IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
IAI.00825-07v1
76/1/161    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vasquez, R. E.
Right arrow Articles by Soong, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vasquez, R. E.
Right arrow Articles by Soong, L.

 Previous Article  |  Next Article 

Infection and Immunity, January 2008, p. 161-169, Vol. 76, No. 1
0019-9567/08/$08.00+0     doi:10.1128/IAI.00825-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Effects of CXCL10 on Dendritic Cell and CD4+ T-Cell Functions during Leishmania amazonensis Infection{triangledown}

René E. Vasquez,1 Lijun Xin,1 and Lynn Soong1,2*

Departments of Microbiology and Immunology,1 Pathology, Center for Biodefense and Emerging Infectious Diseases, Sealy Center for Vaccine Development, Institute for Human Infections and Immunity, University of Texas Medical Branch, Galveston, Texas 77555-10702

Received 15 June 2007/ Returned for modification 23 July 2007/ Accepted 27 October 2007


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Leishmania amazonensis can cause progressive disease in most inbred strains of mice. We have previously reported that treatment with CXCL10 activates macrophage (M{Phi}) effector function(s) in parasite killing and significantly delays lesion development in susceptible C57BL/6 mice via enhanced gamma interferon (IFN-{gamma}) and interleukin 12 (IL-12) secretion; however, the mechanism underlying this enhanced immunity against L. amazonensis infection remains largely unresolved. In this study, we utilized stationary promastigotes to infect bone marrow-derived dendritic cells (DCs) of C57BL/6 mice and assessed the activation of DC subsets and the capacity of these DC subsets to prime CD4+ T cells in vitro. We found that CXCL10 induced IL-12 p40 production but reduced IL-10 production in uninfected DCs. Yet L. amazonensis-infected DCs produced elevated levels of IL-10 despite CXCL10 treatment. Elimination of endogenous IL-10 led to increased IL-12 p40 production in DCs as well as increased proliferation and IFN-{gamma} production by in vitro-primed CD4+ T cells. In addition, CXCL10-treated CD4+ T cells became more responsive to IL-12 via increased expression of the IL-12 receptor β2 chain and produced elevated levels of IFN-{gamma}. This report indicates the utility of CXCL10 in generating a Th1-favored, proinflammatory response, which is a prerequisite for controlling Leishmania infection.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Members of the Leishmania genus are obligate intracellular parasites that replicate within cells in the macrophage (M{Phi}) lineage, resulting in an array of clinical syndromes ranging from cutaneous lesions to visceralizing, lethal infections (29). Immune regulation of host responses to Leishmania parasites has been extensively investigated in murine models of leishmaniasis. Specifically, resistance to Leishmania major in C57BL/6 (B6) or C3H mice is clearly linked to a dominant Th1 response (40). Susceptibility of BALB/c mice to L. major is, in most cases, reliant upon early production of interleukin 4 (IL-4) (40), which promotes lesion development during the early stages of infection. Meanwhile, long-term persistence of L. major in resistant strains of mice appears to be mediated by IL-10 production (4).

Unlike infections with L. major, most inbred mouse strains are susceptible to L. amazonensis infection. Studies performed by our group and those by others have indicated a low level of Th1/Th2 mixed response, rather than Th2 dominance, as the central factor for nonhealing lesions in L. amazonensis-infected hosts (1, 19). In addition, B cells and circulating antibodies (Abs) may also contribute to L. amazonensis pathogenesis (26) via multiple mechanisms, including Ab-mediated IL-10 production from M{Phi}s and dendritic cells (DCs) (25). Decreased production of IL-12 (20), coupled with diminished expression of the IL-12 receptor β2 (IL-12Rβ2) chain on Th1 cells in L. amazonensis-infected mice (21), strongly suggests that an IL-4-independent mechanism is responsible for reduced IL-12 responsiveness and, consequently, impaired Th1 response in L. amazonensis-infected hosts.

Attempts at boosting protective immunity against L. amazonensis have met with limited success. Our laboratory and those of others have explored the potential of DNA- and parasite antigen-based vaccines (12), as well as the adoptive transfer of L. amazonensis-specific Th1 CD4+ T-cell lines (20, 36) or antigen-pulsed DCs (44), in the control of L. amazonensis infection in mice. Although each study consistently revealed an increase in gamma interferon (IFN-{gamma}) production, tissue parasite burdens appeared not completely eliminated because disease syndromes eventually resumed. Recombinant IL-12 (21) or IL-1{alpha} (48), when administered prior to L. major infection, made otherwise susceptible BALB/c mice resistant; however, exogenous IL-12 (23) or IL-1β (50) did not ameliorate L. amazonensis disease progression in L. amazonensis-infected mice. These reports indicate that other factors should be explored as potential therapeutic interventions for the control of nonhealing cutaneous leishmaniasis.

Chemokines play an important role in the proper development and functional aspects of leukocytes, as well as being crucial for the defense against pathogens. CXCL10/IP-10 (IFN-{gamma}-inducible protein 10) binds with high affinity to CXCR3 (14), a receptor known to be expressed on several types of cells in the hematopoietic lineage, including activated and memory CD4+ and CD8+ T cells, NK cells, M{Phi}s, and subsets of DCs (30). The therapeutic potential of chemokines in the control of Leishmania infections has been explored recently (6, 8). Specifically, we found that CXCL10 could activate leishmanicidal activity in murine M{Phi}s, resulting in a significant reduction in parasite infection in vitro, while local injection of CXCL10 markedly delayed disease development in susceptible B6 mice (46). This enhanced parasite killing was partially due to increased production of multiple effector molecules, such as IFN-{gamma}, IL-12, and nitric oxide (NO) following CXCL10 treatment. However, it is unclear whether CXCL10 can directly promote DC activation and Th1 responses to Leishmania infection.

Since both DCs and CD4+ T cells express CXCR3, the cognate receptor for CXCL10 (24, 33), we hypothesize that CXCL10 treatment will result in enhanced expression of IL-12 in DCs and production of IFN-{gamma} in CD4+ T cells. Here we show that CXCL10 modulated IL-12 and IL-10 production in murine bone marrow-derived DCs (BM DCs). However, L. amazonensis-infected DCs exhibited elevated IL-10 levels despite the presence of exogenous CXCL10. Elimination of endogenous IL-10 increased the responsiveness of DCs and T cells to the presence of CXCL10, as judged by enhanced IL-12 p40 production in DCs and increased priming and expansion of Th1-like CD4+ T cells. Furthermore, CXCL10 stimulated CD4+ T cells to express the IL-12Rβ2 chain and to produce elevated IFN-{gamma} levels. Collectively, these results indicate that exogenous CXCL10 triggers a Th1-favored, proinflammatory phenotype, which aids in the reduction of disease syndromes caused by L. amazonensis. This report further highlights the capability of CXCL10 to act on multiple cell types to exert proinflammatory activities.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mice. IL-10-deficient (IL-10null) and wild-type (WT) C57BL/6 (B6) mice were purchased from Jackson Laboratory (Bar Harbor, ME). Mice were maintained under specific pathogen-free conditions and used at 6 to 10 weeks of age. All protocols were approved by the Animal Care and Use Committee of the University of Texas Medical Branch (Galveston, TX).

