This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hybiske, K.
Right arrow Articles by Stephens, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hybiske, K.
Right arrow Articles by Stephens, R. S.

 Previous Article  |  Next Article 

Infection and Immunity, August 2007, p. 3925-3934, Vol. 75, No. 8
0019-9567/07/$08.00+0     doi:10.1128/IAI.00106-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Mechanisms of Chlamydia trachomatis Entry into Nonphagocytic Cells{triangledown}

Kevin Hybiske and Richard S. Stephens*

Division of Infectious Diseases, School of Public Health, University of California—Berkeley, Berkeley, California 94720

Received 19 January 2007/ Returned for modification 23 February 2007/ Accepted 25 April 2007


arrow
ABSTRACT
 
The mechanisms of entry for the obligate intracellular bacterium C. trachomatis were examined by functional disruption of proteins essential for various modes of entry. RNA interference was used to disrupt proteins with established roles in clathrin-mediated endocytosis (clathrin heavy chain, dynamin-2, heat shock 70-kDa protein 8, Arp2, cortactin, and calmodulin), caveola-mediated endocytosis (caveolin-1, dynamin-2, Arp2, NSF, and annexin II), phagocytosis (RhoA, dynamin-2, Rac1, and Arp2), and macropinocytosis (Pak1, Rac1, and Arp2). Comparative quantitative PCR analysis was performed on small interfering RNA-transfected HeLa cells to accurately determine the extent of C. trachomatis entry after these treatments. Key structural and regulatory factors associated with clathrin-mediated endocytosis were found to be involved in Chlamydia entry, whereas those for caveola-mediated endocytosis, phagocytosis, and macropinocytosis were not. Thus, clathrin and its coordinate accessory factors were required for entry of C. trachomatis, although additional, uncharacterized mechanisms are also utilized.


arrow
INTRODUCTION
 
Intracellular pathogens have evolved unique strategies for gaining entry into nonphagocytic cells (17, 36, 45). Yersinia and Listeria spp. bind to receptors on the host cell to trigger actin rearrangements and phagocytic entry. Salmonella and Shigella spp. use type III secretion to subvert host signaling pathways and promote membrane ruffling and invasion. Enterohemorrhagic Escherichia coli and enteropathogenic E. coli have evolved an attachment and effacement strategy to secrete their own receptor into the host membrane, thereby inducing entry. Multiple bacterial pathogens use cholesterol-enriched lipid rafts to facilitate invasion, including uropathogenic E. coli, Brucella spp., Mycobacterium spp., and Rickettsia spp. Viruses also enter cells through various endocytic pathways. Simian virus 40, human immunodeficiency virus type 1 (HIV-1), polyomavirus, echovirus 1, and coxsackievirus B all use lipid rafts to invade cells. Clathrin mediates the entry of Semliki forest virus, influenza virus, and vesicular stomatitis virus. Adenovirus type 2 is believed to enter cells by macropinocytosis. The mechanism of entry of the obligate intracellular bacteria Chlamydia, however, remains unresolved.

Chlamydiae are bacterial pathogens with a widespread global public health impact. Chlamydia trachomatis is the most common causative agent of bacterial sexually transmitted disease, being responsible for an estimated 90 million new cases per year worldwide, and is also a leading cause of blindness. Chlamydiae are responsible for a wide range of diseases in humans, including lymphogranuloma venereum, pelvic inflammatory disease, conjunctivitis, urethritis, cervicitis, pneumonia, psittacosis, and possibly atherosclerosis (49). Chlamydia infection begins with the attachment of the elementary body (EB) to a eukaryotic cell by interaction with a proteinaceous host component (5, 6, 57). After attachment, chlamydiae are internalized into the cell by an unknown mechanism resembling endocytosis, upon which Chlamydia-derived vesicles mature into a specialized parasitophorous vacuole, or inclusion, that is nonfusogenic with endosomal and lysosomal membranes.

Internalization is a critical step in the pathogenic cycle of Chlamydia and has been studied extensively throughout the years. Although a definitive pathway for Chlamydia entry has yet to be elucidated, numerous, and sometimes conflicting, mechanisms have been proposed. Microscopy studies have provided evidence both in support of clathrin-mediated endocytosis (30, 34, 61) and against it (3, 59). Similarly, caveola-mediated entry has garnered both supporting (43, 52, 60) and refuting (24) evidence. A number of regulatory factors have been investigated for their potential roles in facilitating Chlamydia internalization. Evidence suggested that the small GTPases Rac1 and Arf6 play strong roles (1, 8, 21, 53), whereas the large GTPase dynamin-1 (3) and the small GTPases RhoA and Cdc42 do not (8). In addition, it has been suggested that Chlamydia invades cells by either directed phagocytosis (6) or generalized pinocytosis (46). Furthermore, a recent report proposed that C. trachomatis can induce localized actin polymerization via a type III secreted effector, which in turn facilitates Chlamydia uptake (14, 15). This finding, coupled with previous studies that demonstrated partial requirements for actin polymerization (9, 47), strongly support that actin is an important cellular mediator of Chlamydia entry. Finally, there are studies that highlight the involvement of intracellular calcium and calmodulin (42), as well as calcium-activated annexins (35), in Chlamydia infectivity. However, despite this work, an integrated understanding of the cellular processes that mediate Chlamydia entry remains unknown.

The paucity of direct experimental approaches has made it difficult to analyze the functional participation of individual endocytic mechanisms in Chlamydia internalization—as such, researchers have had to depend on microscopic observations and pharmacological agents to draw conclusions. The association of clathrin coats with internalized Chlamydia, or the lack thereof, was made using microscopic observations (30, 34, 59, 61). Likewise, analyses on the involvement of caveolae with Chlamydia entry also relied on indeterminate microscopic observations and pharmacological agents with pleuripotent effects (43, 52, 60). Uniform conclusions on the role of actin in Chlamydia uptake have been difficult due to the idiosyncratic effects of actin cytoskeleton-disrupting agents and differences in experimental methods (9, 46, 47).

Recent advances in the elucidation of endocytic mechanisms and their regulatory factors, in addition to improvements in technical approaches, have empowered researchers with the ability to investigate individual endocytic pathways for their participation in the uptake of specific molecules. To probe the cellular mechanisms of Chlamydia uptake, the roles of four endocytic pathways were independently analyzed for their functional participation in Chlamydia entry. RNA interference was used to specifically impair nine signature genes with well-established roles in (i) clathrin-mediated endocytosis (clathrin heavy chain [31], dynamin-2 [39], Hsc70 [12], Arp2 [20], and cortactin [7]), (ii) caveola-mediated endocytosis (caveolin-1 [19]), (iii) phagocytosis (RhoA [26], dynamin-2 [25], Rac1, and Arp2 [13]), and (iv) macropinocytosis (Pak1 [18], Rac1 [48], and Arp2 [54]). Entry of C. trachomatis was dependent on functional clathrin-mediated processes, whereas caveola-mediated endocytosis, phagocytosis, and macropinocytosis appeared to be not involved.


arrow
MATERIALS AND METHODS
 
Reagents. Unless otherwise specified, all reagents and chemicals were obtained from Sigma (St. Louis, MO).

