This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Akman-Anderson, L.
Right arrow Articles by Luckhart, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Akman-Anderson, L.
Right arrow Articles by Luckhart, S.

 Previous Article  |  Next Article 

Infection and Immunity, August 2007, p. 4012-4019, Vol. 75, No. 8
0019-9567/07/$08.00+0     doi:10.1128/IAI.00645-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Induction of Nitric Oxide Synthase and Activation of Signaling Proteins in Anopheles Mosquitoes by the Malaria Pigment, Hemozoin{triangledown}

Leyla Akman-Anderson,1 Martin Olivier,2 and Shirley Luckhart1*

Department of Medical Microbiology and Immunology, School of Medicine, University of California at Davis, One Shields Avenue, Davis, California 95616,1 Department of Microbiology and Immunology, McGill University, Lyman Duff Medical Building, 3775 University Street, Montreal, QC H3A 2B4, Canada2

Received 8 May 2007/ Returned for modification 14 May 2007/ Accepted 19 May 2007


arrow
ABSTRACT
 
Anopheles stephensi, a major vector for malaria parasite transmission, responds to Plasmodium infection by synthesis of inflammatory levels of nitric oxide (NO), which can limit parasite development in the midgut. We have previously shown that Plasmodium falciparum glycosylphosphatidylinositols (PfGPIs) can induce A. stephensi NO synthase (AsNOS) expression in the midgut epithelium in vivo in a manner similar to the manner in which cytokines and NO are induced by PfGPIs in mammalian cells. In mosquito cells, signaling by PfGPIs and P. falciparum merozoites is mediated through Akt/protein kinase B (Akt/PKB), the mitogen-activated protein kinase kinase DSOR1, and extracellular signal-regulated kinase (ERK). In mammalian cells, a second parasite factor, malaria pigment or hemozoin (Hz), signals NOS induction through ERK- and nuclear factor kappa B-dependent pathways and has been demonstrated to be a novel proinflammatory ligand for Toll-like receptor 9. In this study, we demonstrate that Hz can also induce AsNOS gene expression in immortalized A. stephensi and Anopheles gambiae cell lines in vitro and in A. stephensi midgut tissue in vivo. In mosquito cells, Hz signaling is mediated through transforming growth factor ß-associated kinase 1, Akt/PKB, ERK, and atypical protein kinase C zeta/lambda. Our results show that Hz is a prominent parasite-derived signal for Anopheles and that signaling pathways activated by PfGPIs and Hz have both unique and shared components. Together with our previous findings, our data indicate that parasite signaling of innate immunity is conserved in mosquito and mammalian cells.


arrow
INTRODUCTION
 
Anopheles stephensi and A. gambiae, the two most important vectors in malaria parasite transmission, respond to Plasmodium infection with inducible expression of nitric oxide synthase (NOS) (13, 30). Significant induction of NOS in A. stephensi midguts can be detected as early as 6 h after infection with Plasmodium berghei, a rodent parasite (29). Within 24 to 36 h after ingestion of Plasmodium-infected blood, parasites develop into ookinetes and penetrate the midgut epithelium to form oocysts beneath the basal lamina. Early induction of NOS is critical to limiting parasite development in A. stephensi, as provision of the pan-NOS inhibitor N-{omega}-nitro-L-arginine results in increased parasite numbers in the midgut compared to controls, while provision of the NOS substrate L-arginine reduces the parasite burden (30).

The NO-mediated defense of A. stephensi is analogous to mammalian NO-mediated inactivation of malaria parasites (2, 40). In mammalian cells, two Plasmodium-associated molecular pattern structures, glycosylphosphatidylinositol (GPI) and hemozoin (Hz), are known to upregulate NOS and modulate immune responses (for a review, see reference 39). Plasmodium falciparum GPI (PfGPI)-induced signaling is mediated through Toll-like receptor 2 (TLR2) and TLR4 and involves myeloid differentiation factor 88-dependent activation of extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase, p38 mitogen-activated protein kinase (MAPK), protein kinase C (PKC), and nuclear factor kappa B (NF-{kappa}B) signaling pathways (24, 46, 48). We have previously shown that purified PfGPIs can also induce NOS expression in A. stephensi cells in vitro and in the midgut epithelium in vivo (28). In A. stephensi cells, signaling by PfGPIs is mediated through Akt/protein kinase B (Akt/PKB) and involves the MAPK kinase DSOR1 (downstream of raf1) and ERK. These evident similarities in GPI signaling between mammalian and mosquito cells indicate that PfGPIs are common inflammatory mediators in both the mammalian host and the invertebrate vector.

Malaria parasite Hz is a dark brown pigment produced during hemoglobin (Hb) digestion inside host red blood cells (RBCs) (16). Hz is structurally similar to ß-hematin, which is composed of cyclic heme dimers, i.e., (FeIII-protoporphyrin IX)2. Heme dimers interact through hydrogen bonds and form Hz crystals. As RBCs burst, Hz is released and subsequently engulfed by monocytes, neutrophils, and macrophages (3). Several studies showed that P. falciparum-derived Hz (PfHz) and synthetic Hz (sHz), which can be produced chemically and is spectroscopically and crystallographically identical to the native pigment (35), induce secretion of proinflammatory mediators, including tumor necrosis factor alpha, interleukin-1 beta (38), and the pyrogens macrophage inflammatory proteins 1{alpha} and 1ß (43) in monocytes and macrophages. Both PfHz and sHz increase gamma interferon-mediated NO generation through ERK- and NF-{kappa}B-dependent signaling pathways in macrophages (19, 20). Recently, Hz was shown to be a novel non-DNA ligand for TLR9 (9).

Our previous studies suggested that P. falciparum components other than GPIs could induce A. stephensi NOS (AsNOS) expression (28). Specifically, 15.6 merozoites/cell (equivalent to 0.25 µM PfGPIs) induced AsNOS expression 3-fold, whereas 0.25 µM PfGPIs induced AsNOS expression only 1.7-fold relative to controls. Based on these findings and studies with mammalian cells, we hypothesized that Hz could induce NOS expression and immune activation in mosquitoes as well. This hypothesis is supported by the biology of mosquito feeding. Soon after a mosquito takes an infected blood meal, Hz is released from parasitized RBCs and leukocytes as digestion begins in the midgut. The peritrophic matrix (PM), which forms a barrier between the ingested blood and the midgut epithelium, is fully formed by 48 h after a blood meal (pBM) in A. gambiae (11). Hence, the midgut epithelium is possibly exposed to Hz before the completion of PM formation. In this study, we showed that PfHz can induce AsNOS expression in vitro and in vivo in the mosquito midgut epithelium. Malaria parasite Hz also activates protein kinases associated with multiple pathways in vitro. Further elucidation of the roles of Plasmodium-associated factors in innate immunity and identification of the downstream signaling pathways will advance our understanding of the antiparasite defense in general and help us discover novel targets for genetic enhancement of parasite resistance in mosquitoes.