Parasites. L. amazonensis (MHOM/BR/77/LTB0016) parasites were used in all of the experiments, and their infectivity was maintained by regular passage through BALB/c mice. Promastigotes were cultured in 20% fetal bovine serum (HyClone, Logan, UT)-supplemented Schneider's Drosophila media (Life Technologies, Rockville, MD) (pH 7) at 23°C.

BM DC culture and parasite infection. BM DCs derived from either WT or IL-10null mice were cultured in vitro in the presence of 20 ng/ml of murine granulocyte-macrophage colony-stimulating factor (eBioscience, San Diego, CA) according to the methods of our previous report (37). Briefly, at day 8 of culture, DCs were left untreated or were pretreated with recombinant mouse CXCL10 (Leinco Technologies, St. Louis, MO) (200 ng/ml) in the presence of different doses of lipopolysaccharide (LPS) (1, 5, and 20 ng/ml) or 20 ng/ml of LPS of Salmonella enterica serovar Typhimurium (Sigma, St. Louis, MO) plus 20 ng/ml of IFN-{gamma} (Leinco Technologies) for 4 h. In some cases, CD11c+ DCs were purified by positive selection using magnetic microbeads (Miltenyi Biotec, Auburn, CA). The purity of CD11c+ DCs was >90%. Cells were then infected with promastigotes at an 8:1 parasite-to-cell ratio at 33°C for 12 h and then at 37°C for another 12 h.

Fluorescence-activated cell sorter (FACS) analysis for DC surface markers and intracellular cytokines. The following specific monoclonal Abs (MAbs) were purchased from eBioscience unless stated otherwise: fluorescein isothiocyanate-conjugated anti-CD45RB (C363.16A); phycoerythrin (PE)-conjugated anti-CD83 (Michel-17); anti-IL-12 p40 (C17.8); and PE-Cy5-conjugated anti-CD11c (N418) as well as isotype control Abs, including fluorescein isothiocyanate-conjugated rat immunoglobulin G2a (IgG2a), PE-conjugated rat IgG2a, and IgG2b and PE-Cy5-conjugated hamster IgG. All staining steps were performed on ice. For intracellular staining of IL-12 p40, DCs were infected with parasites for 24 h, and 1 µl GolgiStop (BD Biosciences, San Jose, CA) was added 6 h before harvest. Cells were washed and blocked for nonspecific Ab binding and Fc receptors for 30 min by use of purified anti-mouse CD16/32, hamster IgG (Pierce, Rockford, IL), and 2% rat serum (Sigma). Cells were stained for CD11c and CD45RB as well as CD83 (not shown), and the latter was used as an additional marker to ensure proper DC activation among the different experiments. After surface staining, cells were fixed and permeabilized with a Cytofix/Cytoperm kit (BD Biosciences) and then stained for IL-12 p40. Appropriate isotype controls were included for both surface and intracellular staining. Cells were analyzed on a FACScan system (BD Biosciences) using FlowJo software (TreeStar, Ashland, OR). The mean fluorescence intensities (MFI) were calculated by subtracting the MFI of a given cell from the value obtained for its analogous conjugate isotype control MAb.

Isolation and stimulation of CD4+ T cells. CD4+ T cells were purified from the spleens of naïve B6 mice or from the draining lymph nodes (DLN) of B6 mice infected with 2 x 106 L. amazonensis cells for 8 to 10 weeks via negative selection using magnetic beads (Miltenyi Biotec). FACS analysis indicated ~95% CD4+ purity. Isolated CD4+ T cells were plated in 12-well plates at a concentration of 1 x 107 cells/well. Cells were left untreated or treated with CXCL10 (200 ng/ml) or with concanavalin A (Sigma) (2 ng/ml) for 24 h. Total RNA was then extracted via the use of Tri reagent (Sigma).

RT-PCR analysis for cytokine expression. Total RNAs (200 ng) were subjected to reverse transcription-PCR (RT-PCR) analysis, and annealing temperatures were at 58°C for β-actin and at 59°C for IL-12Rβ2 and IFN-{gamma}. Primer sequences (listed as 5' to 3') were as follows: IL-12Rβ2 F, GGGGCTGCATCCTCCATTAC; IL-12Rβ2 R, AAGTGCTGTTTGCTGGATCTG; IFN-{gamma} F, CATTGAAAGCCTAGAAAGTCTG; IFN-{gamma} R, CTCATGGAATGCATCCTTTTTCG; β-actin F, CCAGCCTTCCTTCCTGGGTA; β-actin R, CTAGAGCATTTGCGGTGCA. The expected PCR products are 405 nucleotides (nt) for IL-12Rβ2, 267 nt for IFN-{gamma}, and 350 nt for β-actin.

DC-T-cell co-culture and T-cell proliferation assay. Purified CD4+ T cells (2 x 105) were co-cultured with parasite-infected, mitomycin C-pretreated (30 min) DCs (2 x 104) in round-bottomed, 96-well plates for 4 days in a total volume of 200 µl. Culture supernatants were harvested for cytokine detection. To determine CD4+ T-cell proliferation data, 1 µCi of [3H]thymidine was added 18 h before harvest. Incorporated radioactivity was determined (in counts per second) on a microplate scintillation and luminescence counter (Packard Instrument Company, Downers Grove, IL).

Cytokine ELISA. Cytokine levels in the supernatants of infected DCs and T cells as well as in DC-T-cell co-cultures were measured by enzyme-linked immunosorbent assays (ELISA) specific for IL-12 p40, IL-10, and IFN-{gamma} (BD Biosciences). Detection limits were 16 pg/ml for IFN-{gamma}, 4 pg/ml for IL-10, and 10 pg/ml for IL-12 p40.