Cell culture and Chlamydia infections. HeLa 229 cells were grown in culture in Dulbecco modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS), 2 mM L-glutamine, 100 µg of vancomycin/ml, and 100 µg of streptomycin/ml. For experiments, cells were plated either to confluence in 24-well plates (Primaria; BD Falcon, Bedford, MA), on glass coverslips, or in coverglass chambers (Lab-Tek II; Nunc, Rochester, NY).

C. trachomatis LGV biovar strain L2 was grown for 48 h in L929 cells as described previously (32). Chlamydial EB were isolated by sonic disruption of L929 suspensions and purification by centrifugation. EB were resuspended in sucrose-phosphate-glutamic acid buffer and stored in aliquots at –80°C.

Unless otherwise indicated, HeLa cells were infected with chlamydial EB diluted in Hanks buffered saline (HBS) at a multiplicity of infection (MOI) of <1 (24-h assays) or at an MOI of >100 (2-h assays) and incubated at room temperature for 1.5 h. Cells were washed with HBS and incubated in normal growth media supplemented with 1 µg of cycloheximide/ml at 37°C for 2 or 24 h unless otherwise indicated.

RNA interference. HeLa cells were plated the day prior to transfection in six-well plates at a density of 2 x 105 cells/well in DMEM with 10% FBS. Transfections were performed by diluting 6 µl of 40 µM small interfering RNA (siRNA) duplexes in 200 µl of OptiMem (Invitrogen, Carlsbad, CA). Then, 3 µl of Oligofectamine (Invitrogen) was diluted separately in 24 µl of OptiMem, and both solutions were mixed and incubated at room temperature for 20 min. This mixture (~230 µl) was added to cells bathed in 770 µl of OptiMem and incubated at 37°C for 4 h, at which time 500 µl of DMEM containing 30% FBS was added. After 48 h, a second transfection was performed, and cells were incubated at 37°C for another 48 h. Finally, transfected cells were treated with trypsin and subjected to RNA and/or protein isolation or replated for subsequent experiments.

For clathrin heavy chain, the target sequence AATAATCCAATTCGAAGACCAAT was used for siRNA duplex synthesis (Option C; Dharmacon, Lafayette, CO). The target sequence AAGACATGATCCTGCAGTTCA was used for dynamin 2 synthesis (Option C; Dharmacon). Predesigned siRNA duplexes for calmodulin-1 and Rac1 were purchased as siGENOME oligonucleotides from Dharmacon with the following sense sequences: UAAGGAGAUUGGUGCUGUAUU (Rac1) and AGUCAACUAUGAAGAAUUCUU (CaM I). Predesigned duplex siRNA oligonucleotides for Arp2 and RhoA were purchased from Ambion (Austin, TX) with the sense sequences CGAGAACUUAAACAGCUUU (Arp2) and CGUGGGAAGAAAAAAUCUG (RhoA). Predesigned siRNA duplexes for Hsc70, N-ethylmaleimide-sensitive factor (NSF), Pak1, annexin II, cortactin, and caveolin-1 were purchased from QIAGEN (Valencia, CA) with the target sequences TTGGCCCTTTATGGTGGTGAA (Hsc70), CTGGTTGTTGGAAACAGTCAA (NSF), and CTGGGACTGAGCTGTACAGTA (AnxA2). A nontargeting siRNA duplex was used as a negative control for all RNAi experiments (siCONTROL nontargeting siRNA #1; Dharmacon).

Quantitative reverse transcription-PCR (RT-PCR). RNA from siRNA transfected cells was isolated by using the QIAshredder and RNeasy kits (QIAGEN), performed according to the manufacturer's protocol, and was purged of contaminating DNA by a 15-min treatment with DNase I (QIAGEN). cDNA was then generated from 2 µg of RNA by using the ThermoScript RT-PCR System according to the manufacturer's protocol (Invitrogen). Reactions were set up for quantitative PCR containing 2 µl of cDNA, 13 µl of SYBR green mix (SYBR Green Master Mix; Applied Biosystems, Foster City, CA), 1 µl of forward specific primer (10 µM stock), 1 µl of reverse specific primer (10 µM stock), and 9 µl of distilled water. Reactions were run in a 7500 Real-Time PCR System (Applied Biosystems) with a thermocycler program of 10 min at 95°C, followed by 15 s at 95°C, 15 s at 55°C, and 1 min at 72°C for 40 cycles. Primer oligonucleotide sequences are summarized in Table 1. CT values were determined by using the 7500 System SDS Software (v.1.2.3; Applied Biosystems), and {Delta}{Delta}CT values were computed in Excel (Microsoft, Redmond, WA) using ß-globin CT values as internal controls. Expression ratios were finally calculated according to the 2{Delta}{Delta}CT method for each transcript (33) and were expressed relative to the values from control siRNA-transfected samples.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Oligonucleotide primer sequences used for quantitative PCR

Quantitative Chlamydia infectivity assay. Genomic DNA from HeLa cells infected with C. trachomatis as described above was isolated using the High-Pure PCR template preparation kit (Roche, Indianapolis, IN) and eluted in 30 µl of 10 mM Tris buffer. For experiments on 2-h infections, cells were briefly incubated with 0.05% trypsin-EDTA to remove adherent, uninternalized bacteria prior to DNA isolation (46, 47, 59). Purified genomic DNA was used as a template in quantitative PCRs to determine the relative levels of chlamydial (16S, Table 1) and HeLa (ß-globin, Table 1) genomic equivalents. Expression ratios were calculated according to the 2{Delta}{Delta}CT method (33) and expressed relative to the values from control siRNA-transfected samples.

Immunofluorescence. Cells transfected with siRNA oligonucleotides and/or infected with C. trachomatis were washed three times with phosphate-buffered saline (PBS) and fixed with 3.7% formaldehyde-PBS for 15 min at room temperature. Cells were washed twice with PBS and permeabilized with 0.5% Triton X-100-PBS for 15 min. After being blocked with 1% bovine serum albumin (BSA)-PBS for 20 min, cells were incubated for 1 h at room temperature with specific antibodies to clathrin heavy chain (BD Biosciences, San Diego, CA), caveolin (Abcam, Cambridge, MA), dynamin-2 (BD Biosciences), Rac1 (BD Biosciences), Hsc70 (Affinity BioReagents), Arp2 (Chemicon), cortactin (Upstate), RhoA (Cytoskeleton), Pak1 (Epitomics), NSF (Chemicon), calmodulin-1 (Santa Cruz Biotech), or annexin II (BD Biosciences). After rinses with 1% BSA-PBS, cells were finally incubated for 45 min at room temperature with either an Alexa-488 or Alexa-594 secondary antibody (Molecular Probes, Eugene, OR). Images were acquired by using a Nikon inverted microscope equipped with a QLC100 real-time spinning disk confocal system (VisiTech, Sunderland, United Kingdom), with a x60 oil objective lens (NA = 1.4) and operated by QEDInVivo software (MediaCybernetics, Silver Spring, MD). Enhancements were performed by using Photoshop CS (Adobe, San Jose, CA) on a Macintosh G5 (Apple, Cupertino, CA).