arrow
MATERIALS AND METHODS
 
Preparation of PfHz. P. falciparum was cultured at a low hematocrit (~40% parasitemia). After schizont burst, the culture was centrifuged at 210 x g at room temperature for 10 min. The supernatant containing merozoites, digestive vacuoles, and some membrane fragments was centrifuged at 2,990 x g for 10 min. The pellet was suspended in phosphate-buffered saline (PBS) and overlaid on sequential cushions of 30, 45, 60, and 90% Percoll. The 45% Percoll layer contained mainly digestive vacuoles and was collected and washed two times with endotoxin-free PBS (Life Technologies). The partially purified digestive vacuoles were extracted with chloroform-methanol (2:1, vol/vol) to remove phospholipids and neutral lipids. The pellet was extracted with chloroform-methanol-water (10:10:3, vol/vol/vol) to remove GPIs. The remaining pellet was sonicated and washed seven or eight times in 2% sodium dodecyl sulfate (SDS). The washed pellet was incubated with 2 mg/ml proteinase K at 37°C overnight and then washed three times in 2% SDS and incubated in 6 M urea for 3 h at room temperature on a shaker. After three to five washes in 2% SDS, the Hz pellet was washed with distilled water, treated with 100 U/ml DNase for 1 h, washed three times with 2% SDS, and then washed in distilled water. Finally, the Hz pellet was washed with endotoxin-free water and suspended in endotoxin-free PBS.

Synthesis of ß-hematin (sHz). sHz was prepared from hemin chloride using a protocol adapted from that described by Egan et al. (14). Briefly, 45 mg of hemin chloride (≥98% pure; Fluka) was solubilized in 4.5 ml of 1 N NaOH and neutralized with 1 N HCl. After neutralization, 10.2 ml of 1 M CH3COONa (pH 4.8) was added, and the suspension was stirred with a magnet for 2 to 3 h at 60°C. Following addition of 0.01 volume of 10% SDS and centrifugation at 14,000 x g for 15 min, the pellet was sonicated in 100 mM NaHCO3 (pH 9.0)-0.5% SDS and centrifuged again. The pellet was washed three or four times in 2% SDS and then in water to remove the SDS. The pigment was dried at 37°C overnight, resuspended in endotoxin-free PBS at a final concentration of 2.5 mg/ml, and kept at –20°C until further use. The absence of endotoxin contamination was confirmed by performing the Limulus amebocyte lysate test with an E-toxate kit (Sigma-Aldrich).

Stimulation of A. stephensi and A. gambiae cells. The immortalized, embryo-derived A. stephensi cell line ASE (25) was cultured in modified minimal essential medium (Cellgro) containing 5% heat-inactivated fetal bovine serum (Invitrogen) at 28°C under 5% CO2. Immortalized A. gambiae cell lines Sua5.1 and 4a3B (derived from minced larvae and generously provided by Hans-Michael Muller, EMBL [34]) were cultured in Schneider's medium (Invitrogen) containing 10% heat-inactivated fetal bovine serum at 28°C. For stimulation, 1 x 106 to 3 x 106 cells were seeded in 24-well plates and allowed to grow overnight. Cells were stimulated with sHz, PfHz, or the diluent endotoxin-free PBS (pH 7.4) (Gibco) as a control. For Western blot and real-time quantitative reverse transcription (qRT)-PCR analyses, cells were harvested 5 to 10 min and 1 to 48 h after stimulation, respectively.

Real-time qRT-PCR analysis. Total RNA was isolated from mosquito cells using Trizol reagent (Invitrogen) 1 to 48 h after Hz treatment. NOS expression was analyzed by qRT-PCR using ABI Prism 7300 or 7700 sequence detection systems (Applied Biosystems). NOS expression levels were normalized against S7 ribosomal protein gene expression by the comparative cycle threshold method as described previously (10, 30). The sequences of primers used for amplification were as follows: AsNOS forward, 5'GACCAAACCGGTCATCCTGAT3'; AsNOS reverse, 5'GGAATCTTGCAGTCAACCATTTC3'; AgNOS forward, 5'CCTGATCGGTCCCGGTACT3'; AgNOS reverse, 5'AATTGGCAACATTCCACATACCTT3'; S7 forward, 5'GAAGGCCTTCCAGAAGGTACAGA3'; and S7 reverse, 5'CATCGGTTTGGGCAGAATG3'. The probe sequences were as follows: NOS, 6-carboxyfluorescein-CACCGTTCCGTTCGTTCTGGCA-6-carboxytetramethylrhodamine; and S7, VIC-AGAAGTTCTCCGGCAAGCACGTCGT-6-carboxytetramethylrhodamine. Duplicate reaction mixtures using 100 ng template RNA were analyzed simultaneously with no template controls. All reactions were performed as one-step RT-PCR (TaqMan Gold RT-PCR; Applied Biosystems) as follows: 30 min at 50°C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C.

Mosquito rearing and provision of PfHz by an artificial blood meal. A. stephensi Liston was reared at 27°C and 80% relative humidity. Five-day-old mosquitoes were fed an artificial blood meal of heat-inactivated human serum and washed human RBCs (Continental Services Group) supplemented with 1.25 to 50 µg/ml of PfHz or hemin chloride (≥98% pure; Fluka) in PBS or supplemented with an equivalent volume of PBS as a control, using a Hemotek membrane feeding apparatus (Discovery Workshops, Accrington, United Kingdom). Mosquitoes were allowed to feed for 30 min. Midguts of blood-fed mosquitoes were dissected at various time points pBM, and 15 to 20 midguts from each group were pooled in Trizol (Invitrogen) at 4°C. Total RNA was isolated and used for AsNOS expression analysis by qRT-PCR as described above.

Western blot analyses. Following stimulation, equal numbers of cells were collected in lysis buffer containing 10 mM Tris-HCl (pH 7.4), 100 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM NaF, 20 mM Na4P2O7, 2 mM Na3VO4, 0.1% SDS, 0.5% sodium deoxycholate, 1% Triton X-100, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, 60 µg/ml aprotinin, 10 µg/ml leupeptin, 1 µg/ml pepstatin, and 1 µg/ml calyculin A. For analysis of atypical PKC (aPKC) activation, cellular proteins were fractionated using a ProteoExtract subcellular proteome extraction kit (Calbiochem). Lysate proteins from equivalent numbers of treated cells were electrophoretically separated using SDS-polyacrylamide gel electrophoresis (Bio-Rad); equal loading of proteins was also confirmed by Coomassie blue staining. Separated proteins were transferred to nitrocellulose membranes using a semidry blotter (Bio-Rad). Membranes were blocked overnight at 4°C with Tris-buffered saline (pH 7.4) containing 0.1% Tween 20 and 5% dried skim milk and incubated with a 1:1,000 dilution of polyclonal rabbit anti-phospho-transforming growth factor ß-associated kinase 1 (anti-phospho-TAK1) (pT184; Cell Signaling Technology), anti-phospho-Akt/PKB (pT308; Biosource International), anti-phospho-aPKC zeta/lambda (anti-phospho-aPKC{zeta}/{lambda}) (pT410/403; Cell Signaling Technology), or anti-phospho-p38 MAPK (pT180pY182; Cayman Chemical) antiserum or a 1:10,000 dilution of monoclonal mouse anti-phospho-ERK1/2 (pT185/pY187; Sigma) antiserum for 6 h at room temperature. Membranes were washed and incubated with horseradish peroxide-conjugated anti-rabbit (1:10,000; Biosource) or anti-mouse (1:25,000; Sigma) immunoglobulin G overnight at 4°C. Peroxidase activity was detected with a SuperSignal West Pico chemiluminescent detection kit (Pierce).


