blotting, as described previously (4).

Growth and stress conditions. Unless otherwise stated, C. albicans was grown in yeast extract-peptone-dextrose (YPD) (36) at 30°C with shaking. Strains were grown overnight to stationary phase, diluted to an optical density at 600 nm of 0.1 in fresh YPD, and regrown to mid-exponential phase (OD at 600 nm, 0.8). For RNA analyses, stresses were applied for a 10-min period to allow comparison with published transcript profiling data. For the green fluorescent protein (GFP) fluorescence experiments, stresses were applied for 2 h to provide sufficient time for the synthesis and folding of GFP (4). Growing cells were heat shocked by transferring them from 23°C to either 37°C or 42°C. Osmotic stress was imposed by addition of NaCl to a final concentration of 0.3 M. Oxidative stress was imposed by addition of H2O2 to the concentrations specified. Nitrosative stress was generated as described by Hromatka et al. (22) using buffered YPD with the specified concentrations of (Z)-1-[N-(3-aminopropyl)-N-(3-ammoniopropyl)amino]diazen-1-ium-1,2-diolate (DPTA-NONOate). The yeast-to-hypha morphogenetic transition was induced in YPD by raising the growth temperature to 37°C and adding fetal bovine serum to a final concentration of 10% (vol/vol) or by transferring the cells to RPMI 1640 medium (6, 38).

Northern blotting. Northern analysis was performed as described previously (30). The GFP probe was PCR amplified with the primers GFP-R (5'-TTTGTACAATTCATC) and GFP-F (5'-TCTAAAGGTGAAGAATTATTCACTGG). The PCR product was labeled and detected by the ECL direct nucleic acid labeling and detection system (Amersham Bioscience).

Fluorescence microscopy for in vitro GFP assays. Yeast cells were prepared for fluorescence microscopy as previously described (4, 5). Individual yeast cells and hyphal compartments were defined by phase-contrast microscopy, and then the relative GFP fluorescence intensities generated by these compartments were quantified with Openlab 3.0.9 software (Improvision Ltd., Coventry, United Kingdom). Nonspecific fluorescence was subtracted, and mean fluorescence intensities were calculated for at least 50 individual cells (± standard deviation) (4). GFP fluorescence levels never exceeded the quantitative range of the assay.

Ex vivo infection models. Neutrophils were isolated from human blood (20). Stationary-phase C. albicans cells were washed with phosphate-buffered saline and mixed with neutrophils in a 1:1 ratio for 2 h at 37°C. Control C. albicans cells were treated with human plasma. Similarly, cultured murine J774A-1 macrophages (34) were mixed with C. albicans cells in a 1:1 ratio and analyzed after 3 h. Control C. albicans cells were treated in the macrophage growth medium (Dulbecco's modified Eagle's medium [DMEM] containing fetal bovine serum and glutamine). Cells were fixed, mounted, and quantified as previously described (4, 5).

Murine model of systemic candidiasis. Female BALB/c mice were infected with 2 x 104 C. albicans cells/g body weight by tail vein injection as described by Barelle and coworkers (5). For the analysis of infections after 1 day, inocula of 2 x 105 cells/g were also used to obtain sufficient fungal cells for single-cell profiling. This increase in inoculum size did not influence the proportion of C. albicans cells that displayed GFP fluorescence in the kidney (not shown). Fungal burdens and in vivo kidney sections were analyzed after 1 or 4 days of infection (26). Frozen sections were stained with Calcofluor white to identify fungal cells (21). GFP fluorescence intensities for individual C. albicans cells were determined as described previously (5). Regions of sections displaying high levels of yellow autofluorescence were not quantified. Images were generated at 461 nm (Calcofluor white staining), 516 nm (GFP), and 573 nm (rhodamine, as a control for GFP specificity). GFP and rhodamine images were overlaid using Adobe Photoshop 7.0 software (Adobe Systems, Inc.) to highlight the GFP-specific signals. For histopathology, 5-µm paraffin wax-embedded kidney sections were stained with periodic acid-Schiff's reagent and then poststained with hematoxylin to reveal host cell nuclei in addition to fungal cells.

In silico analysis of transcript profiling data. Published transcript profiling data sets were analyzed with Genespring software (Silicon Genetics) to identify C. albicans genes that are induced in response to oxidative stress (13-15, 20, 22, 31).