Immunoblotting. Cells were harvested in PBS and lysed in RIPA buffer (150 mM NaCl, 0.5% deoxycholate, 0.1% Nonidet P-40, 0.1% sodium dodecyl sulfate [SDS], 50 mM Tris-HCl) containing protease inhibitors (104 mM AEBSF [4-(2-aminoethyl)-benzenesulfonyl fluoride], 80 µM aprotinin, 2.1 mM leupeptin, 3.6 mM bestatin, 1.5 mM pepstatin A, and 1.4 mM E-64). Total cellular protein was quantified by the Lowry procedure, and equal amounts of protein were mixed with loading buffer (25% glycerol, 0.075% SDS, 1.25 ml of 14.4 M 2-mercaptoethanol, 10% bromophenol blue, and 3.13% stacking gel buffer) and fractionated by gel electrophoresis on SDS-10% polyacrylamide gel electrophoresis (PAGE) gels. Proteins were transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA) and blocked overnight at 4°C with 5% nonfat dry milk in 1x TBST (10 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.05% Tween 20). Blots were probed with either a clathrin heavy chain antibody (BD Biosciences), an HDAC1 antibody (Affinity BioReagents), or a caveolin antibody for 1 h at room temperature, followed by horseradish peroxidase (HRP) anti-rabbit or anti-mouse secondary antibodies (Amersham Biosciences, Piscataway, NJ) for 30 min at room temperature. Blots were visualized by using enzymatic chemiluminescence (Amersham).

Transferrin uptake assay. To biochemically measure transferrin uptake, clathrin-depleted cells were replated in six-well plates and serum starved with OptiMem plus 0.1% BSA for 30 min at 37°C. Cells were incubated with 2 µg of biotinylated-transferrin (Molecular Probes)/ml for 1 h on ice. Cells were then washed twice with OptiMem to remove unbound transferrin and were incubated at 37°C in OptiMem-BSA for 10 min to 1 h to allow internalization. Cells were stripped of extracellular transferrin by washing them with an acid buffer (0.5 M NaCl, 0.2 M sodium acetate [pH 4.5]). Cells were harvested in PBS by trypsin treatment, lysed in radioimmunoprecipitation assay buffer, and the total protein was analyzed by SDS-PAGE as described above. Blots were probed with NeutrAvidin-HRP (Molecular Probes).

For visualization of transferrin uptake by immunofluorescence, transfected cells were replated in coverglass chambers. Cells were serum starved as described above and subsequently incubated with 5 µg of transferrin-Alexa488 (Molecular Probes)/ml for 1 h on ice. Cells were washed and incubated in OptiMem-BSA for 15 min to 1 h for transferrin uptake. After internalization, cells were fixed with 3.7% formaldehyde-PBS for 15 min, washed with PBS, and visualized by confocal microscopy as described above.

Cholera toxin subunit B uptake assay. For measurements of cholera toxin subunit B uptake, cells transfected with siRNA oligonucleotides targeted against caveolin-1 were replated into coverglass chambers (Lab-Tek II) and rinsed with HBS. Cells were incubated with an Alexa-488 cholera toxin subunit B (CTxB) conjugate (Molecular Probes) at a concentration of 7.5 µg/ml for 45 min on ice. Cells were subsequently rinsed with OptiMem to remove unbound cholera toxin, and cells were incubated at 37°C for 15 min to 1 h to facilitate internalization. Finally, cells were fixed with 3.7% formaldehyde-PBS for 15 min and rinsed with PBS, and CTxB fluorescence was visualized by confocal microscopy as described above.


arrow
RESULTS
 
Clathrin mediates C. trachomatis entry. Clathrin-mediated endocytosis is commonly exploited by pathogens to facilitate their invasion of host cells (36, 56). Evidence for the role of clathrin in Chlamydia entry has been equivocal (27). In order to analyze the functional involvement of clathrin-mediated endocytosis in the internalization of C. trachomatis, RNA interference was used to knock down the expression of clathrin heavy chain, the major structural component of clathrin coated pits (31). Depletion of clathrin heavy chain with this oligonucleotide sequence has been shown to effectively impair clathrin-mediated endocytosis in HeLa cells (41).

HeLa cells were serially transfected with duplex siRNA oligonucleotides targeted against clathrin, and the extent of clathrin depletion was examined. Quantitative RT-PCR analysis on mRNA extracted from siRNA-transfected cells revealed an 85% reduction in clathrin transcript levels compared to control cells identically transfected with nontargeting siRNA oligonucleotides (Fig. 1A). These results accurately reflected the concordant reduction in clathrin protein expression, as measured by immunoblotting (Fig. 1B). Moreover, visualization of clathrin expression in siRNA-transfected cells by immunofluorescence with a clathrin-specific antibody revealed that high levels of knockdown were attained in most of the cell population, while typically 5 to 10% of cells appeared to retain wild-type levels of clathrin expression (Fig. 1C). Thus, residual protein and mRNA expression in clathrin-depleted cells was derived from a subpopulation of untransfected cells that lacked the clathrin-impaired phenotype, and subsequent measurements result in an underestimation of clathrin-mediated effects.


Figure 1
View larger version (39K):
[in this window]
[in a new window]

  		FIG. 1. Knockdown of clathrin heavy chain by RNA interference. (A) Quantitative RT-PCR analysis of HeLa cells transfected for 4 days with siRNA oligonucleotides targeted against clathrin or with a nontargeting control sequence. Error bars denote standard error of the mean. (B) Immunoblots of clathrin siRNA-transfected cells using antibodies against clathrin heavy chain and HDAC. (C) Clathrin immunofluorescence in knockdown cells using a clathrin heavy chain specific antibody. Arrow denotes a cell with little or no clathrin depletion.

To establish that functional ablation of clathrin-mediated endocytosis was achieved, siRNA-transfected cells were tested for their ability to internalize extracellular transferrin, a classical marker for clathrin-mediated endocytosis (41). After internalization of a biotin-transferrin conjugate, cells were harvested, and the levels of intracellular transferrin were analyzed by immunoblotting. A robust increase in transferrin uptake was observed from 10 to 60 min in control cells, while only a small amount of transferrin was detected in clathrin-depleted cells (Fig. 2A). Furthermore, the extent of functional clathrin impairment throughout the transfected cell population was determined by fluorescence microcopy. A green fluorescent transferrin conjugate was observed to internalize readily in control cells (Fig. 2B). In contrast, clathrin-depleted cells were largely incapable of internalizing transferrin. A small number of cells still appeared capable of internalizing transferrin, a finding consistent with a heterogeneous knockdown of clathrin throughout the monolayer. Thus, knockdown of clathrin heavy chain by RNA interference was a reliable tool for impairing clathrin-mediated endocytosis.


Figure 2
View larger version (82K):
[in this window]
[in a new window]

  		FIG. 2. Functional impairment of clathrin-mediated endocytosis by RNA interference. (A) Uptake of biotinylated transferrin by clathrin knock-down cells after 0 to 60 min at 37°C. Cellular lysates were resolved by SDS-PAGE, and immunoblots were prepared using HRP-avidin to probe for internalized transferrin. (B) Uptake of green-fluorescent conjugated transferrin by clathrin knockdown cells. After internalization for 0 or 30 min at 37°C, cells were fixed, and transferrin was visualized by confocal microscopy (n = 2).