arrow
RESULTS
 
Hz induces NOS expression in Anopheles cells. To determine whether Hz could act as a signal to mosquito cells, ASE cells were treated with endotoxin-free Hz purified from P. falciparum. Preliminary time course analyses showed that maximal induction of NOS occurred at 24 h after stimulation with PfHz in mosquito cells (data not shown). Therefore, levels of NOS expression induction were analyzed 24 h after Hz stimulation, the treatment time used for similar experiments with mammalian cells (19, 23). The Hz concentrations used were also comparable to concentrations of PfHz (0.1 to 75 µg/ml) used for murine and human macrophage and monocyte stimulation assays in vitro (19, 23). At 24 h after treatment, PfHz significantly induced AsNOS expression from 1.5- to 2.5-fold in ASE cells relative to PBS-treated controls, except for the lowest dose (Fig. 1A).


Figure 1
View larger version (28K):
[in this window]
[in a new window]

  		FIG. 1. NOS expression is induced by sHz and PfHz in Anopheles cells. (A) ASE cells were stimulated with PfHz at concentrations of 1.25 to 50 µg/ml or with PBS as a control for 24 h (n = 3). (B) 4a3B cells were stimulated with sHz at concentrations of 1.25 to 50 µg/ml or with PBS as a control for 24 h (n = 4). Sua5.1 cells were treated with PfHz at the same concentrations for 24 and 48 h (n = 4). NOS expression values were divided by the values for PBS-treated controls to obtain relative induction levels. The error bars indicate standard errors of the means. Data within each treatment were analyzed using the Student t test. P values are represented as follows: two asterisks, P ≤ 0.01; one asterisk, P ≤ 0.05.

To determine whether sHz prepared from high-purity hemin chloride could induce NOS in a manner similar to that observed with PfHz and to determine whether PfHz induction of NOS was species specific, cell lines derived from A. gambiae were treated with sHz (4a3B cells) (Fig. 1B) or PfHz (Sua5.1 cells) Fig. 1B) at concentrations that were identical to those used to treat ASE cells (Fig. 1A). At 24 h after treatment, all sHz concentrations used to stimulate 4a3B cells significantly induced A. gambiae NOS (AgNOS) from 1.5- to 3-fold relative to PBS-treated controls (Fig. 1B). These results were consistent with the levels of AsNOS expression induced by PfHz in ASE cells (Fig. 1A). At 24 h after treatment, PfHz induced AgNOS gene expression significantly in Sua5.1 cells relative to PBS-treated controls, except at doses of 1.25 µg/ml and 12.5 µg/ml (Fig. 1B). AgNOS expression in PfHz-treated Sua5.1 cells was induced 1.5- to 3.5-fold at 24 h (Fig. 1B).

In all cell lines tested, treatment with 25 µg/ml PfHz or sHz resulted in the highest significant mean NOS induction at 24 h poststimulation. At 48 h after treatment, the AgNOS induction levels in Sua5.1 cells were reduced relative to the levels detected at 24 h (Fig. 1B). However, an increase in AgNOS gene expression was still detectable and significant at all concentrations used (Fig. 1B), which suggests that AgNOS gene expression is sustainable for at least 48 h. Overall, these data show that both A. stephensi and A. gambiae cell lines respond to Hz and that the AgNOS induction by sHz is comparable to that by PfHz.

PfHz induces AsNOS expression in the A. stephensi midgut epithelium. To determine whether PfHz could function in vivo to induce AsNOS and to determine whether induction was time dependent, 50 µg/ml PfHz was provided in artificial blood meals to three separate cohorts of A. stephensi. In replicated assays, PfHz significantly induced midgut AsNOS expression twofold at 24 h pBM relative to controls (Fig. 2A), indicating that PfHz can act as a signal to induce AsNOS in vivo. The pattern of AsNOS gene expression in the midgut epithelium (Fig. 2A) was similar to the temporal pattern observed in Sua5.1 cells in vitro (data not shown). Specifically, AsNOS induction by PfHz in the midgut epithelium was maximal at 24 h pBM and reduced at 48 h (Fig. 2A).


Figure 2
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 2. AsNOS expression is induced by PfHz in the midgut epithelium in vivo, and maximum induction occurs at 24 h pBM. (A) Midguts were dissected from A. stephensi at 1 to 48 h after blood feeding for analysis of AsNOS expression (n = 3). Artificial blood meals contained washed human RBCs and plasma supplemented with 50 µg/ml PfHz or PBS as a control. (B) Midguts were dissected from A. stephensi at 24 h after blood feeding with PfHz or hemin chloride at concentrations of 1.25 to 50 µg/ml or with an equivalent volume of PBS as a control (n = 3). Data were analyzed as described in the legend to Fig. 1 using the Student t test and are mean levels of relative AsNOS induction (NOS expression in PfHz- or hemin-fed groups divided by NOS expression in PBS-fed controls); the error bars indicate standard errors of the means. P values are represented as follows: two asterisks, P ≤ 0.01; one asterisk, P ≤ 0.05.

Based on these data, we chose the 24-h time point to analyze the in vivo effects of PfHz (Fig. 2B) at concentrations identical to those used in in vitro experiments. In replicated experiments, PfHz induced AsNOS gene expression up to fourfold at 2.5 µg/ml and up to sevenfold at 25 and 50 µg/ml (Fig. 2B) relative to PBS-fed controls. As found in vitro (Fig. 1A and B), PfHz did not induce AsNOS at the lowest dose (1.25 µg/ml) (Fig. 2B). In contrast, hemin chloride induced AsNOS expression approximately fourfold at 1.25 and 50 µg/ml compared to controls (Fig. 2B). Higher AsNOS induction levels were observed in response to PfHz than in response to hemin (Fig. 2B), and PfHz induced higher levels of AsNOS in vivo (Fig. 2B) than in vitro (Fig. 1A). These data confirmed that PfHz can function as a signal to mosquito cells and that induction of NOS gene expression in the A. stephensi midgut by PfHz is not merely due to activity of its heme subunit or free heme.

Hz activates TAK1 in A. gambiae cells. Based on our data that confirmed that parasite Hz could function as a signal to mosquito cells, we investigated the activation of mosquito proteins that are orthologous to signaling proteins implicated in pathogen-associated molecular pattern-induced signaling cascades in mammalian cells (for a review, see reference 22). The selected mosquito proteins included TAK1, Akt/PKB, ERK, p38 MAPK, and aPKC{zeta}/{lambda}.

