Previous Article | Next Article ![]()
Infection and Immunity, November 2008, p. 5093-5099, Vol. 76, No. 11
0019-9567/08/$08.00+0 doi:10.1128/IAI.00724-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Institute of Medical Microbiology, University of Zürich, Zürich, Switzerland,1 Institute of Medical Microbiology and Hygiene, University of Saarland Hospital, Homburg/Saar, Germany2
Received 9 June 2008/ Returned for modification 9 July 2008/ Accepted 6 August 2008
|
|
|---|
ccpA mutant. Stabilizing the pH ruled out a pH effect due to acid production during glucose catabolism. CcpA thus directly regulates tst transcription, linking carbohydrate utilization to virulence gene expression in S. aureus. |
|
|---|
The regulation of TSST-1 is known to be complex, and several environmental conditions, including salt, oxygen, carbon dioxide, growth rate, temperature, glucose, and pH, were reported to modulate its production (3, 29, 31, 46). Global regulators shown to be involved in the regulation of TSST-1 are SarA (4, 6, 23), RNAIII of the agr system (3, 28), and SrrAB (45) (Fig. 1). However, there is some contradiction about the role of SarA in tst expression, since Chan and Foster (4) described that repression of tst by SarA was agr independent, while Novick (23) found that tst repression was dependent on agr. SrrAB, which is also a repressor of RNAIII (27), was previously shown to repress tst transcription under limited oxygen pressure (45). More recently, Pragman et al. (26) proposed that SrrAB, in addition to its downregulatory function under low-oxygen conditions, enhances the level of tst under aerobic conditions. More complexity is added by the fact that tst has autoregulatory functions, with TSST-1 acting as a repressor of tst transcription (41) (Fig. 1).
![]() View larger version (12K): [in a new window] |
FIG. 1. Regulation of tst transcription. Arrows represent upregulation, bars represent downregulation, dashed arrows indicate controversial findings, and numbers in parentheses indicate references. The question mark corresponds to CcpA.
|
Since TSST-1 production was shown to be repressed by glucose (31) and since our in silico analysis of the sequenced S. aureus genomes identified putative cre sites in the tst promoter regions, we investigated whether CcpA was the mediator of this regulatory phenomenon. We therefore analyzed the effects of glucose on tst transcription and TSST-1 production and compared them to the effects in a ccpA null mutant. Our results indicate that repression of tst by glucose is mediated directly by the carbon catabolite protein CcpA.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Bacterial strains and plasmids
|
ccpA mutant (MST14). The plasmid was also introduced into strain Newman
agr (KS186), which was obtained by transduction of agr::tet(M) from strain RN6911.
Construction of plasmids tstN315-pAW17 (pSKA20) and tstRF122-pAW17 (pSKA21).
One-kilobase fragments containing tst and its promoter region were amplified by PCR from chromosomal DNAs of S. aureus N315 and RF122, using primers TstXbaI+ (GTTGTCTAGAACTCACACTTTGTTTTTTGC), including an XbaI linker (underlined), and TstPstI– (GTTGCTGCAGGTTTACTAATTCACCCTAGC), including a PstI linker (underlined). The PCR products were cloned into pAW17, generating pSKA20 and pSKA21, respectively. The identities of the constructs were confirmed by sequence analysis and comparison to the respective sequences in the NCBI database (for N315, accession no. NC_002745; and for RF122, accession no. NC_007622). The plasmids were electroporated into RN4220 and subsequently transduced into strain Newman, its respective
ccpA mutant (MST14), strain Newman
agr (KS186), and strain RN450.
Luciferase assays. For glucose impulse experiments, the cultures were inoculated at an optical density at 600 nm (OD600) of 0.05 and were grown for 5 h without glucose. At this time point, corresponding to the early stationary growth phase, the cultures were split and different amounts of glucose were added. Samples were taken 0, 30, and 60 min after the glucose impulse. To follow the tst promoter-luciferase reporter activity over time, the medium was inoculated with an overnight culture to an OD600 of 0.05 and the bacteria were grown for 8 h. The medium contained either 10 mM glucose or no glucose. Sampling was performed on an hourly basis, starting 2 h after inoculation. Luciferase activity was measured as described earlier, using a luciferase assay substrate and a Turner Designs TD-20/20 luminometer (Promega) (1). All luciferase assays were performed at least three times in independent experiments.