arrow
RESULTS
 
Identification of candidate oxidative stress biomarkers. To identify C. albicans genes that might be suitable for use as oxidative stress biomarkers, we took advantage of the growing number of transcript profiling data sets available for this pathogen. We focused especially on those experiments that have examined the global transcriptional responses of C. albicans to stresses, morphogenesis, and host-pathogen interactions (13-15, 20, 22, 31; C. Vaughan and D. Sullivan, personal communication). First, from the circa 6,300 genes present on the C. albicans microarray we identified 331 genes that are significantly induced in response to an oxidative stress. From this subset we selected 80 genes that are not induced in response to other conditions and which, therefore, appear to be relatively specific for the oxidative stress response. From this subset of C. albicans genes we selected three genes with well-defined functions in oxidative stress adaptation (Fig. 1): CTA1 (encoding a catalase), TTR1/GRX2 (encoding a glutaredoxin), and TRX1 (encoding a thioredoxin). These genes display relatively strong induction by both mild and strong oxidative stresses, and their transcripts appear to be only transiently induced by nitrosative stress (Fig. 1). The CTA1, TTR1/GRX2, and TRX1 genes are also activated when C. albicans cells are exposed to human blood, probably through the interaction with neutrophil cells (Fig. 1) (19, 20). With the possible exception of TTR1/GRX2, these genes are not transcriptionally regulated, as cells resume growth or during serum-induced morphogenesis (Fig. 1). Therefore, based on available transcript profiling data, the TTR1/GRX2 and TRX1 genes appear to respond specifically to oxidative stress. Although the CTA1 transcript is induced in response to a moderate osmotic stress as well as to oxidative stress (Fig. 1) (15), this promoter was also selected for further analysis. In addition, the ACT1 promoter was chosen as a positive control because this gene appears to be expressed at roughly similar levels under the conditions analyzed (Fig. 1).


Figure 1
View larger version (74K):
[in this window]
[in a new window]

 
FIG. 1. Transcript profiling data for selected oxidative stress genes. Gene annotations and names are given at the top of the figure, along with the data sources. Data from reference a are a personal communication from C. Vaughan and D. Sullivan (unpublished data). Values indicate the expression ratio for each condition relative to the control (before the perturbation): HS (heat shock from 25°C to 37°C) at 10 and 30 min; HS+ (strong heat shock from 25°C to 42°C) at 30 min; OS (osmotic stress of 0.3 M NaCl) at 10 and 30 min; OS+ (strong osmotic stress of 1 M NaCl) at 30 min; XS (oxidative stress of 0.4 mM H2O2) at 10 and 30 min; XS+ (strong oxidative stress of 5 mM H2O2) at 30 min; NO (nitrosative stress of 1 mM DPTA-NONOate) at 10, 40, and 70 min; blood (exposure to human blood) at 30 min; PMN (exposure to polymorphonuclear cells, mainly neutrophils) at 30 min; MNC (exposure to mononuclear cells, mainly macrophages) at 30 min; 30°C (resumption of growth from stationary phase at 30°C) for 10, 60, and 180 min; 37°C (resumption of growth from stationary phase at 37°C) for 10, 60, and 180 min; FBS (switch to 37°C plus 10% fetal bovine serum to trigger hyphae formation) at 30, 60, and 360 min.

Construction and validation of GFP reporters. The CTA1, TTR1/GRX2, and TRX1 promoter regions (from –1000 to +1 with respect to the translation initiation codon) were fused to the GFP open reading frame in the plasmid pGFP, and each fusion was integrated into the C. albicans genome at the RPS1 locus to generate a set of GFP-marked strains (see Materials and Methods). Northern blot analyses compared the expression pattern of each GFP mRNA with the transcript profiling data (Fig. 2). The TTR1/GRX2- and TRX1-GFP mRNAs were induced in response to oxidative stresses, but not after exposure to the osmotic stress. The CTA1-GFP mRNA was strongly induced in response to oxidative stress and to a minor extent by osmotic stress. The ACT1-GFP mRNA was expressed constitutively under these conditions (Fig. 2). The Northern analyses are consistent with the transcript profiling data for this set of genes.


Figure 2
View larger version (43K):
[in this window]
[in a new window]

 
FIG. 2. Northern analysis of GFP reporters. Northern analysis was performed to test expression of the CTA1-, TTR1/GRX2-, and TRX1-GFP reporters as well as the pGFP and ACT1-GFP controls. The five C. albicans reporter strains were exposed to no stress (-), an osmotic stress (OS; 0.3 M NaCl), a mild oxidative stress (XS; 0.4 mM H2O2), or a strong oxidative stress (XS+; 5 mM H2O2). Membranes were probed with a GFP probe (see Materials and Methods).

Next, we examined the green fluorescence generated by these CTA1-, TTR1/GRX2-, and TRX1-GFP strains following exposure to various stresses in vitro by quantitative fluorescence microscopy. Once again, the pGFP and ACT1-GFP strains were used as negative and positive controls, respectively. As expected, cells containing the promoterless pGFP plasmid generated no significant GFP fluorescence. In contrast, ACT1-GFP cells expressed relatively high levels of fluorescence under all of the conditions examined (Fig. 3). The CTA1-, TTR1/GRX2-, and TRX1-GFP fusions were induced in response to both high and low oxidative stresses (Fig. 3, lanes 2 and 3; 5.0 and 0.4 mM H2O2, respectively). Significantly, the fluorescence levels generated by these reporters were not elevated in response to nitrosative, osmotic, or heat stresses (relative to unstressed control cells) (Fig. 3). Therefore, the short-term induction of the CTA1 and TRX1 mRNAs in response to nitrosative stress was not reflected in a significant increase in GFP protein levels (Fig. 1 and 3), and the low level of induction of the CTA1-GFP mRNA in response to osmotic stress did not lead to a significant increase in GFP fluorescence (Fig. 2 and 3). These results suggested that the CTA1-, TTR1/GRX2-, and TRX1-GFP reporters could be used specifically to monitor the exposure of C. albicans cells to oxidative stress.