Data analysis. To evaluate the statistical significance of data among different groups, a one-way analysis of variance with a Tukey's multiple comparison posttest was performed utilizing GraphPad Prism version 4.00 for Windows (GraphPad Software, San Diego, CA). A difference in mean values was deemed significant at P <0.05 or very significant at P <0.01. To determine the statistical difference in calculated MFIs, a Student's two-way t test was also performed.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Modulation of IL-12 and IL-10 production by CXCL10-treated DCs. We have shown that CXCL10 can stimulate murine M{Phi}s to produce several proinflammatory cytokines and chemokines, and intradermal injection of CXCL10 reduced lesion development in susceptible C57BL/6 mice (46). Given the known expression of CXCR3 on DCs (24) and the critical roles of DCs in innate and acquired immunity to Leishmania parasites (13, 37), we investigated here the stimulatory effects of CXCL10 on BM DCs. We first focused our study on CD45RBlowCD11c+ DCs, since this subset is activated (expressing high levels of CD40 and CD83) and is the major producer of IL-12 p40 in response to infection with Leishmania promastigotes (50). We also determined that 200 ng/ml of CXCL10 was the optimal dose for treatment, since higher concentrations did not significantly change the percentage of IL-12 p40-producing cells observed (data not shown). As shown in Fig. 1A, following treatment with 200 ng/ml of CXCL10 for 24 h, ~9.5% of uninfected CD45lowCD11c+ DCs were positive for intracellular IL-12 p40, which represented a 3.5-fold increase in comparison to findings obtained with untreated cells (2.6%). As expected, DCs treated with LPS/IFN-{gamma} displayed an eightfold increase in IL-12 p40-producing DC levels compared to results obtained with untreated cells. In addition, the MFIs of CXCL10-treated DCs (86.1 ± 19.7; P < 0.05) were also significantly elevated, and in the case of LPS/IFN-{gamma} (303.8 ± 57.2) highly elevated, in comparison to findings obtained with untreated controls (32.7 ± 9.7; P < 0.001). No IL-10-producing cells were detected in any group by intracellular staining (data not shown). Using ELISA, we found a significant elevation of IL-12 p40 production (Fig. 1B; P < 0.05). In the presence of different doses of LPS (1 to 20 ng/ml), we found that CXCL10 could enhance the production of IL-12p70 and IL-10 from LPS-stimulated bulk or purified DCs (Fig. 1C and 1D). These observations suggest that CXCL10 treatment can enhance DC function, which is critically important for the control of Leishmania infection (46).


Figure 1
View larger version (35K):
[in this window]
[in a new window]

 
FIG. 1. Modulation of IL-12 and IL-10 production by CXCL10-treated DCs. BM DCs of C57BL/6 mice were seeded in 12-well plates (3 x 106 cells/well) and were subsequently treated with 200 ng/ml of CXCL10 with or without 20 ng/ml of LPS and IFN-{gamma} (A and B) or in the presence of different doses (1, 5, and 20 ng/ml) of LPS (C and D) for 24 h. Purified CD11c+ DCs were used to produce the data presented in panel D. (A) DCs were collected and stained for surface expression of CD11c and CD45RB molecules plus intracellular IL-12 p40. Percentages of positively stained cells gated on CD11c+ cells are shown. The MFI of intracellular IL-12 p40 production was corrected by subtracting the MFI of isotype controls. Data represent five independent experiments with similar results. The levels of IL-12 p40 (B) and IL-12p70 and IL-10 (C and D) in the supernatants were assayed by ELISA. Results represent means ± standard deviations of the results of four independent experiments performed in duplicate. * (P < 0.05) and ** (P < 0.01) indicate statistically significant differences between the treated groups and medium controls.

 
Exogenous CXCL10 does not reverse the immunomodulatory effect of L. amazonensis on IL-10. Since Leishmania parasites can modulate DC activation and function (9, 28, 37), we next examined the effect of CXCL10 on DC maturation and activation during L. amazonensis infection. DCs infected with promastigotes (8:1 parasite-to-DC ratio) for 4 h prior to treatment with CXCL10 showed enhanced DC activation, as judged by high frequencies of both CD83+CD45RBlow DCs (data not shown) and IL-12-producing cells (Fig. 2A). The presence of exogenous CXCL10 increases (from 1.02% to 10.54%) IL-12 p40 levels in uninfected cells (MFI, 28.68 ± 8.3 to 102.12 ± 8.6; P < 0.05), as well as IL-12 p40 levels in L. amazonensis-infected cells, but not to the degree observed in naïve DCs (from 5.96% to 7.32%) (MFI, 50.38 ± 10.0 to 70.72 ± 8.9). IL-12 p40 ELISA results further confirmed the observations from FACS staining (Fig. 2B). Although CXCL10 treatment could reduce IL-10 production from uninfected DCs, it did enhance IL-10 production from L. amazonensis-infected DCs with or without the stimulation of 20 ng/ml LPS (Fig. 2B and 2C). Also, the suppressed IL-12p70 production following L. amazonensis infection in the presence of LPS was partially reversed by CXCL10 treatment (Fig. 2C). Similar results were observed using purified CD11c+ DCs (data not shown). These observations imply that although CXCL10 treatment consistently enhanced IL-12 production from DCs, CXCL10 appeared to suppress IL-10 production in the absence of parasite infection but appeared to promote IL-10 production from L. amazonensis-infected DCs.


Figure 2
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 2. Exogenous CXCL10 does not reverse the immunomodulatory effect of L. amazonensis on IL-10. BM DCs of B6 mice were seeded in 12-well plates (3 x 106 cells/well) and infected with 2.4 x 107 L. amazonensis (La) promastigotes. At 4 h postinfection, cells were treated with 200 ng/ml CXCL10 alone (B) or in the presence of 20 ng/ml of LPS (C) for 24 h. (A) DCs were collected and stained for surface expression of CD11c and CD45RB molecules plus intracellular IL-12. Percentages of positively stained cells gated on CD11c+ cells are shown. Data represent six independent experiments with similar results. The MFI of intracellular IL-12 p40 production was corrected by subtracting the MFI of isotype controls. The amount of IL-12 p40 and IL-10 (B) and of IL-12p70 and IL-10 (C) in the supernatants was assayed by ELISA. Results represent means ± standard deviations of the results from at least three independent experiments performed in duplicate. * (P < 0.05) and ** (P < 0.01) indicate statistically significant differences between the indicated groups.

 
IL-10null DCs produce increased IL-12 levels following CXCL10 treatment. IL-10 is a well-known, immunosuppressive cytokine that is essential in down-modulating immune responses to numerous pathogens and preventing immune pathology (28). Indeed, DCs that matured in the presence of IL-10 gave rise to regulatory DCs, which promoted T-cell anergy and tolerance (49). L. amazonensis parasites have been shown to down-regulate IL-12 production in DCs and to limit DC antigen-presenting functions via multiple mechanisms that include, but are not limited to, IL-10 release (22, 37). To assess the involvement of IL-10 in CXCL10-mediated DC activation, we utilized BM DCs from IL-10null mice. Compared to WT DCs, IL-10null DCs exhibited elevated baseline production of IL-12 p40 as well as stimulation- or infection-induced IL-12 secretion (Fig. 3). Consistently, we observed that, in comparison to the results seen with their WT counterparts, deletion of IL-10 resulted in approximately 3% and 7% increases in the frequencies of IL-12 p40-producing DCs following treatment with CXCL10 and infection with parasites, respectively (Fig. 3A). Most strikingly, there was a nearly 11% increase in frequencies, as well as a very significant rise of MFIs, of IL-12 p40-producing cells in L. amazonensis-infected, CXCL10-treated IL-10null DCs in comparison to the results seen with their WT counterparts (P < 0.01). Consistent with these FACS data, ELISA analysis (Fig. 3B) also showed a significant increase in IL-12 p40 production in all IL-10null groups versus their WT DC counterparts (P < 0.05) as well as among IL-10null DCs following treatment with CXCL10 and parasite infection (P < 0.05). Collectively, these data indicate that abrogation of endogenous IL-10 can markedly enhance CXCL10-mediated and Leishmania infection-mediated DC activation via promoting IL-12 production.