To test the involvement of clathrin-mediated endocytosis in the entry of C. trachomatis, HeLa cells were depleted of clathrin by RNA interference and infected with C. trachomatis serovar L2. Residual adherent bacteria were removed by mild trypsinization (46, 47, 59), and internalization of Chlamydia was analyzed after 2 h by using a quantitative infectivity assay, as described previously (40). This technique enabled more objective determination of uptake than counting inclusion forming units (IFU) or by using radiolabeled organisms. C. trachomatis entry was reduced by an average of 49% compared to control cells (Fig. 3A). Chlamydia internalization experiments require an inordinate number of bacteria per cell to obtain suitable detection and resolution for analysis, regardless of the endpoint assay. This may result in artifactual modes of Chlamydia uptake, and measurements are further confounded by nonviable organisms. As such, the effects of clathrin depletion were also determined after 24 h, in which infections had been performed with a more natural MOI of <1. A similar reduction of 58% in C. trachomatis entry was observed (Fig. 3B). We favored analysis at 24 h because of its greater reliability, sensitivity, and representation of only legitimate entry pathways by viable organisms and since the effects on Chlamydia infectivity were similar at 2 and 24 h for this and subsequent experiments. The effect of clathrin disruption was examined for C. trachomatis serovar D entry, and similar results were obtained (not shown). These data demonstrated a prominent role for clathrin in mediating C. trachomatis entry into host cells; however, the inhibition of Chlamydia infectivity did not reach the level of suppression observed for transferrin uptake.


Figure 3
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 3. Clathrin knockdown cells exhibit reduced C. trachomatis internalization. After 2 h (A) or 24 h (B) of infection with C. trachomatis, control, clathrin knockdown and uninfected cells were subjected to the Chlamydia infectivity assay. Expression ratios were derived from {Delta}{Delta}CT values taken with respect to control cells. Error bars denote the standard error of the mean (n = 5). *, P < 0.05; **, P < 0.001; ***, P < 0.00001 (compared to control cells).

Caveolae do not participate in C. trachomatis entry. Caveolae have been proposed to mediate the internalization of C. trachomatis. To directly address this process, HeLa cells were treated serially with siRNA oligonucleotides targeted against caveolin-1, a critical component of caveolae (19), to effectively inhibit caveola-mediated endocytosis. The extent of caveolin knockdown was evaluated by measuring transcript and protein expression after siRNA treatment. Quantitative RT-PCR performed on mRNA isolated from transfected cells revealed an 88% reduction in caveolin transcript levels compared to control transfected cells (Fig. 4A). Furthermore, a significant decrease in caveolin protein expression, most notably at the plasma membrane, was observed by immunofluorescence staining of caveolin-depleted cells using a caveolin-1-specific antibody (Fig. 4B). These data demonstrated a pronounced reduction in caveolin expression in siRNA-transfected cells.


Figure 4
View larger version (40K):
[in this window]
[in a new window]

  		FIG. 4. Knockdown of caveolin by RNA interference. (A) Quantitative RT-PCR analysis on HeLa cells transfected for 4 days with siRNA oligonucleotides targeted against caveolin. Error bars denote standard error of the mean. (B) Caveolin immunofluorescence in knockdown cells using a caveolin antibody. (C) Uptake of green fluorescent CTxB in caveolin knockdown cells. After internalization for 0 or 30 min at 37°C, cells were fixed, and CTxB was visualized by confocal microscopy (n = 2).

To confirm that the reductions in caveolin protein levels typically obtained resulted in functional impairment of caveola-mediated endocytosis, the ability of caveolin-depleted cells to internalize a fluorescent CTxB conjugate, an established marker for caveolae endocytosis (51), was examined. Caveolin-depleted cells bound extracellular CTxB to a comparable extent as control cells; however, after permitting endocytosis to proceed for 30 min at 37°C, control cells internalized CTxB, whereas cells lacking caveolin did not (Fig. 4C). In some caveolin-depleted cells small amounts of CTxB uptake were observed (not shown); this was likely due to incomplete knockdown in a small population of cells. These data demonstrate effective functional ablation of caveola-mediated endocytosis.

The effect of caveolin knockdown on C. trachomatis internalization was quantitated by using the Chlamydia infectivity assay. The extent of C. trachomatis internalization revealed only a 12% reduction in caveolin-depleted cells compared to control cells (Fig. 5). Moreover, similar data were observed for serovars L2 and D, and no discernible differences in the number of IFU between these populations were found (results not shown). It can be concluded that a reduction of caveolin sufficient to ablate CTxB entry resulted in little impairment of C. trachomatis infectivity. Thus, caveola-mediated endocytosis is not meaningfully involved with Chlamydia internalization.


Figure 5
View larger version (12K):
[in this window]
[in a new window]

  		FIG. 5. C. trachomatis internalization in caveolin knockdown cells. After 24 h of infection with C. trachomatis, control, caveolin knockdown and uninfected cells were subjected to the Chlamydia infectivity assay. Expression ratios were derived from {Delta}{Delta}CT values taken with respect to control cells. Error bars denote the standard error of the mean (n = 4). *, P < 0.00001 (compared to control cells).

No evidence for involvement of phagocytosis or macropinocytosis. The roles of phagocytosis and macropinocytosis in mediating C. trachomatis uptake was next addressed by using RNA interference to deplete RhoA and Pak1, respectively. HeLa cells were serially transfected with siRNA oligonucleotides that effectively reduced expression of either RhoA or Pak1 expression (2, 58). Reductions of 79% of transcript levels for both genes were achieved, as measured by quantitative RT-PCR (Fig. 6A). Corresponding reductions in protein levels were detected by immunofluorescence of RhoA and Pak1 in siRNA-transfected cells (Fig. 6B). The ability of C. trachomatis to gain entry into either of these transfected cells was unperturbed (Fig. 6C), suggesting that phagocytosis and macropinocytosis are likely not pathways of Chlamydia internalization.


Figure 6
View larger version (58K):
[in this window]
[in a new window]

  		FIG. 6. Variable role of membrane trafficking factors in C. trachomatis internalization. (A) Quantitative RT-PCR analysis on HeLa cells transfected for 4 days with siRNA oligonucleotides against dynamin-2, Rac1, Hsc70, Arp2, RhoA, Pak1, NSF, calmodulin, or annexin II. (B) Reduction of protein levels by immunofluorescence in control (nontargeting siRNA) and siRNA-transfected cells. (C) Chlamydia internalization in siRNA-transfected cells infected with C. trachomatis for 24 h or uninfected. For all experiments, n = 2 to 4. Error bars denote the standard error of the mean. *, P < 0.05; **, P < 0.001; ***, P < 0.00001 (compared to control cells).