Figure 3
View larger version (68K):
[in this window]
[in a new window]

 
FIG. 3. Responses of the CTA1-, TTR1/GRX2-, and TRX1-GFP reporters to stresses in vitro. The expression of these three oxidative stress reporters was compared with the pGFP and ACT1-GFP controls under a range of stress conditions in vitro: -, no stress; XS, mild oxidative stress (0.4 mM H2O2); XS+, strong oxidative stress (5 mM H2O2); NS, mild nitrosative stress (1 mM DPTA-NONOate); NS+, strong nitrosative stress (5 mM DPTA-NONOate); HS, mild heat shock (25°C to 37°C); HS+, strong heat shock (25°C to 42°C); OS, osmotic stress (0.3 M NaCl). GFP intensities were determined as described in Materials and Methods. Fluorescence micrographs of the C. albicans transformants exposed to 0 (control) or 5 mM H2O2 (XS+) are shown.

Oxidative dose responses for the GFP reporters. We challenged the GFP-marked strains with a range of H2O2 concentrations to generate dose-response curves for the three reporters. The CTA1-, TTR1/GRX2-, and TRX1-GFP strains displayed fluorescence responses that were roughly proportionate to the dose of H2O2 (Fig. 4A). The CTA1- and TTR1/GRX2-GFP reporters reached their maximum expression level at a dose of 2 mM H2O2, whereas the maximum response of TRX1-GFP cells was observed at 5 mM H2O2.


Figure 4
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 4. Dose responses for the oxidative stress reporters. The expression of the CTA1-, TTR1/GRX2-, and TRX1-GFP reporters was compared to the pGFP and ACT1-GFP controls following exposure to a range of H2O2 concentrations. The C. albicans strains were grown in glucose (YPD; left panel) or lactate (YPL; right panel). Numbers in the right panel indicate the fold change in GFP fluorescence observed during growth on lactate compared with glucose.

Reactive oxygen species are produced to a greater extent under respiratory conditions (17). Hence, we tested whether the CTA1-, TTR1/GRX2-, and TRX1-GFP reporters are differentially regulated under fermentative and nonfermentative conditions. The previous dose-response curves were obtained during growth on glucose (YPD) (Fig. 4A). Therefore, we repeated the dose-response curves with C. albicans cells grown on lactate (YPL) (Fig. 4B). The levels of green fluorescence generated by TTR1/GRX2-GFP and TRX1-GFP cells were not greatly affected by carbon source. There was a slight increase in TRX1-GFP expression levels during growth on lactate, but in general TTR1/GRX2-GFP and TRX1-GFP cells displayed similar dose-response curves whether they were grown on lactate or glucose. In contrast, the expression of the CTA1-GFP reporter was significantly up-regulated on lactate. Lactate-grown CTA1-GFP cells still displayed a response that was roughly proportional to the dose of H2O2, but the fluorescence levels were elevated approximately threefold compared with glucose-grown cells (Fig. 4). The data suggest that the C. albicans CTA1 promoter responds to both oxidative stress and to carbon source. This observation has been confirmed recently by expression profiling of C. albicans cells (A. Rodaki, B. Enjalbert, and A. Brown, unpublished data). Taken together, our data indicate that in principle, the combination of CTA1-, TTR1/GRX2-, and TRX1-GFP reporters could be used as oxidative stress biomarkers to titrate the approximate level of oxidative stress in particular microenvironments.

Expression of oxidative stress biomarkers in ex vivo infection models. Transcript profiling experiments performed on C. albicans cells exposed to immune cells have suggested that the CTA1, TTR1/GRX2, and TRX1 genes are induced following phagocytosis by neutrophils (20, 25) but, with the possible exception of CTA1 (25), these genes are not induced following phagocytosis by macrophages. These transcript profiling experiments have provided information about the behavior of the fungal cell population as a whole, but our GFP reporters provided the opportunity to examine the behavior of individual cells within the population. Also, transcript profiling experiments have not provided much information on the strength of the oxidative stress perceived by C. albicans following phagocytosis by host immune cells. Therefore, we used the CTA1-, TTR1/GRX2-, and TRX1-GFP reporters to analyze the behavior of C. albicans cells following phagocytosis and to titrate the level of oxidative stress after phagocytosis. No significant GFP fluorescence was observed following the engulfment of CTA1-, TTR1/GRX2-, or TRX1-GFP cells by macrophages, although significant fluorescence was observed for the positive ACT1-GFP control (Fig. 5). However, following phagocytosis by neutrophils, the CTA1- and TRX1-GFP reporters in most C. albicans cells were strongly induced, and the TTR1/GRX2-GFP reporter was moderately induced. These results are consistent with the transcript profiling data of Fradin and coworkers (20) (Fig. 1). Quantification of the fluorescence levels in phagocytosed C. albicans cells suggested that they were exposed to an oxidative stress that is equivalent to about 0.4 mM H2O2.