Figure 3
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 3. IL-10null DCs produce increased IL-12 following CXCL10 treatment. BM DCs of WT and IL-10null B6 mice were seeded in 12-well plates (3 x 106 cells/well) and were infected with 2.4 x 107 L. amazonensis (La) promastigotes. At 4 h postinfection, cells were treated with 200 ng/ml CXCL10 for 24 h. (A) WT and IL-10null DCs were collected and stained for surface expression of CD11c+ and CD45RB molecules plus intracellular IL-12. Percentages of positively stained cells gated on CD11c+ cells are shown. The MFI of intracellular IL-12 p40 production was corrected by subtracting the MFI of isotype control. Representative data from one of three independent experiments with similar results are shown. (B) The amounts of IL-12 p40 in the supernatants were assayed by ELISA. Results represent means ± standard deviations of the results from three independent experiments performed in duplicate. * (P < 0.05) represents statistically significant differences between the indicated groups. "n.s." indicates groups whose results were not statistically significant (P > 0.05).

 
Differential effects of CXCL10 on WT and IL-10null CD4+ T-cell activation. To further determine the interplay of CXCL10 and IL-10 in DC antigen-presenting cell (APC) function during L. amazonensis infection, we used an in vitro T-cell priming assay. CD4+ T cells were purified from the spleens of naïve WT and IL-10null B6 mice and coincubated with mitomycin C-treated WT and IL-10null DCs that were previously infected with L. amazonensis and then treated with CXCL10 for 24 h. The proliferation of CD4+ responder T cells was measured after 4 days of co-culture. While CXCL10 treatment of DCs alone had no, or a marginal, effect on CD4+ T-cell proliferation, there was a significant increase in the proliferation of IL-10null CD4+ T cells co-cultured with CXCL10-treated IL-10null DCs versus WT CD4+ T cells incubated with CXCL10-treated WT DCs (Fig. 4A; P < 0.01). Of note, proliferation of IL-10null CD4+ T cells was substantially increased following incubation with L. amazonensis-infected, CXCL10-treated IL-10null DCs compared to the results obtained with their WT analogues (P < 0.01) as well as with IL-10null CD4+ T cells co-cultured with L. amazonensis-infected IL-10null DCs (Fig. 4A; P < 0.01). These observations suggest that in the absence of IL-10, CXCL10 can promote the priming and expansion of L. amazonensis-specific CD4+ T cells.


Figure 4
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 4. Differential effects of CXCL10 on WT and IL-10null T-cell activation. BM DCs of WT and IL-10null mice were infected with L. amazonensis (La) promastigotes for 24 h in the absence or presence of CXCL10 (200 ng/ml), treated with mitomycin C (50 mg/ml), and then co-cultured with spleen-derived, naïve CD4+ T cells (2 x 106/ml) at a 1:10 ratio of DCs to T cells. (A) After 96 h of co-culture, CD4+ T-cell proliferation was measured by a 3H-uptake assay. (B and C) Culture supernatants were collected at 4 days of stimulation for measurement of the levels of IL-10 (B) and IFN-{gamma} (C) by ELISA. (D) Proliferation of co-cultured WT and IL-10null DCs and CD4+ T cells was also measured at the indicated settings. (E) Culture supernatants were harvested at 4 days of stimulation and measured for IFN-{gamma} levels by ELISA. Representative data from one of three independent experiments with similar results are shown. * (P < 0.05), ** (P < 0.01), and *** (P < 0.001) indicate statistically significant differences between the indicated groups.

 
Since activation of CD4+ T cells is responsible for both protective immunity and disease pathogenesis, depending on the magnitude of Th1-type responses (19, 20, 23, 42), we used DC-T-cell co-culture assays to determine whether CXCL10 treatment of DCs could increase the production of Th1-biased cytokines. As expected, we found that IL-10 secretion was significantly decreased among all IL-10null groups in comparison to results seen with their WT counterparts (Fig. 4B; P < 0.05). WT CD4+ T cells co-cultured with CXCL10-treated WT DCs showed a highly significant decrease in IL-10 production compared to the untreated control results (P < 0.05), suggesting that CXCL10 treatment can also suppress IL-10 release in CD4+ T cells as well as in DCs (Fig. 2B). IFN-{gamma} secretion increased when IL-10null CD4+ T cells were co-cultured with CXCL10-treated IL-10null DCs, although not significantly. We did observe a statistical increase in IFN-{gamma} levels in groups exposed to L. amazonensis alone or to L. amazonensis plus CXCL10 (Fig. 4C; P < 0.05). Together, these results suggest that in the absence of IL-10 from both DCs and T cells, CXCL10 treatment can markedly promote priming of CD4+ T cells to become antigen-specific Th1 cells.

To further examine the source of IL-10, we utilized a cross-co-culture system in which IL-10 was eliminated from either CD4+ T cells or DCs. As shown in Fig. 4D, there was a significant increase in the proliferation of WT CD4+ T cells when IL-10 was eliminated from L. amazonensis-infected, CXCL10-treated DCs in comparison to the findings obtained with IL-10null CD4+ T cells incubated with L. amazonensis-infected, CXCL10-treated WT DCs (P < 0.05) and L. amazonensis-infected, IL-10null DCs (P < 0.05), suggesting that IL-10 inhibited DCs to properly signal CD4+ T cells to expand. In addition, we consistently observed that eliminating IL-10 from CD4+ T cells significantly impacted increased T-cell IFN-{gamma} production (Fig. 4E; P < 0.05 and P < 0.01). Collectively, these data illustrate the important role of IL-10 in modulation of both DC and T-cell functions.