Role of membrane trafficking factors in C. trachomatis entry. The establishment of clathrin involvement in C. trachomatis internalization was explored further by analyzing the individual contribution of known regulators of clathrin-mediated endocytosis—dynamin-2, Hsc70, Arp2, and cortactin—by RNA interference. In addition, NSF, calmodulin, and annexin II, three proteins with pervasive effects on membrane trafficking, were addressed for their effects on Chlamydia infectivity. High reductions of all proteins were achieved with RNA interference, resulting in 73 to 90% reductions in transcript levels as determined by quantitative RT-PCR (Fig. 6A). Furthermore, analysis of protein levels in siRNA-transfected cells by immunofluorescence indicated that protein expression was significantly reduced for all targets (Fig. 6B). Transfected cells were then tested for susceptibility to infection by C. trachomatis using the quantitative Chlamydia infectivity assay (Fig. 6C). Cells depleted of dynamin-2 or Rac1 were infected by C. trachomatis at levels that were 34 and 32% of control cells, respectively, demonstrating involvement of these regulatory GTPases in Chlamydia infectivity. Ablation of either Hsc70, Arp2, or cortactin had moderate inhibitory effects, resulting in C. trachomatis infectivities that were 59, 61, and 72% of control cells, respectively. Finally, knockdown of annexin II (62) resulted in a small decrease in C. trachomatis uptake, whereas NSF or calmodulin depletion had no meaningful effect. The functional participation of dynamin-2, Hsc70, cortactin, and Arp2 substantiate the key role for clathrin in Chlamydia entry. Furthermore, the data for Rac1 and Arp2 support an additional actin-mediated entry mechanism. The results of these data in the context of cellular endocytic pathways are summarized in Table 2.


View this table:
[in this window]
[in a new window]

  		TABLE 2. Summary of RNA interference-mediated knockdown of endocytic factors and their known endocytic roles


arrow
DISCUSSION
 
Phagocytosis and macropinocytosis. Phagocytosis and macropinocytosis, which have the capacity to engulf large particles, appeared to be not involved in Chlamydia entry, as demonstrated by the inability of RhoA or Pak1 depletion to inhibit C. trachomatis entry. For macropinocytosis, this represents the first specific investigation into the involvement of this process in Chlamydia uptake. Reynolds and Pearce had previously examined the broad category of pinocytic pathways—clathrin, caveolae, and macropinocytosis—for their role in Chlamydia entry but did not specifically look at macropinocytosis (46). The Rac1 effector Pak1 is known to mediate macropinocytosis (18). The findings of the present study were also consistent with a previous report that dominant-negative inhibition of RhoA did not affect C. trachomatis internalization (8). The small GTPase RhoA has been shown to have an essential role in type II phagocytosis (11). However, these conclusions are not absolute, since the current understanding of these endocytic pathways precludes complete discounting of their involvement in Chlamydia entry.

Ablation of calmodulin had no effect, suggesting that it is not involved with Chlamydia entry, in contrast to a previous report (42). RNA interference-based depletion of NSF did not impair Chlamydia uptake, nor did it affect the growth of the chlamydial inclusion (results not shown), thereby indicating that NSF had no involvement with either Chlamydia entry or the acquisition of membranes by the inclusion. Finally, disruption of annexin II had a small but statistically insignificant effect on C. trachomatis internalization. Although a small role for annexin II in entry cannot be fully excluded, these data further support the conclusion that caveolae are not involved, since annexin II has been shown to mediate caveolar endocytosis (50).

Caveolae. Targeted disruption of caveolae demonstrated that caveola-mediated endocytosis is not a meaningful pathway of Chlamydia internalization. This is in agreement with recent findings that cholesterol-rich lipid rafts and caveolae are not associated with Chlamydia (24). However, these findings contrast with reports that have suggested a role for lipid rafts and caveolae (43, 52, 60). Although Chlamydia strain differences could account for these differences—Stuart and coworkers used C. pneumoniae, GPIC, and C. trachomatis serovars A, C, E, F, and K (43, 52, 60), and this study and Gabel et al. (24) inclusively used C. trachomatis L2, D, E, and K—it seems more likely that technical approaches are responsible. The targeted functional disruption of caveolae used in the present study is advantageous over colocalization observations and inhibition with pleiotropic pharmacological agents. Furthermore, the Chlamydia infectivity assay enabled a consistent, quantifiable determination of the role of caveolae. Finally, while the findings from the present study do not exclude the potential involvement of lipid rafts in facilitating Chlamydia entry or for ocular strains, the findings do demonstrate that caveolae are not involved.

Clathrin. A direct, functional approach was used to address the question of whether clathrin mediates Chlamydia entry. The targeted depletion of clathrin heavy chain by RNA interference revealed a pronounced, yet not fully essential, involvement of clathrin in the uptake of C. trachomatis serovars L2 and D. This agrees with reported observational findings of C. trachomatis in clathrin-coated pits (30, 61) and a colocalization of C. trachomatis with clathrin heavy chain by immunofluorescence (34). Some studies, however, have argued against a participation of clathrin in Chlamydia uptake. One study used dominant-negative expression of dynamin-1 and Eps15 to conclude that there was a lack of clathrin participation in Chlamydia entry (3), while another used electron micrograph observations (59). The present study used functional disruption of clathrin heavy chain to address clathrin involvement, as opposed to accessory factors (3), and infections with C. trachomatis were performed under static conditions instead of using centrifugation (59). Moreover, analysis using the quantitative Chlamydia infectivity assay enabled robust determination of Chlamydia entry between populations regardless of differences in cell number (40), a problem that plagues IFU measurements. That similar results were obtained at 2 and 24 h indicates that clathrin is important for entry and not downstream effects on Chlamydia growth. Thus, the present study provides direct evidence for the participation of clathrin in Chlamydia entry.

An important aspect of these results is that they are consistent with what is known both about Chlamydia and clathrin-mediated endocytosis. Clathrin has been found to facilitate the uptake of many bacterial and viral pathogens, including Listeria (56), Semliki Forest virus (28), influenza virus (37), and vesicular stomatitis virus (38), and so it is not surprising that it is functionally important for Chlamydia entry. The present study also demonstrated that a number of established regulators of clathrin-mediated endocytosis also facilitated Chlamydia uptake, thereby supporting clathrin's prominent role. The large GTPase dynamin-2 has been shown to mediate clathrin endocytosis in a wide range of contexts (39), and HeLa cells depleted of dynamin-2 by RNA interference were significantly crippled in their ability to internalize C. trachomatis. Also, depletion of heat shock 70-kDa protein 8 (Hsc70), an ATPase with a recently described role in the disassembly of clathrin coats from internalized vesicles (12), by RNA interference was found to significantly reduce Chlamydia uptake. Finally, knockdown of either a subunit of the actin nucleating complex (Arp2) or cortactin, both of which have regulatory functions in clathrin-mediated endocytosis via interactions with actin (7, 20), resulted in modest reductions in C. trachomatis internalization. Although cortactin has been shown previously to colocalize with Chlamydia inclusions (22), demonstration of functional roles for these four established regulators of clathrin endocytosis is novel for Chlamydia and strengthens the finding that clathrin and actin are key players in Chlamydia entry.

Host receptor for Chlamydia. While clathrin-mediated endocytosis is constitutive, the signal for recruitment of clathrin to endocytic foci is initiated by the binding of extracellular ligands to cognate transmembrane receptors, followed by the recruitment of assembly and accessory proteins and clathrin triskelions (31). Therefore, an important implication of the present study is that the involvement of clathrin suggests the existence of a host protein receptor that recognizes a surface component of Chlamydia and initiates clathrin coat formation. Thus far, identification of a protein receptor for Chlamydia has been elusive, despite compelling evidence that Chlamydia interacts with host cells through unidentified protein "receptors" (5, 6, 10, 16, 23, 57). The productive nature of the RNA interference approach demonstrated here provides an expectation for the identification of upstream and ancillary components of clathrin-mediated Chlamydia entry.

Clathrin and Tarp. The requirement for clathrin in Chlamydia entry was not absolute; the strongest effects achieved were 75% reductions in entry for clathrin-depleted cells. Although this may partially be explained by incomplete disruption of clathrin-mediated endocytosis, a more likely interpretation is that Chlamydia uses additional unidentified mechanisms to enter nonphagocytic cells. It has been proposed that Chlamydia can induce its own uptake by secretion of a type III effector protein (Tarp) into the host cytoplasm, whereby internalization is induced by an undefined actin- and Rac1-based mechanism (8, 15, 21, 53). The findings of the present study are consistent with this, since both Rac1 and Arp2 were specifically found to have a moderate involvement in C. trachomatis entry. Therefore, the clathrin-independent pathway of C. trachomatis entry could be the proposed Tarp mechanism. Alternatively, it is possible that clathrin and Tarp operate together in the same entry pathway. For example, in addition to its reported ability to induce actin polymerization, Tarp may mediate clathrin coat formation. Alternatively, the role for Tarp may lie downstream of clathrin-coated pit formation, perhaps to promote either the internalization of Chlamydia-containing vesicles or their evasion from endosomal and lysosomal pathways. The concept of clathrin-mediated endocytosis and Tarp-based entry having overlap is supported by data from the present study as disruption of Rac1 or Arp2 on top of clathrin depletion did not have an additive effect (results not shown), suggesting that they all may function in the same mechanism. Future biochemical and genetic studies should address the relationship between clathrin and Tarp in mediating Chlamydia uptake.

These data constitute a comprehensive and directed functional survey of the participation of specific endocytic pathways in Chlamydia entry. Targeted depletion of key structural and regulatory factors by RNA interference revealed that clathrin was profoundly involved in Chlamydia entry, whereas caveolae, phagocytosis, and macropinocytosis had no significant participation. Thus, Chlamydia may gain entry into cells by multiple means—a clathrin-based mechanism and one using Tarp or actin—although the possibility exists that clathrin and Tarp function in a single orchestrated pathway.


arrow
ACKNOWLEDGMENTS
 
This research was supported by grants from the National Institutes of Health (HL071730, AI042156, and AI032943).

We thank the Francis I. Proctor Foundation and T. Machen and J. Forte (University of California—Berkeley) for guidance and support. We also thank P. S. Hefty for scientific insight and careful review of the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Division of Infectious Diseases, School of Public Health, 140 Warren Hall, University of California—Berkeley, Berkeley, CA 94720. Phone: (510) 643-9900. Fax: (510) 643-1537. E-mail: rss{at}berkeley.edu Back

{triangledown} Published ahead of print on 14 May 2007. Back

Editor: D. L. Burns


arrow
REFERENCES
 
    1
  1. Balana, M. E., F. Niedergang, A. Subtil, A. Alcover, P. Chavrier, and A. Dautry-Varsat. 2005. ARF6 GTPase controls bacterial invasion by actin remodeling. J. Cell Sci. 118:2201-2210.[Abstract/Free Full Text]
    2. 2
  2. Beeser, A., Z. M. Jaffer, C. Hoffman, and J. Chernoff. 2005. Role of group A p21-activated kinases in activation of extracellular-regulated kinase by growth factors. J. Biol. Chem. 280:36609-36615.[Abstract/Free Full Text]
    3. 3
  3. Boleti, H., A. Benmerah, D. M. Ojcius, N. Cerf-Bensussan, and A. Dautry-Varsat. 1999. Chlamydia infection of epithelial cells expressing dynamin and Eps15 mutants: clathrin-independent entry into cells and dynamin-dependent productive growth. J. Cell Sci. 112:1487-1496.[Abstract]
    4. 4
  4. Brodsky, F. M., B. L. Hill, S. L. Acton, I. Nathke, D. H. Wong, S. Ponnambalam, and P. Parham. 1991. Clathrin light chains: arrays of protein motifs that regulate coated-vesicle dynamics. Trends Biochem. Sci. 16:208-213.[CrossRef][Medline]
    5. 5
  5. Byrne, G. I. 1976. Requirements for ingestion of Chlamydia psittaci by mouse fibroblasts (L cells). Infect. Immun. 14:645-651.[Abstract/Free Full Text]
    6. 6
  6. Byrne, G. I., and J. W. Moulder. 1978. Parasite-specified phagocytosis of Chlamydia psittaci and Chlamydia trachomatis by L and HeLa cells. Infect. Immun. 19:598-606.[Abstract/Free Full Text]
    7. 7
  7. Cao, H., J. D. Orth, J. Chen, S. G. Weller, J. E. Heuser, and M. A. McNiven. 2003. Cortactin is a component of clathrin-coated pits and participates in receptor-mediated endocytosis. Mol. Cell. Biol. 23:2162-2170.[Abstract/Free Full Text]
    8. 8
  8. Carabeo, R. A., S. S. Grieshaber, A. Hasenkrug, C. Dooley, and T. Hackstadt. 2004. Requirement for the Rac GTPase in Chlamydia trachomatis invasion of non-phagocytic cells. Traffic 5:418-425.[CrossRef][Medline]
    9. 9
  9. Carabeo, R. A., S. S. Grieshaber, E. Fischer, and T. Hackstadt. 2002. Chlamydia trachomatis induces remodeling of the actin cytoskeleton during attachment and entry into HeLa cells. Infect. Immun. 70:3793-3803.[Abstract/Free Full Text]
    10. 10
  10. Carabeo, R. A., and T. Hackstadt. 2001. Isolation and characterization of a mutant Chinese hamster ovary cell line that is resistant to Chlamydia trachomatis infection at a novel step in the attachment process. Infect. Immun. 69:5899-5904.[Abstract/Free Full Text]
    11. 11
  11. Caron, E., and A. Hall. 1998. Identification of two distinct mechanisms of phagocytosis controlled by different Rho GTPases. Science 282:1717-1721.[Abstract/Free Full Text]
    12. 12
  12. Chang, H. C., S. L. Newmyer, M. J. Hull, M. Ebersold, S. L. Schmid, and I. Mellman. 2002. Hsc70 is required for endocytosis and clathrin function in Drosophila. J. Cell Biol. 159:477-487.[Abstract/Free Full Text]
    13. 13
  13. Chimini, G., and P. Chavrier. 2000. Function of Rho family proteins in actin dynamics during phagocytosis and engulfment. Nat. Cell Biol. 2:E191-E196.[CrossRef][Medline]
    14. 14
  14. Clifton, D. R., C. A. Dooley, S. S. Grieshaber, R. A. Carabeo, K. A. Fields, and T. Hackstadt. 2005. Tyrosine phosphorylation of the chlamydial effector protein Tarp is species specific and not required for recruitment of actin. Infect. Immun. 73:3860-3868.[Abstract/Free Full Text]
    15. 15
  15. Clifton, D. R., K. A. Fields, S. S. Grieshaber, C. A. Dooley, E. R. Fischer, D. J. Mead, R. A. Carabeo, and T. Hackstadt. 2004. A chlamydial type III translocated protein is tyrosine-phosphorylated at the site of entry and associated with recruitment of actin. Proc. Natl. Acad. Sci. USA 101:10166-10171.[Abstract/Free Full Text]
    16. 16
  16. Conant, C. G., and R. S. Stephens. 2007. Chlamydia attachment to mammalian cells requires protein disulfide isomerase. Cell Microbiol. 9:222-232.[CrossRef][Medline]
    17. 17
  17. Cossart, P., and P. J. Sansonetti. 2004. Bacterial invasion: the paradigms of enteroinvasive pathogens. Science 304:242-248.[Abstract/Free Full Text]
    18. 18
  18. Dharmawardhane, S., A. Schurmann, M. A. Sells, J. Chernoff, S. L. Schmid, and G. M. Bokoch. 2000. Regulation of macropinocytosis by p21-activated kinase-1. Mol. Biol. Cell 11:3341-3352.[Abstract/Free Full Text]
    19. 19
  19. Drab, M., P. Verkade, M. Elger, M. Kasper, M. Lohn, B. Lauterbach, J. Menne, C. Lindschau, F. Mende, F. C. Luft, A. Schedl, H. Haller, and T. V. Kurzchalia. 2001. Loss of caveolae, vascular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice. Science 293:2449-2452.[Abstract/Free Full Text]
    20. 20
  20. Duncan, M. C., M. J. Cope, B. L. Goode, B. Wendland, and D. G. Drubin. 2001. Yeast Eps15-like endocytic protein, Pan1p, activates the Arp2/3 complex. Nat. Cell Biol. 3:687-690.[CrossRef][Medline]
    21. 21
  21. Elwell, C., and J. N. Engel. 2005. Drosophila melanogaster S2 cells: a model system to study Chlamydia interaction with host cells. Cell Microbiol. 7:725-739.[CrossRef][Medline]
    22. 22
  22. Fawaz, F. S., C. van Ooij, E. Homola, S. C. Mutka, and J. N. Engel. 1997. Infection with Chlamydia trachomatis alters the tyrosine phosphorylation and/or localization of several host cell proteins including cortactin. Infect. Immun. 65:5301-5308.[Abstract]
    23. 23
  23. Fudyk, T., L. Olinger, and R. S. Stephens. 2002. Selection of mutant cell lines resistant to infection by Chlamydia spp. Infect. Immun. 70:6444-6447.[Abstract/Free Full Text]
    24. 24
  24. Gabel, B. R., C. Elwell, S. C. van Ijzendoorn, and J. N. Engel. 2004. Lipid raft-mediated entry is not required for Chlamydia trachomatis infection of cultured epithelial cells. Infect. Immun. 72:7367-7373.[Abstract/Free Full Text]
    25. 25
  25. Gold, E. S., D. M. Underhill, N. S. Morrissette, J. Guo, M. A. McNiven, and A. Aderem. 1999. Dynamin 2 is required for phagocytosis in macrophages. J. Exp. Med. 190:1849-1856.[Abstract/Free Full Text]
    26. 26
  26. Hackam, D. J., O. D. Rotstein, A. Schreiber, W. Zhang, and S. Grinstein. 1997. Rho is required for the initiation of calcium signaling and phagocytosis by Fc{gamma} receptors in macrophages. J. Exp. Med. 186:955-966.[Abstract/Free Full Text]
    27. 27
  27. Hackstadt, T. 1999. Cell biology, p. 101-138. In R. S. Stephens (ed.), Chlamydia: intracellular biology, pathogenesis, and immunity. ASM Press, Washington, DC.
    28. 28
  28. Helenius, A., J. Kartenbeck, K. Simons, and E. Fries. 1980. On the entry of Semliki Forest virus into BHK-21 cells. J. Cell Biol. 84:404-420.[Abstract/Free Full Text]
    29. 29
  29. Henley, J. R., E. W. Krueger, B. J. Oswald, and M. A. McNiven. 1998. Dynamin-mediated internalization of caveolae. J. Cell Biol. 141:85-99.[Abstract/Free Full Text]
    30. 30
  30. Hodinka, R. L., C. H. Davis, J. Choong, and P. B. Wyrick. 1988. Ultrastructural study of endocytosis of Chlamydia trachomatis by McCoy cells. Infect. Immun. 56:1456-1463.[Abstract/Free Full Text]
    31. 31
  31. Kirchhausen, T. 2000. Clathrin. Annu. Rev. Biochem. 69:699-727.[CrossRef][Medline]
    32. 32
  32. Koehler, J. E., R. R. Burgess, N. E. Thompson, and R. S. Stephens. 1990. Chlamydia trachomatis RNA polymerase major sigma subunit. Sequence and structural comparison of conserved and unique regions with Escherichia coli sigma 70 and Bacillus subtilis sigma 43. J. Biol. Chem. 265:13206-13214.[Abstract/Free Full Text]
    33. 33
  33. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2–{Delta}{Delta}CT Method Methods 25:402-408.
    34. 34
  34. Majeed, M., and E. Kihlstrom. 1991. Mobilization of F-actin and clathrin during redistribution of Chlamydia trachomatis to an intracellular site in eucaryotic cells. Infect. Immun. 59:4465-4472.[Abstract/Free Full Text]
    35. 35
  35. Majeed, M., J. D. Ernst, K. E. Magnusson, E. Kihlstrom, and O. Stendahl. 1994. Selective translocation of annexins during intracellular redistribution of Chlamydia trachomatis in HeLa and McCoy cells. Infect. Immun. 62:126-134.[Abstract/Free Full Text]
    36. 36
  36. Marsh, M., and A. Helenius. 2006. Virus entry: open sesame. Cell 124:729-740.[CrossRef][Medline]
    37. 37
  37. Matlin, K. S., H. Reggio, A. Helenius, and K. Simons. 1981. Infectious entry pathway of influenza virus in a canine kidney cell line. J. Cell Biol. 91:601-613.[Abstract/Free Full Text]
    38. 38
  38. Matlin, K. S., H. Reggio, A. Helenius, and K. Simons. 1982. Pathway of vesicular stomatitis virus entry leading to infection. J. Mol. Biol. 156:609-631.[CrossRef][Medline]
    39. 39
  39. Merrifield, C. J., M. E. Feldman, L. Wan, and W. Almers. 2002. Imaging actin and dynamin recruitment during invagination of single clathrin-coated pits. Nat. Cell Biol. 4:691-698.[CrossRef][Medline]
    40. 40
  40. Miyairi, I., O. S. Mahdi, S. P. Ouellette, R. J. Belland, and G. I. Byrne. 2006. Different growth rates of Chlamydia trachomatis biovars reflect pathotype. J. Infect. Dis. 194:350-357.[CrossRef][Medline]
    41. 41
  41. Motley, A., N. A. Bright, M. N. Seaman, and M. S. Robinson. 2003. Clathrin-mediated endocytosis in AP-2-depleted cells. J. Cell Biol. 162:909-918.[Abstract/Free Full Text]
    42. 42
  42. Murray, A., and M. E. Ward. 1984. Control mechanisms governing the infectivity of Chlamydia trachomatis for HeLa cells: the role of calmodulin. J. Gen. Microbiol. 130:193-201.[Abstract/Free Full Text]
    43. 43
  43. Norkin, L. C., S. A. Wolfrom, and E. S. Stuart. 2001. Association of caveolin with Chlamydia trachomatis inclusions at early and late stages of infection. Exp. Cell Res. 266:229-238.[CrossRef][Medline]
    44. 44
  44. Pelkmans, L., D. Puntener, and A. Helenius. 2002. Local actin polymerization and dynamin recruitment in SV40-induced internalization of caveolae. Science 296:535-539.[Abstract/Free Full Text]
    45. 45
  45. Pizarro-Cerda, J., and P. Cossart. 2006. Bacterial adhesion and entry into host cells. Cell 124:715-727.[CrossRef][Medline]
    46. 46
  46. Reynolds, D. J., and J. H. Pearce. 1990. Characterization of the cytochalasin D-resistant (pinocytic) mechanisms of endocytosis utilized by chlamydiae. Infect. Immun. 58:3208-3216.[Abstract/Free Full Text]
    47. 47
  47. Reynolds, D. J., and J. H. Pearce. 1991. Endocytic mechanisms utilized by chlamydiae and their influence on induction of productive infection. Infect. Immun. 59:3033-3039.[Abstract/Free Full Text]
    48. 48
  48. Ridley, A. J., H. F. Paterson, C. L. Johnston, D. Diekmann, and A. Hall. 1992. The small GTP-binding protein Rac regulates growth factor-induced membrane ruffling. Cell 70:401-410.[CrossRef][Medline]
    49. 49
  49. Schachter, J. 1999. Infection and disease epidemiology, p. 139-169. In R. S. Stephens (ed.), Chlamydia: intracellular biology, pathogenesis, and immunity. ASM Press, Washington, DC.
    50. 50
  50. Schnitzer, J. E., J. Liu, and P. Oh. 1995. Endothelial caveolae have the molecular transport machinery for vesicle budding, docking, and fusion including VAMP, NSF, SNAP, annexins, and GTPases. J. Biol. Chem. 270:14399-14404.[Abstract/Free Full Text]
    51. 51
  51. Singh, R. D., V. Puri, J. T. Valiyaveettil, D. L. Marks, R. Bittman, and R. E. Pagano. 2003. Selective caveolin-1-dependent endocytosis of glycosphingolipids. Mol. Biol. Cell 14:3254-3265.[Abstract/Free Full Text]
    52. 52
  52. Stuart, E. S., W. C. Webley, and L. C. Norkin. 2003. Lipid rafts, caveolae, caveolin-1, and entry by chlamydiae into host cells. Exp. Cell Res. 287:67-78.[CrossRef][Medline]
    53. 53
  53. Subtil, A., B. Wyplosz, M. E. Balana, and A. Dautry-Varsat. 2004. Analysis of Chlamydia caviae entry sites and involvement of Cdc42 and Rac activity. J. Cell Sci. 117:3923-3933.[Abstract/Free Full Text]
    54. 54
  54. Swanson, J. A., and C. Watts. 1995. Macropinocytosis. Trends Cell Biol. 5:424-428.[CrossRef][Medline]
    55. 55
  55. Thompson, C. R., and M. S. Bretscher. 2002. Cell polarity and locomotion, as well as endocytosis, depend on NSF. Development 129:4185-4192.[Medline]
    56. 56
  56. Veiga, E., and P. Cossart. 2005. Listeria hijacks the clathrin-dependent endocytic machinery to invade mammalian cells. Nat. Cell Biol. 7:894-900.[CrossRef][Medline]
    57. 57
  57. Vretou, E., P. C. Goswami, and S. K. Bose. 1989. Adherence of multiple serovars of Chlamydia trachomatis to a common receptor on HeLa and McCoy cells is mediated by thermolabile protein(s). J. Gen. Microbiol. 135:3229-3237.[Abstract/Free Full Text]
    58. 58
  58. Wang, R. A., A. Mazumdar, R. K. Vadlamudi, and R. Kumar. 2002. P21-activated kinase-1 phosphorylates and transactivates estrogen receptor-alpha and promotes hyperplasia in mammary epithelium. EMBO J. 21:5437-5447.[CrossRef][Medline]
    59. 59
  59. Ward, M. E., and A. Murray. 1984. Control mechanisms governing the infectivity of Chlamydia trachomatis for HeLa cells: mechanisms of endocytosis. J. Gen. Microbiol. 130:1765-1780.[Abstract/Free Full Text]
    60. 60
  60. Webley, W. C., L. C. Norkin, and E. S. Stuart. 2004. Caveolin-2 associates with intracellular chlamydial inclusions independently of caveolin-1. BMC Infect. Dis. 4:23.[CrossRef][Medline]
    61. 61
  61. Wyrick, P. B., J. Choong, C. H. Davis, S. T. Knight, M. O. Royal, A. S. Maslow, and C. R. Bagnell. 1989. Entry of genital Chlamydia trachomatis into polarized human epithelial cells. Infect. Immun. 57:2378-2389.[Abstract/Free Full Text]
    62. 62
  62. Zobiack, N., U. Rescher, C. Ludwig, D. Zeuschner, and V. Gerke. 2003. The annexin 2/S100A10 complex controls the distribution of transferrin receptor-containing recycling endosomes. Mol. Biol. Cell 14:4896-4908.[Abstract/Free Full Text]

Infection and Immunity, August 2007, p. 3925-3934, Vol. 75, No. 8
0019-9567/07/$08.00+0     doi:10.1128/IAI.00106-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Huang, C.-Y., Lu, T.-Y., Bair, C.-H., Chang, Y.-S., Jwo, J.-K., Chang, W. (2008). A Novel Cellular Protein, VPEF, Facilitates Vaccinia Virus Penetration into HeLa Cells through Fluid Phase Endocytosis. J. Virol. 82: 7988-7999 [Abstract] [Full Text]  
  • Cheng, W., Shivshankar, P., Zhong, Y., Chen, D., Li, Z., Zhong, G. (2008). Intracellular Interleukin-1{alpha} Mediates Interleukin-8 Production Induced by Chlamydia trachomatis Infection via a Mechanism Independent of Type I Interleukin-1 Receptor. Infect. Immun. 76: 942-951 [Abstract] [Full Text]  
  • Buchholz, K. R., Stephens, R. S. (2007). The Extracellular Signal-Regulated Kinase/Mitogen-Activated Protein Kinase Pathway Induces the Inflammatory Factor Interleukin-8 following Chlamydia trachomatis Infection. Infect. Immun. 75: 5924-5929 [Abstract] [Full Text]  
  • Swanson, K. A., Crane, D. D., Caldwell, H. D. (2007). Chlamydia trachomatis Species-Specific Induction of Ezrin Tyrosine Phosphorylation Functions in Pathogen Entry. Infect. Immun. 75: 5669-5677 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hybiske, K.
Right arrow Articles by Stephens, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hybiske, K.
Right arrow Articles by Stephens, R. S.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»