Northern blots. Sampling for Northern blot analysis was performed basically as described for the glucose impulse experiments in the luciferase assays. Ten millimolar glucose was added to one-half of the culture, while the other half remained without glucose. Samples were centrifuged for 2 min at 12,000 x g, and cell sediments were snap-frozen in liquid nitrogen. RNA isolation and Northern blotting were performed as described earlier (18). Primers DIGtst+ (TAAGCCTTTGTTGCTTGCG) and DIGtst– (CACTTTGATATGTGGATCCG) were used to generate DIG-labeled tst probes. All Northern blot analyses were performed at least twice with independently isolated RNA samples.
Exoprotein analysis and Western blots. For the determination of TSST-1 levels in the supernatants, cells were grown for 3 or 5 h either with or without 10 mM glucose. Supernatants were adjusted to the same volume for all samples, using sterile medium. Identical amounts of bovine serum albumin were added to samples as an internal control for semiquantitative detection of TSST-1. Proteins were precipitated with trichloroacetic acid at a final concentration of 10%, samples were placed on ice for 30 min and centrifuged for 15 min at 16,000 x g, and sediments were washed twice with 5 ml acetone. After being air dried, sediments were resuspended in loading buffer and samples corresponding to a final OD600 of 0.25 (1.25 for strain N315) were analyzed by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Gels were either stained with Coomassie brilliant blue or blotted on nitrocellulose membranes. TSST-1 detection was performed using rabbit polyclonal anti-TSST-1 antibodies (LucernaChem, Switzerland) after blocking with human immunoglobulin G and visualized using SuperSignal West Pico chemiluminescent substrate (Pierce, Rockford, IL).
For the determination of exoprotein patterns, cells were sampled at an OD600 of 3.5 (
5 h). Proteins were precipitated as described above, and samples corresponding to a final OD600 of 1.0 were analyzed by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and stained with Coomassie brilliant blue or blotted for TSST-1 detection as described above.
Determination of glucose levels. Two-milliliter aliquots of bacterial cultures were harvested at the indicated time points and centrifuged for 2 min at 16,000 x g. The supernatants were incubated at 80°C for 15 min and stored at –20°C until use. Glucose levels were determined with kits from R-Biopharm (Darmstadt, Germany) according to the manufacturer's directions.
|
|
|---|
![]() View larger version (20K): [in a new window] |
FIG. 2. Alignment of the cloned tst promoter regions of strains N315 (GenBank accession no. NC_002745; nucleotides 2,060,871 to 2,061,078) and RF122 (GenBank accession no. NC_007622; nucleotides 400,656 to 400,452) used for the construction of pSKA20 and pSKA21. The ribosome binding site (rbs) suggested by Blomster-Hautamaa et al. (2) is shown. Nucleotides fitting with the cre consensus of B. subtilis suggested by Miwa et al. (21) are highlighted in bold. Inverted repeats are indicated by arrows. Differences in nucleotides are highlighted by gray boxes.
|
![]() View larger version (31K): [in a new window] |
FIG. 3. Influence of glucose on tst expression. (A) Northern blot analysis of tst expression in response to glucose in strain RF122 after the addition of 10 mM glucose to a culture in the early stationary growth phase. Ethidium bromide-stained 23S rRNA indicates RNA loading. (B) Luciferase activity of strain KS87 in response to different glucose concentrations. The luciferase activity at time zero was set to 100% (dashed line), and relative activity after 60 min was assessed. The averages of three independent measurements are shown. Error bars indicate the standard deviations of the mean activities. **, P < 0.01 for supplemented versus unsupplemented cultures. (C) tst transcription in response to glucose in strains Newman (wt) and MST14 ( ccpA) carrying pSKA20 (tstN315) or pSKA21 (tstRF122) after the addition of 10 mM glucose to a culture in the early stationary growth phase. Ethidium bromide-stained 23S rRNA indicates RNA loading. The exposure time of tstN315 had to be adjusted in comparison to that of tstRF122.
|
Glucose-dependent repression of tst transcription requires CcpA.