For these assays, 4a3B cells were treated with PfHz (Fig. 3A) or sHz (Fig. 3B) at concentrations identical to those that induced AgNOS expression (Fig. 1B) or with an equivalent volume of PBS as a control. At 10 min after treatment, cells were lysed and subjected to Western blot analysis for detection of TAK1 protein phosphorylation. In replicated assays, both PfHz and sHz induced TAK1 (~75 kDa) phosphorylation in 4a3B cells at concentrations of 2.5 to 50 µg/ml (Fig. 3A and B). After prolonged film exposure, cross-reacting bands were also detectable at a 1.25-µg/ml Hz dose (Fig. 3, insets). These results indicate that Hz activated TAK1, a protein that functions as a MAPK kinase and an inhibitor of NF-{kappa}B kinase-activating kinase in the immunodeficiency (imd) signaling pathway (45).


Figure 3
View larger version (88K):
[in this window]
[in a new window]

  		FIG. 3. Both PfHz and sHz can activate TAK1. 4a3B cells were treated with PfHz (A) or sHz (B) at concentrations of 1.25 to 50 µg/ml or with equivalent volumes of PBS as a control for 10 min. After stimulation, cells were lysed and analyzed by Western blotting using anti-phospho-TAK1 antisera. An additional blot was used in panel A to show TAK1 phosphorylation in samples treated with 1.25 and 2.5 µg/ml PfHz. The insets show cross-reacting bands after prolonged film exposure. Equal loading of proteins was confirmed by Coomassie blue staining (bottom panels). The blots are representative of replicated Western blots from independent experiments.

Hz activates Akt/PKB and ERK but not p38 MAPK in A. gambiae cells. Previous studies in our laboratory had shown that PfGPIs signal through the insulin signaling pathway to induce AsNOS expression and that activation of Akt/PKB and ERK, representatives of the two main branches of the insulin signaling pathway, is required for AsNOS expression (28). Since Hz signals through ERK in mammalian cells (20), we hypothesized that Hz activates Akt/PKB and ERK in mosquito cells.

For analysis of Akt/PKB activation, 4a3B cells were treated for 10 min with PfHz (Fig. 4A), with sHz (Fig. 4B), or with an equivalent volume of PBS as a control. In replicated assays, both PfHz and sHz at 12.5 to 50 µg/ml induced Akt/PKB (~60 kDa) phosphorylation (Fig. 4A and B). After prolonged film exposure, cross-reacting bands were also detectable at 1.25- and 2.5-µg/ml Hz doses (Fig. 4, insets). We observed that increasing amounts of sHz led to increasing levels of activated Akt/PKB (Fig. 4B), whereas an incremental dose response was observed only at the lowest PfHz doses (1.25 and 2.5 µg/ml) (Fig. 4A, inset). Despite these differences, our data indicate that Hz, like PfGPIs, activates Akt/PKB protein in mosquito cells.


Figure 4
View larger version (70K):
[in this window]
[in a new window]

  		FIG. 4. Both PfHz and sHz can activate Akt/PKB. 4a3B cells were treated with PfHz (A) or sHz (B) at concentrations of 1.25 to 50 µg/ml or with equivalent volumes of PBS as a control for 10 min. After stimulation, cells were lysed and analyzed by Western blotting using anti-phospho-Akt/PKB antisera. The insets show cross-reacting bands after prolonged film exposure. Equal loading of proteins was confirmed by Coomassie blue staining (bottom panels). The blots are representative of replicated Western blots from independent experiments.

Although hemin chloride could induce AsNOS expression in the A. stephensi midgut, the effective doses were distinct from those of PfHz, and the AsNOS induction levels were lower than the levels induced by PfHz (Fig. 2B). To further explore signaling by Hz and hemin, we examined activation of ERK and p38 MAPK, which are downstream of TAK1 (22) in 4a3B cells treated with sHz or hemin chloride. In replicated assays, we observed increased ERK phosphorylation in response to 1.25 to 50 µg/ml sHz (Fig. 5A, top panel) relative to the PBS-treated control. In contrast, hemin chloride at 12.5 to 50 µg/ml decreased phospho-ERK levels relative to the PBS-treated control (Fig. 5B, top panel). In contrast to ERK activation by sHz (Fig. 5A, top panel), treatment with 2.5 to 50 µg/ml sHz (Fig. 5A, middle panel) or PfHz (data not shown) reduced p38 MAPK phosphorylation relative to PBS-treated control cells. However, no change in phospho-p38 MAPK levels were detected in 4a3B cells treated with hemin chloride (Fig. 5B, middle panel) compared to cells treated with PBS as a control. Thus, Hz increased phospho-ERK levels while decreasing activation of p38 MAPK, and hemin chloride reduced phospho-ERK levels without affecting the activation of phospho-p38 MAPK. These observations suggested that even though heme (provided as hemin chloride) and Hz can induce NOS expression, heme and Hz do not function as equivalent signals to mosquito cells.


Figure 5
View larger version (62K):
[in this window]
[in a new window]

  		FIG. 5. Hz and hemin are distinct signals. 4a3B cells were treated with sHz (A) or hemin chloride (B) at concentrations of 1.25 to 50 µg/ml or with equivalent volumes of PBS as a control for 10 min. After stimulation, cells were lysed and analyzed by Western blotting using anti-phospho-ERK (top panels) or anti-phospho-p38 antisera (middle panels). Equal loading of proteins was confirmed by Coomassie blue staining (bottom panels). The blots are representative of replicated Western blots from independent experiments.

Hz activates aPKC{zeta}/{lambda} in A. gambiae cells. aPKC{zeta}/{lambda} is a key regulator of critical intracellular signaling pathways induced by various extracellular stimuli and lies in the nexus of MAPK- and NF-{kappa}B-dependent pathways (18). As such, we examined whether Hz can lead to aPKC{zeta}/{lambda} phosphorylation or translocation in A. gambiae cells. At 5 min poststimulation, sHz treatment resulted in increased phosphorylation of cytosolic aPKC{zeta}/{lambda} (~85 kDa) relative to PBS-treated control cells (Fig. 6). However, no substantial differences in phospho-aPKC{zeta}/{lambda} levels were observed in the membrane or nuclear fractions from sHz-treated cells compared with control cells. Taken together, our findings demonstrate that Hz activates TAK1-, ERK-, Akt/PKB-, and aPKC-dependent pathways but negatively regulates p38 MAPK in Anopheles cells.


Figure 6
View larger version (68K):
[in this window]
[in a new window]

  		FIG. 6. sHz increases phosphorylation of cytosolic aPKC{zeta}/{lambda}. Sua5.1 cells were treated with 50 µg/ml sHz or an equivalent volume of PBS as a control for 5 min. After stimulation, cells were lysed and proteins were separated into cytosolic, membrane, and nuclear fractions. Equal amounts of proteins from the cellular compartments were analyzed by Western blotting using anti-phospho-aPKC{zeta}/{lambda} antisera. Equal loading of proteins was confirmed by Coomassie blue staining (bottom panel).


arrow
DISCUSSION
 
The NO-mediated defense against Plasmodium spp. is a shared innate immune response among mammalian hosts and mosquito vectors for this parasite (2, 30, 40). Previous studies in our laboratory showed that PfGPIs alone could induce mosquito NOS expression, but data from these studies also suggested that other parasite factors likely contribute to mosquito cell activation (28). The data described here indicate that Plasmodium-derived Hz, which functions together with PfGPIs to activate mammalian cells, contributes to immune activation of mosquito cells as well.