CXCL10 directly stimulates CD4+ T cells to express the IL-12Rβ2 chain and produce IFN-{gamma}. Given that L. amazonensis-infected mice are deficient in Th1 cell activation (20, 22) due to an IL-4-independent down-regulation of the IL-12Rβ2 chain on CD4+ T cells (22, 23), we therefore examined whether CXCL10 treatment could overcome these deficiencies on CD4+ T cells. CD4+ T cells were isolated from the spleens of naïve mice, treated with 200 ng/ml of CXCL10 for 24 h, and subjected to RT-PCR analysis. While IL-12Rβ2 mRNA was undetectable in untreated naïve CD4+ T cells (Fig. 5A, lane 1), CXCL10 treatment resulted in a 2.5-fold increase in the expression of the IL-12Rβ2 chain (Fig. 5A, lane 3, and 5B). To determine whether CXCL10 could increase the expression of the IL-12Rβ2 chain on in vivo-primed CD4+ T cells, we isolated CD4+ T cells from DLNs of B6 mice that were infected with L. amazonensis for 6 to 8 weeks. These cells were either rested in medium for 24 h or treated with CXCL10 for 24 h in the absence of APCs and antigen prior to RNA isolation. Although primed, rested CD4+ T cells expressed low levels of IL-12Rβ2 but not of IFN-{gamma} (lane 2), CXCL10 treatment led to 3.5- and 2-fold increases in IL-12Rβ2 and IFN-{gamma} expression (Fig. 5A, lane 4, and Fig. 5B), respectively. These data suggest that CXCL10 can directly stimulate the expression of the IL-12Rβ2 chain, making CD4+ T cells more responsive to IL-12. Although CXCL10 is a downstream molecule induced by IFN-{gamma}, CXCL10 can, in turn, trigger strong IFN-{gamma} gene expression via antigen-dependent and -independent means (27). Consistent with this notion, we found that in vivo-primed, CXCL10-treated CD4+ T cells produced significant amounts of IFN-{gamma} (Fig. 5C; P < 0.05). These data suggest that CXCL10 potentially enhances T-cell responsiveness to IL-12 and can stimulate IFN-{gamma} production.


Figure 5
View larger version (18K):
[in this window]
[in a new window]

 
FIG. 5. CXCL10 directly stimulates CD4+ T cells to express the IL-12Rβ2 chain and produce IFN-{gamma}. Naïve CD4+ T cells (N) and L. amazonensis (La)-primed CD4+ T cells (P) were isolated from the spleens of naïve and DLNs of L. amazonensis-infected B6 mice (8 to 10 weeks old), respectively. CD4+ T cells were cultured in the presence or absence of CXCL10 (200 ng/ml) or concanavalin A (Con A) (2 ng/ml) for 24 h. (A) Total RNA (100 ng) was extracted for RT-PCR analyses for determination of IL-12β2, IFN-{gamma}, and β-actin data. (B) Bands of interest were analyzed via spot densitometry and normalized with their corresponding β-actin controls. Data are presented as severalfold increases in results for CXCL10-treated groups over medium control results; data shown are representative of the results of three independent experiments. (C) The levels of IFN-{gamma} in culture supernatants were assayed by ELISA. Results represent means ± standard deviations of the results from a total of three independent experiments performed in duplicate. * (P < 0.05) represents statistically significant differences between the indicated groups, and n.s. indicates groups with results whose differences were not statistically significant (P > 0.05). KO, knockout.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chronic, nonhealing L. amazonensis infection in mice has been linked to both impaired production of IL-12 and unresponsiveness of CD4+ T cells to IL-12 activation, resulting in diminished Th1 response (19, 23). It has been proposed that L. amazonensis parasites can evade host immunity by inhibiting these early responses (19), thus preventing the expansion of antigen-specific Th1 cells even in the absence of Th2 dominance (3). In this study, we investigated the effects of CXCL10 treatment on both DCs and CD4+ T cells and their potential influence upon L. amazonensis infection in mice. While much has been learned regarding the role of CXCL10 in T-cell chemotaxis (27), this report is focused mainly on the ability of CXCL10 to function in the cellular activation of both DCs and CD4+ T cells in L. amazonensis infection. Using an in vitro DC infection and T-cell priming system, we have provided evidence that CXCL10 treatment can trigger significant production of IL-12 p40 and of IL-12p70 and IL-10 in the presence of LPS (Fig. 1 and 2). In the presence of exogenous CXCL10, infection with L. amazonensis promastigotes preferentially stimulates DC to produce significantly higher levels of IL-10 in comparison to the results seen with cells treated with parasite alone (Fig. 2). The role of endogenous IL-10 in DC and T-cell activation during L. amazonensis infection and the interplay between IL-10 and CXCL10 was further investigated using DC and CD4+ T cells that were derived from IL-10null mice (Fig. 3 and 4). This report provides the first evidence that while eliminating endogenous IL-10 from DCs greatly enhances DC IL-12 production and its antigen-presenting functions, eliminating IL-10 from both DCs and CD4+ T cells allows maximal T-cell proliferation and IFN-{gamma} production during L. amazonensis infection (Fig. 4). Collectively, the data presented in this report indicate that L. amazonensis parasites have certain intrinsic features favoring the production of IL-10 over IL-12 in DCs even in the presence of exogenous, Th1-promoting CXCL10. In addition, this report suggests that the direct effect of CXCL10 on CD4+ T cells in stimulating the expression of the IL-12Rβ2 chain and IFN-{gamma} production may contribute to the protective effect of CXCL10 treatment in vivo, an idea which warrants further investigation (46).

IL-10 is known to inhibit the induction and expression of cell-mediated immunity required for the control of many intracellular pathogens, including L. major, Toxoplasma gondii, and Trypanosoma cruzi (4, 16, 17). IL-10 can be produced by many cell types, including M{Phi}s, conventional DCs, T cells, B cells, and NK cells (31). At the DC level, IL-10 can act against Th1 development by blocking IL-12 production, can interfere with DC maturation, and can modulate apoptosis (18). It has been shown that IL-10null B6 mice or WT B6 mice treated with anti-IL-10 receptor Abs achieved a sterile cure for L. major infection (5). We and others have reported that susceptibility to L. amazonensis is not solely dependent on the expression of IL-10, since these parasites persisted in IL-10null mice despite enhanced Th1 responses at early and late stages of infection (20, 22). While IL-10 production in Leishmania infection is crucial for M{Phi} suppression and disease exacerbation (10), we found that IL-10null DCs have an enhanced capacity for production of IL-12 (Fig. 3) and that that capacity was greatly amplified in L. amazonensis-infected, CXCL10-treated IL-10null DCs (Fig. 3B). These data suggest that in WT DCs, despite the beneficial effects afforded by CXCL10 treatment, exogenous CXCL10 can only partially overcome IL-10-mediated suppressive effects in L. amazonensis-infected DCs (Fig. 2). Our results are consistent with a report that described augmented inflammation by M{Phi}s with a specific deletion of the IL-10 after exposure to LPS (41). These results show the direct influence of IL-10 upon DC function throughout the duration of an immune response to intracellular pathogens.