To assess the impact of CcpA on the glucose-dependent repression of tst transcription, we transduced the tstpN315::luc+-pCN34 construct into the
ccpA mutant of strain Newman and followed the glucose effect over time in the wild-type and mutant strains. In the wild type, repression of luciferase activity was already clearly detectable 30 min after glucose addition, and activity decreased further until 1 h after glucose addition (Fig. 4). The pH remained stable throughout the time course followed, ruling out a possible pH effect on tst expression (31). In the mutant, no changes in activity were observed upon glucose addition, strongly suggesting that CcpA was involved in glucose-mediated tst repression (Fig. 4).
![]() View larger version (15K): [in a new window] |
FIG. 4. Relative luciferase activities of strains KS87 (wt), KS64 ( ccpA), and KS187 ( agr). Glucose (10 mM) was added to one-half of a culture in the early stationary growth phase (black bars), while the other half remained without glucose (white bars). Activity at time zero was set to 100% (dashed line), and relative activities after 30 and 60 min were assessed. The averages of three independent measurements are shown. Error bars indicate the standard deviations of the mean activities. **, P < 0.01 for supplemented versus unsupplemented cultures.
|
ccpA mutant strains were grown for 8 h in either the presence or absence of glucose, and luciferase activity was followed at 1-h intervals. Without glucose, activity in the wild type started to rise after 3 h, reached its maximum after 5 h, and remained stable from then on (Fig. 5A). In the presence of glucose, activity remained very low (about 1% of the activity without glucose) and started to rise only slowly after 5 h, when glucose was depleted from the medium, reaching a similar value to that for cells grown without glucose after 8 h (Fig. 5A and B). Despite HEPES buffering, in the presence of glucose, the pH dropped slightly after 5 h (Fig. 5B). For the mutant, luciferase activities were similar in the presence and absence of glucose, and the pH remained stable under both conditions for up to 7 h (Fig. 5A and B). Compared with that of the wild type, luciferase activity in the mutant rose faster and tended to be higher.
![]() View larger version (20K): [in a new window] |
FIG. 5. tst promoter activity and growth characteristics of KS87 (wt) and KS64 ( ccpA) in the presence (squares) and absence (triangles) of glucose. (A) Luciferase activity and glucose consumption. rlu, relative light units. (B) Growth and pH. Data are representative of three independent measurements.
|
ccpA mutation into strain N315, strain RF122, or other clinical TSST-1-expressing isolates from our strain collection. We therefore introduced the tst genes of strains N315 and RF122 (tstN315 and tstRF122, respectively) in trans into strain Newman and its
ccpA mutant. The plasmid-borne tst transcripts were the same size (1 kb) as the chromosomal tst transcripts of strains N315 and RF122 (data not shown). Even though the higher copy number of the plasmid-carried tstN315 and tstRF122 genes may blur a CcpA effect in strains KS181 and KS179, tst transcription in the respective Newman
ccpA mutants KS182 and KS180 was lower than that in the wild type, indicating that CcpA might exert some regulatory function on tst expression even in the absence of glucose (Fig. 3C). The overall apparently stronger tstN315 transcription, although it was cloned into the same plasmid backbone as tstRF122 and expressed in the same Newman background, may be due to small sequence differences in the operator region (Fig. 2) or possibly also within the coding or terminator region (not shown).