A review of the physiology of blood digestion is required to understand the likely events of Hz signaling in the mosquito in vivo. Blood digestion in the mosquito midgut peaks at 24 h and is completed by approximately 48 h pBM. The PM, which forms a barrier between the ingested blood and the midgut epithelium, can be visualized by electron microscopy by 12 h pBM and is fully formed by 48 h pBM in A. gambiae (5, 11, 17). However, a lack of PM formation around blood meals has also been reported when mosquitoes take a second blood meal after the PM has formed around the first meal (6), and ingestion of multiple blood meals in nature is a common reproductive strategy in Anopheles (7, 15, 26). Taken together, these observations suggest that in the early hours of blood digestion, the midgut epithelium is likely exposed to Hz released as parasitized RBCs (e.g., RBCs with trophozoites) and leukocytes are gradually lysed in the midgut. Moreover, diuresis, a rapid process during which plasma is excreted to concentrate RBCs up to fivefold in the mosquito midgut (8), could also concentrate Hz in an infected blood meal. Indeed, this process could explain the difference that we observed between the levels of AsNOS induction in ASE cells and the levels of AsNOS induction in the midgut epithelium. For example, at 24 h poststimulation, PfHz induced AsNOS expression up to 2.5-fold in ASE cells in vitro (Fig. 1A) and up to 7-fold in the A. stephensi midgut in vivo (Fig. 2B). However, this variation could also be due to physiological differences between midgut and ASE cells, the presence of critical factors in vivo (e.g., cross talk between blood components such as insulin and Hz) that are absent in vitro, or a requirement for tissue communication (e.g., communication between midgut and fat body [13]) for maximal effects of Hz.

As RBCs are lysed and Hb is digested, heme is also released in the midgut. Up to 18 nmol of heme (equivalent to 2 µl of blood containing 10 mM heme) was found to bind to the PM 48 h after feeding in Aedes aegypti (12, 37). Although it is not known whether Hz binds to PM as heme does, our findings demonstrate that PfHz could function in vivo as a proinflammatory signal to mosquito midgut cells in a way that is fundamentally different from the way that heme that is released during blood digestion functions (Fig. 2B).

Despite the general acceptance of the proinflammatory role of PfHz in mammals, some studies dispute its function as an activating signal for innate immunity. For example, Parroche et al. have recently reported that high-purity Hz (both synthetic and P. falciparum derived) is immunologically inert and that activation of TLR9 is due to contaminating parasite DNA in crude PfHz preparations since the activity of PfHz was abolished after nuclease treatment (36). These findings contradict the results of Coban et al. which demonstrated that PfHz signals through TLR9 and the results of our experiments. We used high-purity hemin chloride (≥98% pure as determined by high-performance liquid chromatography) comparable to that used by Parroche et al. in our sHz preparations. Our results demonstrate that both PfHz, which was treated with DNase during purification, and high-purity sHz can activate signaling molecules and NOS gene expression in Anopheles cells. Specifically, PfHz and sHz had nearly indistinguishable effects on mosquito cells in vitro (Fig. 1B), and these effects could be distinguished from those of heme (hemin chloride) in vivo (Fig. 2B). As such, our findings corroborate the consensus that Hz activity is attributable to the ß-hematin crystal structure and not to the heme subunit or to contaminating DNA. It is possible that discrepancies observed in Hz-induced responses among various cells result from differences in intrinsic properties (e.g., redox levels) of these cells. For instance, Hz-induced responses in macrophages were detected only when these cells were costimulated with gamma interferon (20), whereas mosquito cells appear to be naturally responsive to Hz.

Although we did not observe a linear correlation between the PfHz dose and NOS induction levels, both sHz and PfHz at a 25-µg/ml dose resulted in the highest NOS expression in vitro and in vivo (Fig. 1 and 2). A study investigating PfHZ induction of NOS enzyme activity ex vivo in peripheral blood mononuclear cells estimated that children with mild and severe malaria would have 1.9 and 12.9 µg PfHz per ml of circulating blood, respectively (23). The malaria parasite is known to ingest 60 to 80% of its host erythrocyte Hb (16). Based on conservative assumptions that about 50% of Hb heme is converted into PfHz (i.e., 47 fg per RBC), a 10% parasitemia (e.g., in a critical malaria infection) would result in approximately 23.5 µg/ml PfHz in a person with an RBC count of 5 x 106 cells per µl. Thus, a 25-µg/ml concentration of PfHz would correspond to approximately 10% parasitemia under natural conditions.

Overall, our studies suggest that both PfHz and PfGPIs are important parasite signals to mosquito cells and that their activities are complementary. Malaria parasites induce AsNOS expression at 6 h and 24 to 48 h after infection (29), a pattern that was reproduced in the mosquito by provision of PfGPIs by an artificial blood meal (28). In our experiments, PfHz induced AsNOS gene expression in the midgut only at 24 h pBM (Fig. 2B), suggesting that PfGPIs and PfHz have independent but complementary roles in regulating early antiparasite immune responses in A. stephensi. Hence, at 24 h after an infected blood meal, AsNOS expression in the midgut is likely to reach its highest levels due to cumulative effects of these two parasite signals and to be sustainable up to 48 h. Most importantly, under natural conditions, variations in the amounts of PfGPIs and PfHz ingested by Anopheles depending on the parasitemia levels of the patients are likely to influence NO production and parasite development in the midgut and thus impact transmission accordingly.

The complementary roles of PfGPIs and PfHz are further highlighted by their effects on signaling proteins in mosquito cells. Signaling by PfGPIs is mediated through A. stephensi Akt/PKB, DSOR1, and ERK. By comparison, PfHz signals A. stephensi cells through activation of TAK1, Akt/PKB, ERK, and aPKC{zeta}/{lambda}. Currently, the roles of these signaling proteins in mosquito cells are poorly known. Recently, A. gambiae immune responses against Plasmodium parasites were shown to be mediated through an alternative splicing product of an NF-{kappa}B-like gene (REL2), REL2-F (31). The imd pathway leads to activation of REL2-F, a Drosophila Relish ortholog, and activation of this signaling pathway in the midgut has been implicated in limiting Plasmodium infection in A. gambiae (31). Drosophila TAK1 acts downstream of imd and functions as an inhibitor of NF-{kappa}B kinase-activating kinase in the imd pathway (45). Based on our finding that PfHz activates TAK1 (Fig. 3), it is conceivable that PfHz may initiate the response leading to REL2-F activation.

In mammalian cells, TAK1, a MAPK kinase, can activate ERK and p38 MAPKs as well as Akt/PKB (27, 41, 44). We found that Akt/PKB and ERK are readily phosphorylated upon Hz treatment of A. gambiae cells (Fig. 4 and 5A, top panel), whereas hemin chloride caused a decrease in phospho-ERK levels at higher doses (Fig. 5B, top panel). A reduction in ERK phosphorylation was also noted in A. stephensi cells stimulated in vitro with P. falciparum merozoites (28), suggesting that heme contamination of purified merozoites could have contributed to these effects. Despite this possibility, Lim et al. (28) also demonstrated that merozoite-derived PfGPIs signal through activation of Akt/PKB and ERK in A. stephensi midgut epithelium in vivo. Hence, Akt/PKB- and ERK-dependent pathways appear to be central to the activation of immune responses by both PfGPIs and PfHz.