In the present study, we also examined the importance of DC- versus T cell-derived IL-10 in the host response to L. amazonensis infection. We have shown that the magnitude of antigen-specific T-cell proliferation and T-cell cytokine production (IL-12, p40, and IFN-{gamma}) reached its highest level when endogenous IL-10 was eliminated from both DC and CD4+ T cells (Fig. 4). These observations are consistent with those of a previous report (35), suggesting that in the absence of IL-10, CXCL10 impacts T-cell expansion, which is often defective in L. amazonensis-infected mice. Interestingly, we also found that while eliminating IL-10 from DCs greatly enhanced DC IL-12 production from all three treatment groups (CXCL10, L. amazonensis infection, and CXCL10 plus infection; Fig. 3), limiting IL-10 from the T-cell source had more profound effects on T-cell IFN-{gamma} production in all three treatment groups (Fig. 4). These observations are consistent with a previous report showing that IL-10-deleted T cells secreted substantial amounts of proinflammatory cytokines after in vitro activation with Toxoplasma gondii (38). Together, the data from our in vitro studies presented herein support those from our previous studies employing foot tissues and DLNs derived from L. amazonensis-infected mice (20), indicating that during natural L. amazonensis infection in an immunocompetent host, endogenous IL-10 from both DCs and T cells contributes to impaired cell-mediated immune responses to this parasite. Since IL-10null mice remain susceptible to L. amazonensis infection and develop a persistent infection (19, 22), it is possible that IL-10 is not the sole factor and that other suppressive, regulatory cytokines such as transforming growth factor β (2) or other undefined mechanisms may also contribute to host susceptibility to this parasite.

CXCL10 is a CXC chemokine known to favor the recruitment and activation of Th1-polarized cells (39). IFN-{gamma}-producing Th1 cells most commonly express CXCR3 and CCR5, while IL-4/IL-5-producing Th2 cells are more often characterized by expression of CCR4 (7). CXCR3 ligands (CXCL9/Mig, CXCL10, and CXCL11/iTAC) are secreted by multiple cell types, including endothelium cells, epithelium cells, fibroblasts, keratinocytes, neutrophils, monocytes, and DCs, and are chemotactic for leukocytes, especially activated T cells (15). Currently, there are several reports on the effect of CXCL10 in the control of infections caused by intracellular pathogens, and those concerning Leishmania infections have reached contradictory conclusions. For example, early and strong induction of the CXCL10 gene strongly correlated with the healing phenotype in L. major-resistant B6 mice (32, 43); however, a single injection of CXCL10 into L. major-susceptible BALB/c mice resulted in enhanced lesion development (47). Furthermore, L. major-infected CXCR3–/– mice were capable of mounting an efficient Th1 response, since increases in Th1-associated IgG2a and significant IFN-{gamma} and IL-12 production by DLN cells restricted the systemic spread of infection and yet failed to control parasite replication at the site of infection, resulting in the development of chronic, nonhealing lesions (39). Indeed, L. major has been reported to release an inhibitory factor which interferes with neutrophil release of CXCL10 in an effort to prevent NK cell activation (45). Therefore, most reports suggest a beneficial role of CXCL10 in cutaneous leishmaniasis caused by L. major infection (39, 43, 47) and visceral leishmaniasis caused by L. donovani (14).

Nonhealing, cutaneous leishmaniasis caused by L. amazonensis infection in mice is marked by IL-4-independent down-regulation of the IL-12Rβ2 chain on CD4+ T cells and lack of responsiveness to IL-12 treatment (20, 23), which is possibly due in L. amazonensis-infected hosts to suppressed levels of nitric oxide, a well-known IL-12Rβ2 chain inducer (34). We found that CXCL10, when given to purified naïve or L. amazonensis-primed CD4+ T cells, markedly enhanced mRNA transcripts of the IL-12Rβ2 chain (Fig. 5). It has been postulated that CXCL10 may be relevant in human immune responses not only for its role in the chemotaxis of T cells to inflammatory sites but also for regulating the expression of cytokine synthesis patterns. Furthermore, CXCL10 binding to its receptor was found to act as a costimulus with antigen, resulting in substantially enhanced IFN-{gamma} production, which inhibited T-cell proliferation (11). In the present study, we also observed a significant increase in IFN-{gamma} production in L. amazonensis-primed, CXCL10-treated CD4+ T cells (Fig. 5C). While it is tempting to speculate that CXCL10-mediated up-regulation of the IL-12Rβ2 increases CD4+ T-cell responsiveness to IL-12 signaling, currently, the validity of that speculation remains undetermined, and, accordingly, studies in this area are ongoing.

In summary, we report here that CXCL10 treatment could directly increase IL-12 p40 production as well as APC function in DCs. L. amazonensis-infected DCs also secreted significant amounts of IL-10, which limited the efficacy of CXCL10-induced IL-12 p40 production. The elimination of IL-10 led to the enhanced production of IL-12 in DCs and CD4+ T-cell proliferation and IFN-{gamma} production in groups treated with CXCL10. In addition, the presence of exogenous CXCL10 led to increased expression of the IL-12Rβ2 chain on CD4+ T cells, resulting in potentially enhanced IL-12 responsiveness and subsequent IFN-{gamma} production.


    ACKNOWLEDGMENTS
 
We thank John T. Sullivan, Jiaren Sun, Nanchaya Wanasen, and Diego Vargas for their insightful comments as well as Mardelle Susman for assisting in manuscript preparation.

This study was supported by National Institutes of Health grant AI043003 to L.S. and a James W. McLaughlin Predoctoral Fellowship to R.E.V.

The authors have no financial conflict of interest.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, University of Texas Medical Branch, Medical Research Building 3.132, 301 University Blvd., Galveston, TX 77555-1070. Phone: (409) 772-8149. Fax: (409) 747-6869. E-mail: lysoong{at}utmb.edu Back