In performing glucose impulse experiments with the strains carrying the tst-expressing plasmids, we found strong repression of tst transcription by glucose in strain Newman, independent of whether it carried the N315 or RF122 tst variant. However, no such effect was observed in the
ccpA mutant (Fig. 3C). The finding that both tst genes were repressed by glucose in a CcpA-dependent manner suggests that the minor difference in their cre sites did not affect CcpA activity.
tst does not affect exoprotein patterns in LB medium. To assess TSST-1 production and the impact of TSST-1 on the exoprotein patterns of the different strains, we analyzed supernatants of post-exponential-growth-phase cultures. Consistent with its low tst transcription, strain N315 produced significantly smaller amounts of TSST-1 than those in RF122 or Newman carrying the tst plasmids after 5 h of growth (data not shown). The production of larger TSST-1 amounts in KS179 (Newman tstN315) than in KS181 (Newman tstRF122) (Fig. 6A) was in line with the stronger tstN315 transcription in this strain.
![]() View larger version (74K): [in a new window] |
FIG. 6. Influence of TSST-1 production on exoprotein patterns and influence of ccpA deletion on TSST-1 production in response to glucose. (A) Exoprotein patterns and TSST-1 production of strains Newman, KS179 (Newman tstN315), KS181 (Newman tstRF122), RN450, KS197 (RN450/pSKA20 tstN315), and KS198 (RN450/pSKA21tstRF122) at an OD600 of 3.5. The arrow indicates the position of TSST-1. (B) Comparison of TSST-1 production in response to glucose in strains KS179 (Newman tstN315), KS180 (Newman ccpA tstN315), and RF122 after 3 h of growth.
|
Glucose affects TSST-1 production in a CcpA-dependent manner.
To confirm that the observed glucose-mediated repression of tst transcription also affected TSST-1 production, we determined the TSST-1 contents in the supernatants of KS179 (Newman tstN315) and KS180 (Newman
ccpA tstN315) cell cultures after 3 h of growth in the presence and absence of 10 mM glucose. In the presence of glucose, KS179 reached a higher OD600 than that in the absence of glucose, while no such difference in OD600 was found for strain KS180. In line with the transcriptional data, we found a clear decrease in TSST-1 in the supernatant of strain KS179 grown in the presence of glucose, while the TSST-1 levels in the supernatants of the
ccpA mutant KS180 were almost identical in the presence and absence of glucose (Fig. 6B). Glucose also led to a higher OD600 in strain RF122 and repressed TSST-1 production (Fig. 6B).
Repression of tst expression by CcpA in an agr-null mutant.
Strain N315 was previously reported to have defective RNAIII production (36). Since RNAIII is a known inducer of tst transcription (3, 28), this may explain the low tst transcription levels in N315. We confirmed that agr inactivation in strain Newman strongly reduced tstN315 and tstRF122 transcription (data not shown). The low level of tst transcription observed in N315, which harbors a functional CcpA system, might therefore be due, at least in part, to the lack of RNAIII. Nevertheless, by luciferase assays, we observed glucose-mediated repression of tst promoter-reporter gene activity in the
agr mutant of strain Newman (Fig. 4), indicating that the glucose-mediated repression by CcpA remained functional in the
agr mutant. This suggests that expression of tst depends on dual, direct RNAIII stimulation and glucose-mediated CcpA repression and on indirect CcpA-mediated control of RNAIII levels. However, we cannot rule out that additional factors may influence tst transcription, as N315 differs in terms of metabolism from strain Newman by being unable to catabolize acetate in the post-exponential growth phase (36). This loss of secondary metabolite catabolism might have consequences on tst expression. Also, regulatory circuits which may be present in strain N315 but not in the other strains could be the reason for the low tst expression in N315.
Conclusion. The expression of S. aureus virulence genes is regulated by complex networks in which global regulators such as the agr system and the sarA family play a central role. We recently showed that CcpA is also involved in the regulation of major virulence determinants by influencing the expression of hla, spa, and RNAIII (35). By demonstrating that the expression of tst is affected by CcpA as well, we add another important virulence factor to the group of CcpA-regulated genes/operons. The significance of glucose-mediated TSST-1 expression in vivo is unknown and remains to be evaluated using appropriate S. aureus constructs in wild-type and diabetic animal pathogenesis models, with the latter elaborating elevated blood glucose levels.
Published ahead of print on 18 August 2008. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»