Figure 5
View larger version (49K):
[in this window]
[in a new window]

 
FIG. 5. Responses of oxidative stress reporters in ex vivo models. The expression of the CTA1-, TTR1/GRX2-, and TRX1-GFP reporters was compared to the pGFP and ACT1-GFP controls before and after phagocytosis by macrophages or neutrophils as described in the text (see Materials and Methods). (A) GFP fluorescence generated by the C. albicans reporter strains was measured in cells inoculated for 3 h in DMEM with no macrophages (MNC-), DMEM containing macrophages (MNC+), plasma lacking neutrophils (PMN-), or plasma containing neutrophils (PMN+). (B) GFP intensities were quantified as described in the text (see Materials and Methods) in the above cells and under other types of control conditions: 1, 30°C, mid-exponential yeast cells; 2, 37°C, hyphae cells in YPD at 37°C; 3, 37°C plus serum, hyphae in YPD at 37°C with fetal bovine serum; 4, RPMI, hyphae in RMPI 1640 at 37°C; 5, MNC-, hyphae in DMEM at 37°C; 6, MNC+, cells in macrophages; 7, PMN-, cells in plasma; 8, PMN+, cells in neutrophils.

Exposure to oxidative stress during disseminated infection. Having used the CTA1-, TTR1/GRX2-, and TRX1-GFP reporters successfully in vitro and in ex vivo infection models, we investigated the behavior of these reporters in the mouse model of systemic candidiasis. Mice were infected with the C. albicans reporter strains by intravenous injection, and their kidneys were examined after 1 or 4 days. Two inoculum sizes were used (see Materials and Methods). With a standard inoculum (2 x 104 C. albicans cells/g) after 4 days sufficient fungal loads had built up in the kidneys of infected animals to provide adequate population sizes for GFP analysis (1.4 x 106 to 8.2 x 106 CFU/g kidney tissue). Both standard and 10-fold-increased inocula were compared to facilitate the analysis after 1 day of infection. After 1 day the standard inoculum generated fungal burdens of between 2.6 x 105 and 5.3 x 105 CFU/g kidney tissue, whereas the higher inoculum generated burdens of 3.5 x 106 to 5.3 x 106 CFU/g kidney tissue.

Tissue sections were stained with Calcofluor white to detect fungal cells within the kidney tissue (Fig. 6). A small proportion of C. albicans cells were dispersed in the kidneys, but even after 1 day most were present in foci of infection. C. albicans cells carrying the negative pGFP control displayed no GFP fluorescence (Fig. 6A), whereas all cells with the ACT1-GFP reporter displayed significant levels of fluorescence, as expected (Fig. 6B) (4, 5). Only about 4% of C. albicans cells carrying an oxidative stress reporter displayed GFP fluorescence. This was the case 1 and 4 days after infection (Fig. 7A). Furthermore, the inoculum size did not influence the proportion of GFP-fluorescing cells in the kidney. For example, only 5 of 113 CTA1-GFP-containing cells examined after 1 day of infection expressed GFP. Induced cells were generally clustered together in groups (Fig. 6D), suggesting that C. albicans cells are exposed to a significant external oxidative stress only within specific microenvironments in the kidney. Quantification of these GFP signals suggested that the fungal cells in these microenvironments were exposed to oxidative stresses that were equivalent to about 0.4 mM H2O2. There was no significant difference in the strength of the oxidative stress response between the early and late infection time points (Fig. 7B). Similar observations were made for the CTA1-, TTR1/GRX2-, and TRX1-GFP reporters. The data indicate that, once infection has been established in the kidney, C. albicans cells are rarely exposed to a significant external oxidative stress.


Figure 6
View larger version (71K):
[in this window]
[in a new window]

 
FIG. 6. Expression of GFP reporters in C. albicans cells infecting mouse kidney. Collages of three images are presented: Calcofluor white staining of C. albicans cells (white), GFP fluorescence (green), and nonspecific background fluorescence (red). (A) ACT1-GFP (positive control) after 1 day of infection. (B) pGFP (negative control) after 4 days of infection. (C and D) Two images of TRX1-GFP after 1 day of infection. Arrows illustrate examples of GFP-positive cells (filled arrows) and GFP-negative cells (open arrows).


Figure 7
View larger version (31K):
[in this window]
[in a new window]

 
FIG. 7. Expression of oxidative stress reporters in C. albicans cells infecting mouse kidney. The CTA1-, TTR1/GRX2-, and TRX1-GFP reporter strains and the pGFP and ACT1-GFP controls were used to infect mice by tail vein injection (see Materials and Methods). Kidney sections were prepared, and the fungal cells were detected and quantified. Data are from animals infected for 4 days with the standard inoculum (dark gray bars) and 1 day with the elevated inoculum (light gray bars). (A) Proportion of fungal cells displaying GFP fluorescence. (B) Quantification of GFP fluorescence intensity in those fungal cells that were induced.

Histopathological examination of infected kidneys revealed obvious polymorphonuclear leukocyte (PMN) infiltrates 1 day and 4 days after C. albicans challenge (Fig. 8). Foci of fungal growth were obvious at both times, but the sizes of the lesions on day 4 were larger than on day 1. The majority of the fungal foci (>60%) were associated with PMN infiltrates.


Figure 8
View larger version (146K):
[in this window]
[in a new window]

 
FIG. 8. Visualization of fungal and host cells in kidney sections from animals infected for 1 (upper panel) and 4 (lower panel) days, based on periodic acid-Schiff and hematoxylin stain. At both times a majority of fungal hyphae (strong pink) were surrounded by infiltrates of PMNs (dark staining; blue arrows), but examples of hyphae without surrounding infiltrates were also observed (white arrows).


arrow
DISCUSSION
 
The ability to respond appropriately to environmental stress has been shown to be an important factor in the virulence of C. albicans. Mutations that disrupt stress signaling attenuate the virulence of this pathogen (2). Furthermore, C. albicans virulence is attenuated by the inactivation of catalase (CAT1) or superoxide dismutases (SOD1 and SOD5) (20, 24, 27, 39, 40). These observations suggest that oxidative stress responses in particular are important for the establishment of systemic infections. Therefore, we have investigated the extent to which C. albicans cells are exposed to oxidative stresses in specific niches associated with the establishment and progression of systemic disease.

Our approach was to use single-cell profiling to examine the behavior of individual fungal cells in these niches. This approach exploits the specific regulatory profiles of particular promoters, which are then fused to the synthetic, codon-optimized yEGFP gene (11). These GFP fusions are then used to report the activation of particular molecular responses in C. albicans (4, 5). In this study we selected three C. albicans promoters which, on the basis of genome-wide expression profiling, respond relatively specifically to oxidative stress: CTA1, TRX1, and TTR1/GRX2 (Fig. 1). Our analyses of the TRX1- and TTR1/GRX2-GFP reporter strains under a range of experimental conditions in vitro confirmed that they respond specifically to oxidative stresses (Fig. 2 and 3). The CTA1-GFP reporter also responded to oxidative stress but was also activated during growth on lactate, indicating that this gene is regulated by carbon source as well as oxidative stress (Fig. 3). This reporter was not activated strongly in response to osmotic stress (Fig. 2 and 3), unlike the wild-type CTA1 transcript (Fig. 1), suggesting that the wild-type transcript might be regulated at the posttranscriptional level under these conditions. Despite its regulation by carbon source, the CTA1-GFP reporter could be used in combination with the TRX1- and TTR1/GRX2-GFP reporters to define the proportion of C. albicans cells that are exposed to an environmental oxidative stress. Furthermore, the activation of all three reporters was proportional to the level of oxidative stress, at least up to about 2 to 5 mM H2O2 (Fig. 4). This allowed us to estimate the relative strength of the environmental oxidative stress to which the C. albicans cells were exposed.

Having defined the specificity and amplitude of the CTA1-, TRX1-, and TTR1/GRX2-GFP reporter strains, we examined them in well-established ex vivo neutrophil and macrophage models. We chose these models because they are thought to reflect initial contact between C. albicans and host immune cells in the bloodstream and tissues early in a systemic infection. None of the reporter strains was activated following phagocytosis by macrophages (Fig. 5). The expression profiling performed by Lorenz et al. (25) suggests that C. albicans CTA1 mRNA levels are increased following phagocytosis by macrophages, whereas the transcript profiling data set of Fradin and coworkers (20) suggests that this mRNA is not induced inside macrophages. Our single-cell profiling data are consistent with the latter conclusion. Our data also reinforce the view that neither TRX1 nor TTR1/GRX2 is induced in macrophages (20, 25). Taken together, the data confirm that C. albicans cells are not exposed to a significant oxidative stress after phagocytosis by macrophages.

In contrast C. albicans cells are exposed to an oxidative stress when they are engulfed by neutrophils (Fig. 5). All three oxidative stress reporters were activated under these circumstances, and again, this was entirely consistent with the work of Fradin et al. (20). As part of their genome-wide expression profiling, they reported that the CTA1, TRX1, and TTR1/GRX2 mRNAs are all induced in response to neutrophils. By quantifying the degree of activation of the CTA1-, TRX1-, and TTR1/GRX2-GFP reporter strains, we were able to show that the behavior of the population of phagocytosed cells is relatively homogeneous and that C. albicans is exposed to a relatively mild oxidative stress under these conditions (Fig. 5). This stress, which is equivalent to approximately 0.4 mM H2O2, is insufficient to activate the stress-activated protein kinase Hog1 (37). Although C. albicans cells were exposed to a relatively mild oxidative stress, few were able to survive phagocytosis by neutrophils. This is in contrast to phagocytosis by macrophages, which the C. albicans cells were generally able to survive in vitro. This is consistent with the idea that neutrophils use a combination of defense mechanisms to control C. albicans (16). The stringency of the environment within the neutrophil (20) or the additional exposure to nitrosative stress (22) might contribute to the anti-Candida activity of neutrophils. Our CTA1-, TRX1-, and TTR1/GRX2-GFP reporter strains were not triggered by a nitrosative stress (Fig. 3), indicating that the reporters are able to differentiate between these two defense mechanisms.

The relative importance of neutrophils and macrophages in defense against experimental C. albicans infections has been examined directly in the past. Carrageenan is a polysaccharide that is toxic for macrophages but which also stimulates a neutrophil leukocytosis. It has been shown to reduce the susceptibility of mice to intravenous C. albicans challenge, indicating that the increase in neutrophils is of more importance than the decrease in macrophages (23). With filter chambers implanted intraperitoneally in mice, Cutler and Poor (12) found neutrophils were more strongly candidacidal than macrophages, an observation subsequently confirmed in tests with human peritoneal neutrophils and macrophages (33).

Analysis of the oxidative stress reporter strains in the mouse model of systemic infection indicated that approximately 95% of C. albicans cells infecting the kidney are not exposed to a significant oxidative stress (Fig. 7). This was the case early (1 day) and late (4 days) in the infection process. Furthermore, this was not affected by inoculum size. Clearly, oxidative stress is not a constant threat to this pathogen during systemic infection. Histopathology showed that many fungal cells were apparently exposed to a PMN-based attack in infected kidneys (Fig. 8). However, unlike the situation ex vivo, in which PMNs definitely engulf C. albicans cells and induce an oxidative stress response, only a small proportion of cells was exposed to an oxidative stress in the kidney (Fig. 6D), with most foci of infection displaying no oxidative stress induction (Fig. 6C). The histopathology revealed few PMNs in direct contact with the C. albicans cells, which might account for this difference.

Hence, we conclude that C. albicans activates an oxidative stress response in a niche-specific manner during disease establishment and progression. The fungal cells are more likely to be exposed to an oxidative stress early in the establishment of a systemic infection, when they come into direct contact with neutrophils circulating in the bloodstream. At this stage, the ability to adapt appropriately to this oxidative stress might promote the survival of the pathogen and the subsequent development of a deep-seated infection. However, once an infection has been established in the kidney, PMNs surround the fungi but do not stimulate oxidative stress adaptation.


arrow
ACKNOWLEDGMENTS
 
We thank Caroline Barelle for her help and advice. We are also grateful to Derek Sullivan, Bernhard Hube, Chantal Fradin, and Alexander Johnson for kindly sharing their transcript profiling data with us.

B.E. was funded by the European Commission (MRTN-CT-2003-504148), and A.B. was also funded by the British Council (CRP004), the BBSRC (BB/C510391/1), and the Wellcome Trust (055015, 080088).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Aberdeen Fungal Group, School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Foresterhill, Aberdeen AB25 2ZD, United Kingdom. Phone: 44-1224-555883. Fax: 44-1224-555844. E-mail: al.brown{at}abdn.ac.uk Back

{triangledown} Published ahead of print on 5 March 2007. Back

Editor: A. Casadevall


arrow
REFERENCES
 
    1
  1. Alarco, A. M., and M. Raymond. 1999. The bZip transcription factor Cap1p is involved in multidrug resistance and oxidative stress response in Candida albicans. J. Bacteriol. 181:700-708.[Abstract/Free Full Text]
  2. 2
  3. Alonso-Monge, R., F. Navarro-Garcia, G. Molero, R. Diez-Orejas, M. Gustin, J. Pla, M. Sanchez, and C. Nombela. 1999. Role of the mitogen-activated protein kinase Hog1p in morphogenesis and virulence of Candida albicans. J. Bacteriol. 181:3058-3068.[Abstract/Free Full Text]
  4. 3
  5. Alonso-Monge, R., F. Navarro-Garcia, E. Roman, A. I. Negredo, B. Eisman, C. Nombela, and J. Pla. 2003. The Hog1 mitogen-activated protein kinase is essential in the oxidative stress response and chlamydospore formation in Candida albicans. Eukaryot. Cell 2:351-361.[Abstract/Free Full Text]
  6. 4
  7. Barelle, C. J., C. L. Manson, D. M. MacCallum, F. C. Odds, N. A. R. Gow, and A. J. P. Brown. 2004. GFP as a quantitative reporter of gene regulation in Candida albicans. Yeast 21:333-340.[CrossRef][Medline]
  8. 5
  9. Barelle, C. J., C. L. Priest, D. M. MacCallum, N. A. R. Gow, F. C. Odds, and A. J. P. Brown. 2006. Niche-specific regulation of central metabolic pathways in a fungal pathogen. Cell Microbiol. 8:961-971.[CrossRef][Medline]
  10. 6
  11. Beno, D. W., A. G. Stover, and H. L. Mathews. 1995. Growth inhibition of Candida albicans hyphae by CD8+ lymphocytes. J. Immunol. 154:5273-5281.[Abstract]
  12. 7
  13. Brown, A. J. P. 2005. Fungal genomics, Mycota XIII, p. 185-203. Springer-Verlag, Heidelberg, Germany.
  14. 8
  15. Calderone, R. A. 2002. Candida and candidiasis. ASM Press, Washington, DC.
  16. 9
  17. Chauhan, N., D. Inglis, E. Roman, J. Pla, D. Li, J. A. Calera, and R. Calderone. 2003. Candida albicans response regulator gene SSK1 regulates a subset of genes whose functions are associated with cell wall biosynthesis and adaptation to oxidative stress. Eukaryot. Cell 2:1018-1024.[Abstract/Free Full Text]
  18. 10
  19. Chauhan, N., J. P. Latge, and R. Calderone. 2006. Signalling and oxidant adaptation in Candida albicans and Aspergillus fumigatus. Nat. Rev. Microbiol. 4:435-444.[CrossRef][Medline]
  20. 11
  21. Cormack, B., G. Bertram, M. Egerton, N. A. R. Gow, S. Falkow, and A. J. P. Brown. 1997. Yeast enhanced green fluorescent protein (yEGFP): a reporter of gene expression in Candida albicans. Microbiology 143:303-311.[Abstract/Free Full Text]
  22. 12
  23. Cutler, J. E., and A. H. Poor. 1981. Effect of mouse phagocytes on Candida albicans in in vivo chambers. Infect. Immun. 31:1110-1116.[Abstract/Free Full Text]
  24. 13
  25. Enjalbert, B., A. Nantel, and M. Whiteway. 2003. Stress-induced gene expression in Candida albicans: absence of a general stress response. Mol. Biol. Cell 14:1460-1467.[Abstract/Free Full Text]
  26. 14
  27. Enjalbert, B., and M. Whiteway. 2005. Release from quorum-sensing molecules triggers hyphal formation during Candida albicans resumption of growth. Eukaryot. Cell 4:1203-1210.[Abstract/Free Full Text]
  28. 15
  29. Enjalbert, B., D. A. Smith, M. J. Cornell, I. Alam, S. Nicholls, A. J. P. Brown, and J. Quinn. 2006. Role of the Hog1 stress-activated protein kinase in the global transcriptional response to stress in the fungal pathogen Candida albicans. Mol. Biol. Cell 17:1018-1032.[Abstract/Free Full Text]
  30. 16
  31. Fang, F. C. 2004. Antimicrobial reactive oxygen and nitrogen species: concepts and controversies. Nat. Rev. Microbiol. 2:820-832.[CrossRef][Medline]
  32. 17
  33. Finkel, T., and N. J. Holbrook. 2000. Oxidants, oxidative stress and the biology of ageing. Nature 408:239-247.[CrossRef][Medline]
  34. 18
  35. Fonzi, W. A., and M. Y. Irwin. 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717-728.[Abstract]
  36. 19
  37. Fradin, C., M. Kretschmar, T. Nichterlein, C. Gaillardin, C. d'Enfert, and B. Hube. 2003. Stage-specific gene expression of Candida albicans in human blood. Mol. Microbiol. 47:1523-1543.[CrossRef][Medline]
  38. 20
  39. Fradin, C., P. De Groot, D. M. MacCallum, M. Schaller, F. Klis, F. C. Odds, and B. Hube. 2005. Granulocytes govern the transcriptional response, morphology and proliferation of Candida albicans in human blood. Mol. Microbiol. 56:397-415.[CrossRef][Medline]
  40. 21
  41. Gow, N. A. R., and G. W. Gooday. 1982. Growth kinetics and morphology of colonies of the filamentous form of Candida albicans. J. Gen. Microbiol. 128:2187-2194.[Abstract/Free Full Text]
  42. 22
  43. Hromatka, B. S., S. M. Noble, and A. D. Johnson. 2005. Transcriptional response of Candida albicans to nitric oxide and the role of the YHB1 gene in nitrosative stress and virulence. Mol. Biol. Cell 16:4814-4826.[Abstract/Free Full Text]
  44. 23
  45. Hurtrel, B., and P. H. Lagrange. 1981. Comparative effects of carrageenan on systemic candidiasis and listeriosis in mice. Clin. Exp. Immunol. 44:355-358.[Medline]
  46. 24
  47. Hwang, C. S., G. E. Rhie, J. H. Oh, W. K. Huh, H. S. Yim, and S. O. Kang. 2002. Copper- and zinc-containing superoxide dismutase (Cu/ZnSOD) is required for the protection of Candida albicans against oxidative stresses and the expression of its full virulence. Microbiology 148:3705-3713.[Abstract/Free Full Text]
  48. 25