{triangledown} Published ahead of print on 12 November 2007. Back

Editor: J. F. Urban, Jr.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Afonso, L. C., and P. Scott. 1993. Immune responses associated with susceptibility of C57BL/10 mice to Leishmania amazonensis. Infect. Immun. 61:2952-2959.[Abstract/Free Full Text]
2. Balestieri, F. M., A. R. Queiroz, C. Scavone, V. M. Costa, M. Barral-Netto, and A. Abrahamsohn Ide. 2002. Leishmania (L.) amazonensis-induced inhibition of nitric oxide synthesis in host macrophages. Microb. Infect. 4:23-29.[CrossRef][Medline]
3. Banchereau, J., F. Briere, C. Caux, J. Davoust, S. Lebecque, Y. J. Liu, B. Pulendran, and K. Palucka. 2000. Immunobiology of dendritic cells. Annu. Rev. Immunol. 18:767-811.[CrossRef][Medline]
4. Belkaid, Y., K. F. Hoffmann, S. Mendez, S. Kamhawi, M. C. Udey, T. A. Wynn, and D. L. Sacks. 2001. The role of interleukin (IL)-10 in the persistence of Leishmania major in the skin after healing and the therapeutic potential of anti-IL-10 receptor antibody for sterile cure. J. Exp. Med. 194:1497-1506.[Abstract/Free Full Text]
5. Belkaid, Y., C. A. Piccirillo, S. Mendez, E. M. Shevach, and D. L. Sacks. 2002. CD4+CD25+ regulatory T cells control Leishmania major persistence and immunity. Nature 420:502-507.[CrossRef][Medline]
6. Bhattacharyya, S., S. Ghosh, B. Dasgupta, D. Mazumder, S. Roy, and S. Majumdar. 2002. Chemokine-induced leishmanicidal activity in murine macrophages via the generation of nitric oxide. J. Infect. Dis. 185:1704-1708.[CrossRef][Medline]
7. Bonecchi, R., G. Bianchi, P. P. Bordignon, D. D'Ambrosio, R. Lang, A. Borsatti, S. Sozzani, P. Allavena, P. A. Gray, A. Mantovani, and F. Sinigaglia. 1998. Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J. Exp. Med. 187:129-134.[Abstract/Free Full Text]
8. Brandonisio, O., M. A. Panaro, I. Fumarola, M. Sisto, D. Leogrande, A. Acquafredda, R. Spinelli, and V. Mitolo. 2002. Macrophage chemotactic protein-1 and macrophage inflammatory protein-1{alpha} induce nitric oxide release and enhance parasite killing in Leishmania infantum-infected human macrophages. Clin. Exp. Med. 2:125-129.[CrossRef][Medline]
9. Brandonisio, O., R. Spinelli, and M. Pepe. 2004. Dendritic cells in Leishmania infection. Microb. Infect. 6:1402-1409.[CrossRef][Medline]
10. Buxbaum, L. U., and P. Scott. 2005. Interleukin 10- and Fc{gamma} receptor-deficient mice resolve Leishmania mexicana lesions. Infect. Immun. 73:2101-2108.[Abstract/Free Full Text]
11. Campbell, J. D., V. Gangur, F. E. Simons, and K. T. HayGlass. 2004. Allergic humans are hyporesponsive to a CXCR3 ligand-mediated Th1 immunity-promoting loop. FASEB J. 18:329-331.[Abstract/Free Full Text]
12. Campbell, K., H. Diao, J. Ji, and L. Soong. 2003. DNA immunization with the gene encoding P4 nuclease of Leishmania amazonensis protects mice against cutaneous leishmaniasis. Infect. Immun. 71:6270-6278.[Abstract/Free Full Text]
13. Colmenares, M., A. L. Corbi, S. J. Turco, and L. Rivas. 2004. The dendritic cell receptor DC-SIGN discriminates among species and life cycle forms of Leishmania. J. Immunol. 172:1186-1190.[Abstract/Free Full Text]
14. Cotterell, S. E., C. R. Engwerda, and P. M. Kaye. 1999. Leishmania donovani infection initiates T cell-independent chemokine responses, which are subsequently amplified in a T cell-dependent manner. Eur. J. Immunol. 29:203-214.[CrossRef][Medline]
15. Farber, J. M. 1997. Mig and IP-10: CXC chemokines that target lymphocytes. J. Leukoc. Biol. 61:246-257.[Abstract]
16. Gasim, S., A. M. Elhassan, E. A. Khalil, A. Ismail, A. M. Kadaru, A. Kharazmi, and T. G. Theander. 1998. High levels of plasma IL-10 and expression of IL-10 by keratinocytes during visceral leishmaniasis predict subsequent development of post-kala-azar dermal leishmaniasis. Clin. Exp. Immunol. 111:64-69.[CrossRef][Medline]
17. Ghalib, H. W., M. R. Piuvezam, Y. A. Skeiky, M. Siddig, F. A. Hashim, A. M. el-Hassan, D. M. Russo, and S. G. Reed. 1993. Interleukin 10 production correlates with pathology in human Leishmania donovani infections. J. Clin. Investig. 92:324-329.[Medline]
18. Haase, C., T. N. Jorgensen, and B. K. Michelsen. 2002. Both exogenous and endogenous interleukin-10 affects the maturation of bone-marrow-derived dendritic cells in vitro and strongly influences T-cell priming in vivo. Immunology 107:489-499.[CrossRef][Medline]
19. Ji, J., J. Sun, H. Qi, and L. Soong. 2002. Analysis of T helper cell responses during infection with Leishmania amazonensis. Am. J. Trop. Med. Hyg. 66:338-345.[Abstract]
20. Ji, J., J. Sun, and L. Soong. 2003. Impaired expression of inflammatory cytokines and chemokines at early stages of infection with Leishmania amazonensis. Infect. Immun. 71:4278-4288.[Abstract/Free Full Text]
21. Jones, D., M. M. Elloso, L. Showe, D. Williams, G. Trinchieri, and P. Scott. 1998. Differential regulation of the interleukin-12 receptor during the innate immune response to Leishmania major. Infect. Immun. 66:3818-3824.[Abstract/Free Full Text]
22. Jones, D. E., M. R. Ackermann, U. Wille, C. A. Hunter, and P. Scott. 2002. Early enhanced Th1 response after Leishmania amazonensis infection of C57BL/6 interleukin-10-deficient mice does not lead to resolution of infection. Infect. Immun. 70:2151-2158.[Abstract/Free Full Text]
23. Jones, D. E., L. U. Buxbaum, and P. Scott. 2000. IL-4-independent inhibition of IL-12 responsiveness during Leishmania amazonensis infection. J. Immunol. 165:364-372.[Abstract/Free Full Text]
24. Kalter, D. C., H. E. Gendelman, and M. S. Meltzer. 1991. Monocytes, dendritic cells, and Langerhans cells in human immunodeficiency virus infection. Dermatol. Clin. 9:415-428.[CrossRef][Medline]
25. Kane, M. M., and D. M. Mosser. 2001. The role of IL-10 in promoting disease progression in leishmaniasis. J. Immunol. 166:1141-1147.[Abstract/Free Full Text]
26. Kima, P. E., S. L. Constant, L. Hannum, M. Colmenares, K. S. Lee, A. M. Haberman, M. J. Shlomchik, and D. McMahon-Pratt. 2000. Internalization of Leishmania mexicana complex amastigotes via the Fc receptor is required to sustain infection in murine cutaneous leishmaniasis. J. Exp. Med. 191:1063-1068.[Abstract/Free Full Text]
27. Liu, Y. Q., R. T. Poon, J. Hughes, Q. Y. Li, W. C. Yu, and S. T. Fan. 2005. Desensitization of T lymphocyte function by CXCR3 ligands in human hepatocellular carcinoma. World J. Gastroenterol. 11:164-170.[Medline]