In contrast to activation of TAK1, Akt/PKB, and ERK, Hz decreased phospho-p38 MAPK levels in A. gambiae cells (Fig. 5A, middle panel). We suggest that these results highlight some interesting differences between mosquito and mammalian cells and between PfHz and PfGPIs. Phosphorylation of mammalian p38 MAPK has not been reported for PfHz. However, treatment with PfGPIs induced p38 MAPK phosphorylation in mouse macrophages (24), although NO synthesis in these cells was only marginally affected by the inhibition of p38 MAPK (48). Interestingly, inhibition of p38 resulted in upregulation of TLR9 gene expression in mouse dendritic cells (1). Thus, it is conceivable that PfHz treatment could induce expression of similar pattern recognition molecules in mosquitoes through inhibition of p38 MAPK.

Our data indicate that aPKC{zeta}/{lambda} is also involved in Hz signaling in Anopheles cells. aPKC{zeta}/{lambda} provides a link between distinct signaling pathways and can act both upstream and downstream of NF-{kappa}B (4, 33). Although the mechanism of aPKC activation is still unclear, aPKC activity correlates with the phosphorylation of Thr410 and Thr403 in the kinase activation loop of zeta and lambda aPKCs, respectively. aPKCs are insensitive to phorbol esters, which are potent activators of classical and novel PKC isotypes (32). Previously, Schwarzer et al. showed that membrane-associated, phorbol ester-bound PKCs (classical or novel) increased transiently in Hz-fed monocytes by 50% after 30 min and decreased irreversibly to 20% of control levels within 5 h after phagocytosis (42). In this study, we found that within 5 min poststimulation, cytosolic phospho-aPKC{zeta}/{lambda} levels increased in A. gambiae cells treated with sHz (Fig. 6). Our finding of aPKC{zeta}/{lambda} phosphorylation without translocation to a membrane is in agreement with a recent study that showed that phosphoinositide-3-kinase activation can increase cytoplasmic phospho-aPKC{zeta}/{lambda} in murine adipocytes without recruitment to the plasma membrane (21). PKC-dependent pathways are also activated by PfGPIs in mouse macrophages (46), and novel PKC{varepsilon} is translocated to the plasma membrane upon treatment with PfGPIs or parasite extracts (47). Although the isotypes of PKC that are activated by PfGPIs and Hz are distinct, our data and the data of Lim et al. (28) suggest that PKC-dependent pathways are involved in both PfGPI and PfHz signaling in mosquito cells. The kinetics of aPKC{zeta}/{lambda} activation, the ultimate fate of aPKC{zeta}/{lambda} in mosquito cells, and whether these kinases are required for NOS expression remain to be determined.

Our work demonstrates that PfHz and PfGPIs can upregulate inflammatory signaling pathways in Anopheles. A key target of interest for these pathways is NOS, but based on observations in mammalian cells we suspect that NOS is one of a wide variety of inflammatory effectors that are regulated by these pathways. As such, the identification of downstream targets in mosquito cells may reveal a wealth of new antiparasite effectors. We have discovered several key signaling proteins involved in the mosquito response to malaria parasite infection that have not been previously identified, and the additional molecules and pathways may provide fruitful targets for genetically enhancing mosquito resistance to parasite development.

Comparisons of our findings with those in mammals have significant implications for understanding the evolution of the innate host response to malaria parasite infection; that is, shared responses to the same parasite factors can be interpreted as evolutionarily conserved, whereas responses that are unique to mosquitoes may indicate that the orthologous response was lost from mammalian cells or that it has been replaced by newly evolved, more efficient responses. Striking similarities in mosquito and mammalian innate immune responses against Plasmodium-associated molecular patterns such as PfGPIs and PfHz point to substantial evolutionary conservation in host and vector defense mechanisms against infection and suggest that the mosquito can be used as a model for comparative studies of innate immunity.


arrow
ACKNOWLEDGMENTS
 
This work was supported by Public Health Service grant AI060664 from the National Institute of Allergy and Infectious Diseases at the National Institutes of Health and was performed in a facility with support from Research Facilities Improvement Grant C06 RR-12088-01 from the National Center for Research Resources of the NIH.

We thank Channe D. Gowda for kindly providing PfHz samples and reviewing the manuscript and Gowdahalli Krishnegowda for PfHz purification. We also thank Kong Wai Cheung for his kind assistance with mosquito dissections.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Medical Microbiology and Immunology, 3437 Tupper Hall, One Shields Avenue, School of Medicine, University of California at Davis, Davis, CA 95616. Phone: (530) 754-6963. Fax: (530) 752-8692. E-mail: sluckhart{at}ucdavis.edu Back

{triangledown} Published ahead of print on 25 May 2007. Back

Editor: W. A. Petri, Jr.


arrow
REFERENCES
 
    1
  1. An, H., Y. Yu, M. Zhang, H. Xu, R. Qi, X. Yan, S. Liu, W. Wang, Z. Guo, J. Guo, Z. Qin, and X. Cao. 2002. Involvement of ERK, p38 and NF-kappaB signal transduction in regulation of TLR2, TLR4 and TLR9 gene expression induced by lipopolysaccharide in mouse dendritic cells. Immunology 106:38-45.[CrossRef][Medline]
    2. 2
  2. Anstey, N. M., J. B. Weinberg, M. Y. Hassanali, E. D. Mwaikambo, D. Manyenga, M. A. Misukonis, D. R. Arnelle, D. Hollis, M. I. McDonald, and D. L. Granger. 1996. Nitric oxide in Tanzanian children with malaria: inverse relationship between malaria severity and nitric oxide production/nitric oxide synthase type 2 expression. J. Exp. Med. 184:557-567.[Abstract/Free Full Text]
    3. 3
  3. Arese, P., and E. Schwarzer. 1997. Malarial pigment (haemozoin): a very active ‘inert’ substance. Ann. Trop. Med. Parasitol. 91:501-516.[CrossRef][Medline]
    4. 4
  4. Avila, A., N. Silverman, M. T. Diaz-Meco, and J. Moscat. 2002. The Drosophila atypical protein kinase C-ref(2)p complex constitutes a conserved module for signaling in the toll pathway. Mol. Cell. Biol. 22:8787-8795.[Abstract/Free Full Text]
    5. 5
  5. Berner, R., W. Rudin, and H. Hecker. 1983. Peritrophic membranes and protease activity in the midgut of the malaria mosquito, Anopheles stephensi (Liston) (Insecta: Diptera) under normal and experimental conditions. J. Ultrastruct. Res. 83:195-204.[CrossRef][Medline]
    6. 6
  6. Billingsley, P. F., and W. Rudin. 1992. The role of the mosquito peritrophic membrane in bloodmeal digestion and infectivity of Plasmodium species. J. Parasitol. 78:430-440.[CrossRef][Medline]
    7. 7
  7. Briegel, H., and E. Horler. 1993. Multiple blood meals as a reproductive strategy in Anopheles (Diptera: Culicidae). J. Med. Entomol. 30:975-985.[Medline]
    8. 8
  8. Briegel, H., and L. Rezzonico. 1985. Concentration of host blood protein during feeding by anopheline mosquitoes (Diptera: Culicidae). J. Med. Entomol. 22:612-618.[Medline]
    9. 9
  9. Coban, C., K. J. Ishii, T. Kawai, H. Hemmi, S. Sato, S. Uematsu, M. Yamamoto, O. Takeuchi, S. Itagaki, N. Kumar, T. Horii, and S. Akira. 2005. Toll-like receptor 9 mediates innate immune activation by the malaria pigment hemozoin. J. Exp. Med. 201:19-25.[Abstract/Free Full Text]
    10. 10
  10. Crampton, A. L., and S. Luckhart. 2001. Isolation and characterization of As60A, a transforming growth factor-beta gene, from the malaria vector Anopheles stephensi. Cytokine 13:65-74.[CrossRef][Medline]
    11. 11
  11. Dana, A. N., Y. S. Hong, M. K. Kern, M. E. Hillenmeyer, B. W. Harker, N. F. Lobo, J. R. Hogan, P. Romans, and F. H. Collins. 2005. Gene expression patterns associated with blood-feeding in the malaria mosquito Anopheles gambiae. BMC Genomics 6:5.[CrossRef][Medline]
    12. 12
  12. Devenport, M., P. H. Alvarenga, L. Shao, H. Fujioka, M. L. Bianconi, P. L. Oliveira, and M. Jacobs-Lorena. 2006. Identification of the Aedes aegypti peritrophic matrix protein AeIMUCI as a heme-binding protein. Biochemistry 45:9540-9549.[CrossRef][Medline]
    13. 13
  13. Dimopoulos, G., D. Seeley, A. Wolf, and F. C. Kafatos. 1998. Malaria infection of the mosquito Anopheles gambiae activates immune-responsive genes during critical transition stages of the parasite life cycle. EMBO J. 17:6115-6123.[CrossRef][Medline]
    14. 14
  14. Egan, T. J., D. C. Ross, and P. A. Adams. 1994. Quinoline anti-malarial drugs inhibit spontaneous formation of beta-haematin (malaria pigment). FEBS Lett. 352:54-57.[CrossRef][Medline]
    15. 15
  15. Fernandes, L., and H. Briegel. 2005. Reproductive physiology of Anopheles gambiae and Anopheles atroparvus. J. Vector Ecol. 30:11-26.[Medline]
    16. 16
  16. Francis, S. E., D. J. Sullivan, Jr., and D. E. Goldberg. 1997. Hemoglobin metabolism in the malaria parasite Plasmodium falciparum. Annu. Rev. Microbiol. 51:97-123.[CrossRef][Medline]
    17. 17
  17. Freyvogel, T. A., and C. Jaquet. 1965. The prerequisites for the formation of a peritrophic membrane in Culicidae females. Acta Trop. 22:148-154.[Medline]
    18. 18
  18. Hirai, T., and K. Chida. 2003. Protein kinase Czeta (PKCzeta): activation mechanisms and cellular functions. J. Biochem. (Tokyo) 133:1-7.[Abstract/Free Full Text]
    19. 19
  19. Jaramillo, M., M. Godbout, and M. Olivier. 2005. Hemozoin induces macrophage chemokine expression through oxidative stress-dependent and -independent mechanisms. J. Immunol. 174:475-484.[Abstract/Free Full Text]
    20. 20
  20. Jaramillo, M., D. C. Gowda, D. Radzioch, and M. Olivier. 2003. Hemozoin increases IFN-gamma-inducible macrophage nitric oxide generation through extracellular signal-regulated kinase- and NF-kappa B-dependent pathways. J. Immunol. 171:4243-4253.[Abstract/Free Full Text]
    21. 21
  21. Kanzaki, M., S. Mora, J. B. Hwang, A. R. Saltiel, and J. E. Pessin. 2004. Atypical protein kinase C (PKCzeta/lambda) is a convergent downstream target of the insulin-stimulated phosphatidylinositol 3-kinase and TC10 signaling pathways. J. Cell Biol. 164:279-290.[Abstract/Free Full Text]
    22. 22
  22. Kawai, T., and S. Akira. 2006. TLR signaling. Cell Death Differ. 13:816-825.[CrossRef][Medline]
    23. 23
  23. Keller, C. C., P. G. Kremsner, J. B. Hittner, M. A. Misukonis, J. B. Weinberg, and D. J. Perkins. 2004. Elevated nitric oxide production in children with malarial anemia: hemozoin-induced nitric oxide synthase type 2 transcripts and nitric oxide in blood mononuclear cells. Infect. Immun. 72:4868-4873.[Abstract/Free Full Text]
    24. 24
  24. Krishnegowda, G., A. M. Hajjar, J. Zhu, E. J. Douglass, S. Uematsu, S. Akira, A. S. Woods, and D. C. Gowda. 2005. Induction of proinflammatory responses in macrophages by the glycosylphosphatidylinositols of Plasmodium falciparum: cell signaling receptors, glycosylphosphatidylinositol (GPI) structural requirement, and regulation of GPI activity. J. Biol. Chem. 280:8606-8616.[Abstract/Free Full Text]
    25. 25
  25. Kurtti, T. J., and U. G. Munderloh. 1989. Advances in the definition of culture media for mosquito cells, p. 21-29. In J. Mitsuhashi (ed.), Invertebrate cell system applications, vol. 1. CRC Press, Inc., Boca Raton, FL.
    26. 26
  26. Lardeux, F., P. Loayza, B. Bouchite, and T. Chavez. 2007. Host choice and human blood index of Anopheles pseudopunctipennis in a village of the Andean valleys of Bolivia. Malar. J. 6:8.[CrossRef][Medline]
    27. 27
  27. Lee, J., L. Mira-Arbibe, and R. J. Ulevitch. 2000. TAK1 regulates multiple protein kinase cascades activated by bacterial lipopolysaccharide. J. Leukoc. Biol. 68:909-915.[Abstract/Free Full Text]
    28. 28
  28. Lim, J., D. C. Gowda, G. Krishnegowda, and S. Luckhart. 2005. Induction of nitric oxide synthase in Anopheles stephensi by Plasmodium falciparum: mechanism of signaling and the role of parasite glycosylphosphatidylinositols. Infect. Immun. 73:2778-2789.[Abstract/Free Full Text]
    29. 29
  29. Luckhart, S., A. L. Crampton, R. Zamora, M. J. Lieber, P. C. Dos Santos, T. M. Peterson, N. Emmith, J. Lim, D. A. Wink, and Y. Vodovotz. 2003. Mammalian transforming growth factor beta1 activated after ingestion by Anopheles stephensi modulates mosquito immunity. Infect. Immun. 71:3000-3009.[Abstract/Free Full Text]
    30. 30
  30. Luckhart, S., Y. Vodovotz, L. Cui, and R. Rosenberg. 1998. The mosquito Anopheles stephensi limits malaria parasite development with inducible synthesis of nitric oxide. Proc. Natl. Acad. Sci. USA 95:5700-5705.[Abstract/Free Full Text]
    31. 31
  31. Meister, S., S. M. Kanzok, X. L. Zheng, C. Luna, T. R. Li, N. T. Hoa, J. R. Clayton, K. P. White, F. C. Kafatos, G. K. Christophides, and L. Zheng. 2005. Immune signaling pathways regulating bacterial and malaria parasite infection of the mosquito Anopheles gambiae. Proc. Natl. Acad. Sci. USA 102:11420-11425.[Abstract/Free Full Text]
    32. 32
  32. Moscat, J., and M. T. Diaz-Meco. 2000. The atypical protein kinase Cs. Functional specificity mediated by specific protein adapters. EMBO Rep. 1:399-403.[CrossRef][Medline]
    33. 33
  33. Moscat, J., P. Rennert, and M. T. Diaz-Meco. 2006. PKCzeta at the crossroad of NF-kappaB and Jak1/Stat6 signaling pathways. Cell Death Differ. 13:702-711.[CrossRef][Medline]
    34. 34
  34. Muller, H. M., G. Dimopoulos, C. Blass, and F. C. Kafatos. 1999. A hemocyte-like cell line established from the malaria vector Anopheles gambiae expresses six prophenoloxidase genes. J. Biol. Chem. 274:11727-11735.[Abstract/Free Full Text]
    35. 35
  35. Pagola, S., P. W. Stephens, D. S. Bohle, A. D. Kosar, and S. K. Madsen. 2000. The structure of malaria pigment beta-haematin. Nature 404:307-310.[CrossRef][Medline]
    36. 36
  36. Parroche, P., F. N. Lauw, N. Goutagny, E. Latz, B. G. Monks, A. Visintin, K. A. Halmen, M. Lamphier, M. Olivier, D. C. Bartholomeu, R. T. Gazzinelli, and D. T. Golenbock. 2007. Malaria hemozoin is immunologically inert but radically enhances innate responses by presenting malaria DNA to Toll-like receptor 9. Proc. Natl. Acad. Sci. USA 104:1919-1924.[Abstract/Free Full Text]
    37. 37
  37. Pascoa, V., P. L. Oliveira, M. Dansa-Petretski, J. R. Silva, P. H. Alvarenga, M. Jacobs-Lorena, and F. J. Lemos. 2002. Aedes aegypti peritrophic matrix and its interaction with heme during blood digestion. Insect Biochem. Mol. Biol. 32:517-523.[CrossRef][Medline]
    38. 38
  38. Pichyangkul, S., P. Saengkrai, and H. K. Webster. 1994. Plasmodium falciparum pigment induces monocytes to release high levels of tumor necrosis factor-alpha and interleukin-1 beta. Am. J. Trop. Med. Hyg. 51:430-435.[Abstract/Free Full Text]
    39. 39
  39. Riley, E. M., S. Wahl, D. J. Perkins, and L. Schofield. 2006. Regulating immunity to malaria. Parasite Immunol. 28:35-49.[CrossRef][Medline]
    40. 40
  40. Rockett, K. A., M. M. Awburn, W. B. Cowden, and I. A. Clark. 1991. Killing of Plasmodium falciparum in vitro by nitric oxide derivatives. Infect. Immun. 59:3280-3283.[Abstract/Free Full Text]
    41. 41
  41. Sato, S., H. Sanjo, K. Takeda, J. Ninomiya-Tsuji, M. Yamamoto, T. Kawai, K. Matsumoto, O. Takeuchi, and S. Akira. 2005. Essential function for the kinase TAK1 in innate and adaptive immune responses. Nat. Immunol. 6:1087-1095.[CrossRef][Medline]
    42. 42
  42. Schwarzer, E., F. Turrini, G. Giribaldi, M. Cappadoro, and P. Arese. 1993. Phagocytosis of P. falciparum malarial pigment hemozoin by human monocytes inactivates monocyte protein kinase C. Biochim. Biophys. Acta 1181:51-54.[Medline]
    43. 43
  43. Sherry, B. A., G. Alava, K. J. Tracey, J. Martiney, A. Cerami, and A. F. Slater. 1995. Malaria-specific metabolite hemozoin mediates the release of several potent endogenous pyrogens (TNF, MIP-1 alpha, and MIP-1 beta) in vitro, and altered thermoregulation in vivo. J. Inflamm. 45:85-96.[Medline]
    44. 44
  44. Shim, J. H., C. Xiao, A. E. Paschal, S. T. Bailey, P. Rao, M. S. Hayden, K. Y. Lee, C. Bussey, M. Steckel, N. Tanaka, G. Yamada, S. Akira, K. Matsumoto, and S. Ghosh. 2005. TAK1, but not TAB1 or TAB2, plays an essential role in multiple signaling pathways in vivo. Genes Dev. 19:2668-2681.[Abstract/Free Full Text]
    45. 45
  45. Silverman, N., R. Zhou, R. L. Erlich, M. Hunter, E. Bernstein, D. Schneider, and T. Maniatis. 2003. Immune activation of NF-kappaB and JNK requires Drosophila TAK1. J. Biol. Chem. 278:48928-48934.[Abstract/Free Full Text]
    46. 46
  46. Tachado, S. D., P. Gerold, M. J. McConville, T. Baldwin, D. Quilici, R. T. Schwarz, and L. Schofield. 1996. Glycosylphosphatidylinositol toxin of Plasmodium induces nitric oxide synthase expression in macrophages and vascular endothelial cells by a protein tyrosine kinase-dependent and protein kinase C-dependent signaling pathway. J. Immunol. 156:1897-1907.[Abstract]
    47. 47
  47. Tachado, S. D., P. Gerold, R. Schwarz, S. Novakovic, M. McConville, and L. Schofield. 1997. Signal transduction in macrophages by glycosylphosphatidylinositols of Plasmodium, Trypanosoma, and Leishmania: activation of protein tyrosine kinases and protein kinase C by inositolglycan and diacylglycerol moieties. Proc. Natl. Acad. Sci. USA 94:4022-4027.[Abstract/Free Full Text]
    48. 48
  48. Zhu, J., G. Krishnegowda, and D. C. Gowda. 2005. Induction of proinflammatory responses in macrophages by the glycosylphosphatidylinositols of Plasmodium falciparum: the requirement of extracellular signal-regulated kinase, p38, c-Jun N-terminal kinase and NF-kappaB pathways for the expression of proinflammatory cytokines and nitric oxide. J. Biol. Chem. 280:8617-8627.[Abstract/Free Full Text]

Infection and Immunity, August 2007, p. 4012-4019, Vol. 75, No. 8
0019-9567/07/$08.00+0     doi:10.1128/IAI.00645-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Knipp, S., Bicker, G. (2009). Regulation of enteric neuron migration by the gaseous messenger molecules CO and NO. Development 136: 85-93 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Akman-Anderson, L.
Right arrow Articles by Luckhart, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Akman-Anderson, L.
Right arrow Articles by Luckhart, S.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»