  49. Lorenz, M. C., J. A. Bender, and G. R. Fink. 2004. Transcriptional response of Candida albicans upon internalization by macrophages. Eukaryot. Cell 3:1076-1087.[Abstract/Free Full Text]
  50. 26
  51. MacCallum, D. M., and F. C. Odds. 2005. Temporal events in the intravenous challenge model for experimental Candida albicans infections in female mice. Mycoses 48:151-161.[CrossRef][Medline]
  52. 27
  53. Martchenko, M., A. M. Alarco, D. Harcus, and M. Whiteway. 2004. Superoxide dismutases in Candida albicans: transcriptional regulation and functional characterization of the hyphal-induced SOD5 gene. Mol. Biol. Cell 15:456-467.[Abstract/Free Full Text]
  54. 28
  55. Mavor, A. L., S. Thewes, and B. Hube. 2005. Systemic fungal infections caused by Candida species: epidemiology, infection process and virulence attributes. Curr. Drug Targets 6:863-874.[CrossRef][Medline]
  56. 29
  57. Murad, A. M. A., P. R. Lee, I. D. Broadbent, C. J. Barelle, and A. J. P. Brown. 2000. CIp10, an efficient and convenient integrating vector for Candida albicans. Yeast 16:325-327.[CrossRef][Medline]
  58. 30
  59. Murad, A. M. A., P. Leng, M. Straffon, J. Wishart, S. Macaskill, D. MacCallum, N. Schnell, D. Talibi, D. Marechal, F. Tekaia, C. d'Enfert, C. Gaillardin, F. C. Odds, and A. J. P. Brown. 2001. NRG1 represses yeast-hypha morphogenesis and hypha-specific gene expression in Candida albicans. EMBO J. 20:4742-4752.[CrossRef][Medline]
  60. 31
  61. Nantel, A., D. Dignard, C. Bachewich, D. Harcus, A. Marcil, A.-P. Bouin, C. W. Sensen, H., Hogues, M. van het Hoog, P. Gordon, T. Rigby, F. Benoit, D. C. Tessier, D. Y. Thomas, and M. Whiteway. 2002. Transcript profiling of Candida albicans cells undergoing the yeast-to-hyphal transition. Mol. Biol. Cell 13:3452-3465.[Abstract/Free Full Text]
  62. 32
  63. Odds, F. C. 1988. Candida and candidosis, 2nd ed. Bailliere Tindall, London, England.
  64. 33
  65. Peterson, P. K., D. Lee, H. J. Suh, M. Devalon, R. D. Nelson, and W. F. Keane. 1986. Intracellular survival of Candida albicans in peritoneal macrophages from chronic peritoneal dialysis patients. Am. J. Kidney Dis. 7:146-152.
  66. 34
  67. Ralph, P., J. Prichard, and M. Cohn. 1975. Reticulum cell sarcoma: an effector cell in antibody-dependent cell-mediated immunity. J. Immunol. 114:898-905.[Abstract/Free Full Text]
  68. 35
  69. Rubin-Bejerano, I., I. Fraser, P. Grisafil, and G. R. Fink. 2003. Phagocytosis by neutrophils induces an amino acid deprivation response in Saccharomyces cerevisiae and Candida albicans. Proc. Natl. Acad. Sci. USA 100:11007-11012.[Abstract/Free Full Text]
  70. 36
  71. Sherman, F. 1991. Getting started with yeast. Methods Enzymol. 194:3-21.[CrossRef][Medline]
  72. 37
  73. Smith, D. A., S. Nicholls, B. A. Morgan, A. J. P. Brown, and J. Quinn. 2004. A conserved stress-activated protein kinase regulates a core stress response in the human pathogen Candida albicans. Mol. Biol. Cell 15:4179-4190.[Abstract/Free Full Text]
  74. 38
  75. Swoboda, R. K., G. Bertram, S. Delbruck, J. F. Ernst, N. A. R. Gow, G. W. Gooday, and A. J. P. Brown. 1994. Fluctuations in glycolytic mRNA levels during the yeast-to-hyphal transition in Candida albicans reflect underlying changes in growth rather than a response to cellular dimorphism. Mol. Microbiol. 13:663-672.[Medline]
  76. 39
  77. Van Dijck, P., L. De Rop, K. Szlufcik, E. Van Ael, and J. M. Thevelein. 2002. Disruption of the Candida albicans TPS2 gene encoding trehalose-6-phosphate phosphatase decreases infectivity without affecting hypha formation. Infect. Immun. 70:1772-1782.[Abstract/Free Full Text]
  78. 40
  79. Wysong, D. R., L. Christin, A. M. Sugar, P. W. Robbins, and R. D. Diamond. 1998. Cloning and sequencing of a Candida albicans catalase gene and effects of disruption of this gene. Infect. Immun. 66:1953-1961.[Abstract/Free Full Text]
  80. 41
  81. Zaragoza, O., M. A. Blasquez, and C. Gancedo. 1998. Disruption of the Candida albicans TPS1 gene encoding trehalose-6-phosphate synthase impairs formation of hyphae and decreases virulence. J. Bacteriol. 180:3809-3815.[Abstract/Free Full Text]
  82. 42
  83. Zhang, X., M. De Micheli, S. T. Coleman, D. Sanglard, and W. S. Moye-Rowley. 2000. Analysis of the oxidative stress regulation of the Candida albicans transcription factor, Cap1p. Mol. Microbiol. 36:618-629.[CrossRef][Medline]


Infection and Immunity, May 2007, p. 2143-2151, Vol. 75, No. 5
0019-9567/07/$08.00+0     doi:10.1128/IAI.01680-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Rodaki, A., Bohovych, I. M., Enjalbert, B., Young, T., Odds, F. C., Gow, N. A.R., Brown, A. J.P. (2009). Glucose Promotes Stress Resistance in the Fungal Pathogen Candida albicans. Mol. Biol. Cell 20: 4845-4855 [Abstract] [Full Text]  
  • Enjalbert, B., Rachini, A., Vediyappan, G., Pietrella, D., Spaccapelo, R., Vecchiarelli, A., Brown, A. J. P., d'Enfert, C. (2009). A Multifunctional, Synthetic Gaussia princeps Luciferase Reporter for Live Imaging of Candida albicans Infections. Infect. Immun. 77: 4847-4858 [Abstract] [Full Text]  
  • Bauer, J., Wendland, J. (2007). Candida albicans Sfl1 Suppresses Flocculation and Filamentation. Eukaryot Cell 6: 1736-1744 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Enjalbert, B.
Right arrow Articles by Brown, A. J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Enjalbert, B.
Right arrow Articles by Brown, A. J. P.