28. Maloy, K. J., and F. Powrie. 2001. Regulatory T cells in the control of immune pathology. Nat. Immunol. 2:816-822.[CrossRef][Medline]
29. McMahon-Pratt, D., and J. Alexander. 2004. Does the Leishmania major paradigm of pathogenesis and protection hold for New World cutaneous leishmaniases or the visceral disease? Immunol. Rev. 201:206-224.[CrossRef][Medline]
30. Mohan, K., E. Cordeiro, M. Vaci, C. McMaster, and T. B. Issekutz. 2005. CXCR3 is required for migration to dermal inflammation by normal and in vivo activated T cells: differential requirements by CD4 and CD8 memory subsets. Eur. J. Immunol. 35:1702-1711.[CrossRef][Medline]
31. Moore, K. W., R. de Waal Malefyt, R. L. Coffman, and A. O'Garra. 2001. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 19:683-765.[CrossRef][Medline]
32. Muller, K., G. van Zandbergen, B. Hansen, H. Laufs, N. Jahnke, W. Solbach, and T. Laskay. 2001. Chemokines, natural killer cells and granulocytes in the early course of Leishmania major infection in mice. Med. Microbiol. Immunol. (Berlin) 190:73-76. (In German.)[Medline]
33. Nakajima, C., T. Mukai, N. Yamaguchi, Y. Morimoto, W. R. Park, M. Iwasaki, P. Gao, S. Ono, H. Fujiwara, and T. Hamaoka. 2002. Induction of the chemokine receptor CXCR3 on TCR-stimulated T cells: dependence on the release from persistent TCR-triggering and requirement for IFN-{gamma} stimulation. Eur. J. Immunol. 32:1792-1801.[CrossRef][Medline]
34. Niedbala, W., X. Q. Wei, C. Campbell, D. Thomson, M. Komai-Koma, and F. Y. Liew. 2002. Nitric oxide preferentially induces type 1 T cell differentiation by selectively up-regulating IL-12 receptor beta 2 expression via cGMP. Proc. Natl. Acad. Sci. USA 99:16186-16191.[Abstract/Free Full Text]
35. Pompeu, M., A. L. Freitas, G. A. dosReis, and M. Barral-Netto. 1992. T-lymphocytes in experimental Leishmania amazonensis infection: comparison between immunized and naive BALB/c mice. Parasitol. Res. 78:16-22.[CrossRef][Medline]
36. Qi, H., J. Ji, N. Wanasen, and L. Soong. 2004. Enhanced replication of Leishmania amazonensis amastigotes in gamma interferon-stimulated murine macrophages: implications for the pathogenesis of cutaneous leishmaniasis. Infect. Immun. 72:988-995.[Abstract/Free Full Text]
37. Qi, H., V. Popov, and L. Soong. 2001. Leishmania amazonensis-dendritic cell interactions in vitro and the priming of parasite-specific CD4+ T cells in vivo. J. Immunol. 167:4534-4542.[Abstract/Free Full Text]
38. Roers, A., L. Siewe, E. Strittmatter, M. Deckert, D. Schluter, W. Stenzel, A. D. Gruber, T. Krieg, K. Rajewsky, and W. Muller. 2004. T cell-specific inactivation of the interleukin 10 gene in mice results in enhanced T cell responses but normal innate responses to lipopolysaccharide or skin irritation. J. Exp. Med. 200:1289-1297.[Abstract/Free Full Text]
39. Rosas, L. E., J. Barbi, B. Lu, Y. Fujiwara, C. Gerard, V. M. Sanders, and A. R. Satoskar. 2005. CXCR3–/– mice mount an efficient Th1 response but fail to control Leishmania major infection. Eur. J. Immunol. 35:515-523.[CrossRef][Medline]
40. Sacks, D., and N. Noben-Trauth. 2002. The immunology of susceptibility and resistance to Leishmania major in mice. Nat. Rev. Immunol. 2:845-858.[CrossRef][Medline]
41. Siewe, L., M. Bollati-Fogolin, C. Wickenhauser, T. Krieg, W. Muller, and A. Roers. 2006. Interleukin-10 derived from macrophages and/or neutrophils regulates the inflammatory response to LPS but not the response to CpG DNA. Eur. J. Immunol. 36:3248-3255.[CrossRef][Medline]
42. Soong, L., C. H. Chang, J. Sun, B. J. Longley, Jr., N. H. Ruddle, R. A. Flavell, and D. McMahon-Pratt. 1997. Role of CD4+ T cells in pathogenesis associated with Leishmania amazonensis infection. J. Immunol. 158:5374-5383.[Abstract]
43. Steigerwald, M., and H. Moll. 2005. Leishmania major modulates chemokine and chemokine receptor expression by dendritic cells and affects their migratory capacity. Infect. Immun. 73:2564-2567.[Abstract/Free Full Text]
44. Vanloubbeeck, Y. F., A. E. Ramer, F. Jie, and D. E. Jones. 2004. CD4+ Th1 cells induced by dendritic cell-based immunotherapy in mice chronically infected with Leishmania amazonensis do not promote healing. Infect. Immun. 72:4455-4463.[Abstract/Free Full Text]
45. van Zandbergen, G., N. Hermann, H. Laufs, W. Solbach, and T. Laskay. 2002. Leishmania promastigotes release a granulocyte chemotactic factor and induce interleukin-8 release but inhibit gamma interferon-inducible protein 10 production by neutrophil granulocytes. Infect. Immun. 70:4177-4184.[Abstract/Free Full Text]
46. Vasquez, R. E., and L. Soong. 2006. CXCL10/gamma interferon-inducible protein 10-mediated protection against Leishmania amazonensis infection in mice. Infect. Immun. 74:6769-6777.[Abstract/Free Full Text]
47. Vester, B., K. Muller, W. Solbach, and T. Laskay. 1999. Early gene expression of NK cell-activating chemokines in mice resistant to Leishmania major. Infect. Immun. 67:3155-3159.[Abstract/Free Full Text]
48. Von Stebut, E., J. M. Ehrchen, Y. Belkaid, S. L. Kostka, K. Molle, J. Knop, C. Sunderkotter, and M. C. Udey. 2003. Interleukin-1{alpha} promotes Th1 differentiation and inhibits disease progression in Leishmania major-susceptible BALB/c mice. J. Exp. Med. 198:191-199.[Abstract/Free Full Text]
49. Wakkach, A., N. Fournier, V. Brun, J. P. Breittmayer, F. Cottrez, and H. Groux. 2003. Characterization of dendritic cells that induce tolerance and T regulatory 1 cell differentiation in vivo. Immunity 18:605-617.[CrossRef][Medline]
50. Xin, L., Y. Li, and L. Soong. 2007. Role of interleukin-1β in activating the CD11chigh CD45RB dendritic cell subset and priming Leishmania amazonensis-specific CD4+ T cells in vitro and in vivo. Infect. Immun. 75:5018-5026.[Abstract/Free Full Text]


Infection and Immunity, January 2008, p. 161-169, Vol. 76, No. 1
0019-9567/08/$08.00+0     doi:10.1128/IAI.00825-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
IAI.00825-07v1
76/1/161    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vasquez, R. E.
Right arrow Articles by Soong, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vasquez, R. E.
Right arrow Articles by Soong, L.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals