This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, J.
Right arrow Articles by Gao, L.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, J.
Right arrow Articles by Gao, L.-Y.

 Previous Article  |  Next Article 

Infection and Immunity, December 2008, p. 5478-5487, Vol. 76, No. 12
0019-9567/08/$08.00+0     doi:10.1128/IAI.00614-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Evidence for Pore Formation in Host Cell Membranes by ESX-1-Secreted ESAT-6 and Its Role in Mycobacterium marinum Escape from the Vacuole{triangledown}

Jennifer Smith,1,{dagger} Joanna Manoranjan,1,{dagger} Miao Pan,2 Amro Bohsali,1 Junjie Xu,1 Jun Liu,3 Kent L. McDonald,4 Agnieszka Szyk,5 Nicole LaRonde-LeBlanc,5 and Lian-Yong Gao1,2*

Department of Cell Biology and Molecular Genetics and Maryland Pathogens Research Institute, University of Maryland, College Park, Maryland 20742,1 Molecular and Cell Biology Graduate Program, University of Maryland, College Park, Maryland 20742,2 Department of Molecular Genetics, University of Toronto, Toronto, Ontario M5S 1A8, Canada,3 Electron Microscope Laboratory, University of California Berkeley, Berkeley, California 94720,4 Department of Chemistry and Biochemistry, University of Maryland, College Park, Maryland 207425

Received 20 May 2008/ Returned for modification 22 June 2008/ Accepted 14 September 2008


arrow
ABSTRACT
 
The ESX-1 secretion system plays a critical role in the virulence of M. tuberculosis and M. marinum, but the precise molecular and cellular mechanisms are not clearly defined. Virulent M. marinum is able to escape from the Mycobacterium-containing vacuole (MCV) into the host cell cytosol, polymerize actin, and spread from cell to cell. In this study, we have examined nine M. marinum ESX-1 mutants and the wild type by using fluorescence and electron microscopy detecting MCV membranes and actin polymerization. We conclude that ESX-1 plays an essential role in M. marinum escape from the MCV. We also show that the ESX-1 mutants acquire the ability to polymerize actin after being artificially delivered into the macrophage cytosol by hypotonic shock treatment, indicating that ESX-1 is not directly involved in initiation of actin polymerization. We provide evidence that M. marinum induces membrane pores ~4.5 nm in diameter, and this activity correlates with ESAT-6 secretion. Importantly, purified ESAT-6, but not the other ESX-1-secreted proteins, is able to cause dose-dependent pore formation in host cell membranes. These results suggest that ESAT-6 secreted by M. marinum ESX-1 could play a direct role in producing pores in MCV membranes, facilitating M. marinum escape from the vacuole and cell-to-cell spread. Our study provides new insight into the mechanism by which ESX-1 secretion and ESAT-6 enhance the virulence of mycobacterial infection.


arrow
INTRODUCTION
 
Mycobacterium tuberculosis infects one-third of the world's population and kills 2 to 3 million people each year (13). The molecular and cellular mechanisms governing the pathogenesis of M. tuberculosis are beginning to be elucidated but are not fully understood. Mycobacterium marinum is a close relative of M. tuberculosis. M. marinum causes a tuberculosis-like disease in fish with symptoms similar to those of human tuberculosis and has been used as a surrogate model for studying the pathogenesis of M. tuberculosis (7, 17, 20, 46, 47).

Previous studies have identified and partially characterized a specialized protein secretion system, ESX-1, in M. tuberculosis (14, 23, 24, 33, 44) and M. marinum (17, 50). This secretion system has recently been named the type VII secretion system (1). ESX-1 is encoded by genes of RD1 (region of difference 1) (24, 33, 44) and its surrounding region (23, 34), together termed extRD1 (4, 17). RD1 encompasses nine genes in M. tuberculosis (Rv3871 to Rv3879c) that are deleted from the attenuated vaccine Mycobacterium bovis BCG (2, 22). M. tuberculosis and M. marinum utilize ESX-1 to export virulence proteins that do not have the conventional SecA-dependent signal peptide sequences (17, 24, 33, 44, 50). The proteins that are secreted by ESX-1 and involved in virulence include ESAT-6, CFP-10, EspA, and Mh3881c (or EspB) (14, 17, 23, 28, 34, 50). During secretion, Mh3881c is cleaved close to its C terminus to produce two fragments with apparent molecular masses of 50 and 11 kDa (28, 50). Inside the bacterial cytosol, the C-terminal sequence of Mh3881c interacts with ESAT-6, and this interaction is essential for the secretion of ESAT-6 (50).

ESX-1 plays a critical role in the virulence of M. tuberculosis and M. marinum in vitro and in vivo (14, 17, 23, 24, 33, 44, 46), but the precise molecular and cellular mechanisms are not clearly defined. We previously reported that M. marinum is able to escape from the Mycobacterium-containing vacuole (MCV) into the host cell cytosol, where M. marinum is able to polymerize host cell actin and spread from cell to cell (42). However, the M. marinum genes involved in mycobacterial escape from the MCV and actin polymerization have not been characterized. Because mutations in various ESX-1 genes abolish M. marinum cell-to-cell spreading (17), we hypothesized that the ESX-1 secretion system could secrete a pore-forming protein into the MCV to compromise the integrity of the vacuole membrane and facilitate the escape of M. marinum into the host cell cytosol. In this study, we show that ESX-1 plays an essential role in the escape of M. marinum from the MCV. We provide evidence that ESX-1 secretion and secreted ESAT-6 play a critical role in causing pore formation in host cell membranes. These results suggest that ESAT-6 secretion by ESX-1 may cause membrane pore formation in the MCV, facilitating M. marinum escape from the vacuole and spreading.


arrow
MATERIALS AND METHODS
 
Bacteria and media. M. marinum strain M was cultured and maintained as described previously (16). The M. marinum ESX-1 mutants were produced as described previously (17). The mh3877::tn mutant was recently isolated from an M. marinum transposon mutant library (16). The mh3881c::tn mutant and its complementation were described previously (50).

Generation of M. marinum {Delta}esat-6 mutant. {Delta}esat-6 mutant M. marinum was generated by allelic exchange. The left flanking fragment was amplified by PCR with primers DelESAT-F1 (5'CCGCTCTAGACCTGGTTGCAGACCGCCTCGAC3') and DelESAT-R1 (5'GCCCGAATTCAGAAGCCCATTTGCGAGGACAGCGC3'). The right flanking fragment was amplified by PCR with primers DelESAT-F2 (5'CGGGAATTCGCGTAGAATACCGAAGCACGAGATCGGG3') and DelESAT-R2 (5'CCGCAAGCTTCTAGATTCATGCCGGTTTGGCGTGGC3'). The left flanking fragment was digested with XbaI and EcoRI, and the right flanking fragment was digested with EcoRI and HindIII. The left and right flanking fragments and a kanamycin resistance cassette (kanr) (cut with EcoRI from pUC4K) were ligated into pBluescript. The entire sequence containing the flanking sequences and kanr was cut from the pBluescript clone and ligated into pLYG304.zeo (19) to generate the esat-6 knockout plasmid. The plasmid was electroporated into wild-type (WT) M. marinum, and homologous recombinants were selected as described previously (19). Confirmation of the {Delta}esat-6 mutation was carried out by PCR with two primer pairs. One pair confirms recombination within the left flanking sequence, in which a primer that anneals to a sequence upstream from the flanking sequence (5'CGTGGACCGGAGGCGGCAGCGAGAAAG3') and another that anneals to a sequence in kanr (5'CACCTTCTTCACGAGGCAGACCTCAGCGCC3') were used. The other pair confirms recombination within the right flanking sequence, in which a primer that anneals to a sequence downstream from the flanking sequence (5'GGATTCAGCCTCCGGTGGCCCTGGAG3') and another that anneals to a sequence in kanr (5'GGCAATGTAACATCAGAGATTTTGAGACACAACGTGGC3') were used.

Complementation of M. marinum {Delta}esat-6 mutant. To complement the {Delta}esat-6 mutant with both the esat-6 and cfp-10 genes together, a fragment containing both genes was amplified by PCR from the M. marinum genome with primers 5'CAGAGATGAAGACCGATGCCGCTACCCTCG3' and 5'GGCCGGATCCTTAGTGATGGTGATGGTGATGAGCAAACATCCCCGTGACGTTGCC C3'. The reverse primer contains a six-His tag fused to the C terminus of ESAT-6. The PCR product was cloned into pLYG206.Zeo (18) to generate the complementation plasmid. This plasmid was electroporated into {Delta}esat-6 to obtain the complementation strain.

Macrophages. J774.A1 (ATCC TIB67) or Raw264.7 (ATCC TIB-71) murine macrophage-like cells were cultured and maintained as described previously (16). Bone marrow-derived macrophages (BMDMs) were obtained from C57BL/6 mice as previously described (38). Cells were harvested 8 to 10 days after plating and allowed to adhere to fibronectin-coated coverslips (Becton Dickinson) for infection with M. marinum the next day.

DiI labeling of MCV membranes. BMDMs on glass coverslips were infected with M. marinum at a multiplicity of infection (MOI) of 2 for 2 h, followed by three washes with phosphate-buffered saline (PBS) and 1 h of incubation with 200 µg/ml amikacin to kill the extracellular bacteria. At the end of the antibiotic incubation, the cells were washed two times with PBS and incubated at 32°C in 5% CO2 for 48 to 72 h. CM-DiI (Molecular Probes) was added to the cells at a 2 µM final concentration and incubated for 1 h. The cells were then washed two times with PBS to remove excess DiI, incubated for 1 h in the cell culture medium, and fixed with 4% paraformaldehyde. The fixed cells were washed three times with PBS, mounted on a glass slide with Prolong Antifade (Molecular Probes), and imaged.

Fluorescent labeling of F-actin. BMDMs on glass coverslips were infected at an MOI of 2 as described above. At 48 to 72 h postinfection, the cells were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X-100, stained with Alexa Fluor phalloidin (Molecular Probes), and imaged. To artificially deliver the ESX-1 mutant bacteria into macrophage cytosol, the cells at 48 h postinfection were treated for 5 min with a hypotonic solution (4 parts phenol red-free Dulbecco modified Eagle medium [DMEM] to 1 part H2O), incubated in cell culture medium at 32°C in 5% CO2 for an additional 24 h, and then processed for actin staining. The procedures for the hypotonic shock treatment were similar to those described by Okada and Rechsteiner (31).

Electron microscopy. BMDMs were infected at an MOI of 2 as described above. At 72 h after infection, the cells were processed for electron microscopic analysis as described previously (48).

Detection of pore formation in red blood cell membranes. Induction of pore formation in red blood cell membranes by M. marinum was detected by hemolysis assay as previously described (15, 17). Briefly, M. marinum grown in 7H9 medium to mid-log phase was washed twice with PBS. A volume of 1.3 ml of M. marinum suspension (containing 2.5 x 109 bacteria) was mixed with 400 µl of sheep red blood cells (sRBC; Quad Five) (containing 1 x 108 cells) in a microcentrifuge tube and centrifuged at 8,000 x g for 2 min. The tubes were incubated at 32°C for designated periods of time. The pellets were then resuspended and centrifuged, and the A405 of the supernatants was measured. To examine the role of energy-dependent secretion in membrane pore formation, M. marinum WT bacteria were pretreated for 15 min with 20 µM carbonyl cyanide m-chlorophenylhydrazone (CCCP) to uncouple the proton motive force and then incubated with sRBC in the presence of CCCP for 2 h. To observe the reversibility of CCCP in hemolysis, the pellet containing M. marinum and red blood cells was resuspended in PBS and then repelleted and further incubated for 2 h before measurement of hemolysis.

In the polyethylene glycol (PEG) osmoprotection experiment, PEG1000, PEG3350, PEG6000, and PEG8000 were resuspended in PBS and added to red blood cells with or without M. marinum to a final concentration of 30 mM. Hemolysis was measured after 2 h of incubation at 32°C. To determine if protection from hemolysis by PEG8000 is reversible, the pellet containing M. marinum and red blood cells was resuspended in PBS and then repelleted and further incubated for 2 h before measurement of hemolysis. To estimate membrane pore size, the various PEGs were resuspended in PBS at the following ranges of osmolarities: PEG1000, 1.0, 2.0, 3.0, and 4.0 M; PEG3350, 0.2, 0.4, 0.6, 0.8, and 1.0 M; PEG6000, 0.2, 0.3, 0.4, and 0.5 M; PEG8000, 0.1, 0.2, and 0.3 M. The osmolarity required for each PEG to provide 50% protection from hemolysis was determined and plotted against the Einstein-Stokes molecular diffusion radium, RES (40).

Expression and purification of recombinant ESX-1 proteins. The rESAT-6-His(6), rCFP-10-His(6), and rMh3881c-His(6) proteins were affinity purified and had endotoxins removed. The rESAT-6-His(6) and rCFP-10-His(6) proteins were obtained from Colorado State University under the NIH TB Research Materials Contract. The inclusion bodies containing rESAT-6-His(6) were solubilized with 6 M urea, and the protein was purified with the His-Bind resin (Novagen). Endotoxins were removed by washing the column with 10 mM Tris-HCl, followed by 0.5% ASB-14. The protein was eluted with 10 mM Tris-HCl containing 1 M imidazole. The eluted protein was dialyzed against 10 mM ammonium bicarbonate. The residual concentration of endotoxins was ≤0.24 ng/mg protein. Two lots were obtained, one produced in 2001 and the other in 2007. Both lots were used for the analysis of membrane pore formation, and similar results were observed. We expressed and purified the rMh3881c-His(6) protein by using procedures similar to those described above.

Detection of pore formation by purified ESX-1 proteins. To determine the ability of ESX-1-secreted proteins to induce membrane pore formation, the above-described purified rESAT-6-His(6), rCFP-10-His(6), or rMh3881c-His(6) in a 50-µl volume was mixed with 100 µl of sRBC (containing 1 x 109 cells) in a microcentrifuge tube. The tubes were incubated at 32°C for designated periods of time. The cells were then resuspended and centrifuged at 4,000 rpm for 7 min. The supernatants were transferred to corresponding wells in a 96-well plate, and the A405 was measured. In the PEG osmoprotection experiment, PEG1000, PEG3350, PEG6000, and PEG8000 were resuspended in PBS and added to the red blood cell-protein mixture at a final concentration of 30 mM. Hemolysis was measured after 2 h of incubation at 32°C.

Detection of pore formation in macrophage cell membranes. M. marinum strains grown to mid-log phase were washed twice with DMEM, added to macrophage monolayers at an MOI of 50, centrifuged for 10 min at 1,500 x g to allow immediate bacterium-cell contacts, and incubated at 32°C in 5% CO2 for designated periods of time. The release of lactate dehydrogenase (LDH) by the infected and noninfected cells was measured with a CytoTox-One Homogeneous Membrane Integrity Assay kit (Promega) at an excitation wavelength of 560 nm and an emission wavelength of 590 nm. Pore formation in macrophage cell membranes was determined by an osmoprotection assay with various PEGs at a final concentration of 30 mM. To examine the induction of pore formation in macrophage cell membranes by rESAT-6-His(6), rCFP-10-His(6), or rMh3881c-His(6), the proteins were dissolved in DMEM and added individually to Raw264 cells in a 96-well plate at designated concentrations. After 2 h of incubation at 32°C in 5% CO2, the release of LDH was determined.

To detect membrane pore formation by a microscopic method, infected or noninfected macrophages were incubated with ethidium homodimer-1 (Molecular Probes) and penetration of the cell by ethidium homodimer-1 across the membranes was detected by fluorescence microscopy. In brief, macrophages were incubated for 40 min in phenol red-free culture medium containing ethidium homodimer-1 (4 µM) and calcein AM (2 µM), followed by imaging. Ethidium homodimer-1 only penetrates permeabilized cell membranes and stains the nuclei red. Calcein AM permeates every cell membrane and is only metabolized by live cells to produce green fluorescence.

Preparation of M. marinum short-term culture filtrate and cell lysate. Preparation of M. marinum short-term culture filtrate and cell lysate was carried out as previously described (50). In brief, WT and mutant M. marinum cells were first grown in 7H9 medium to mid-log phase. The bacteria were then washed and diluted 10 times in Sauton's medium and cultured for 2 days to reach mid-log phase. The bacteria were washed again and diluted 10 times in Sauton medium and cultured for another 2 days. The culture supernatant was collected, filtered through a 0.2-µm filter, and concentrated 100 times with a Centricon centrifugal filter with a molecular weight cutoff of 3,000. The cell lysate was obtained by bead beating the bacterial pellet.

Western blotting. Proteins were separated by 4 to 20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane. After blocking with 2% bovine serum albumin, the membrane was incubated with a primary antibody diluted in 2% bovine serum albumin overnight, followed by incubation for 1 h with a horseradish peroxidase-conjugated secondary antibody (Bio-Rad). The membrane was developed by enhanced chemiluminescence (Pierce) and exposed to films. The following primary antibodies were used at the dilutions indicated: anti-ESAT-6 (monoclonal antibody HYB 76-8; Abcam), 1:3,000; anti-CFP-10 (Colorado State University, NIH contract NO1-AI-75320), 1:2,000; anti-Mh3881c (Michael Lodes, Corixa Corporation, Seattle, WA), 1:5,000.


arrow
RESULTS
 
ESX-1 is essential for M. marinum to escape from the vacuole. M. marinum is able to escape from the MCV into the host cell cytosol, polymerize actin, and spread from cell to cell (17, 42, 43). Because mutations in various ESX-1 genes abolish M. marinum spreading (17), we hypothesized that the ESX-1 secretion system may play a role in either the escape of M. marinum from the MCV or initiation of actin polymerization. We first determined if ESX-1 is involved in M. marinum escape from the vacuole. We examined the association of WT or ESX-1 mutant bacteria with the vacuole membranes in live macrophages by using a fluorescent membrane dye, DiI. DiI is frequently used to label the live cell membranes and has worked well in previous studies labeling MCV membranes (42). As shown in Fig. 1A to C and Table 1, at 72 h postinfection only a small fraction (18%) of the WT bacteria colocalized with DiI, suggesting that the majority of the bacteria entered the cytosol. In sharp contrast, for all of the nine ESX-1 mutants examined, the majority of the bacteria (≥80%) colocalized with DiI (Fig. 1D to F and Table 1), indicating that they reside predominantly within MCV membranes. To confirm the above observations, we used transmission electron microscopy to examine in greater detail the association of M. marinum with vacuole membranes. This study shows that only a small fraction of the WT bacteria are bound with MCV membranes (36%), while most are free of the membrane (64%) (Fig. 2A and Table 1). On the other hand, for the four ESX-1 mutants examined, more than 98% of the bacteria are surrounded by MCV membranes (Fig. 2B and Table 1). The mutants used in the above assays contain mutations in either the ESX-1 secretion apparatus (such as mh3877::tn and mh3871::tn) or the secreted substrates (such as {Delta}esat-6, {Delta}cfp-10+esat-6, and mh3881c::tn). Because the two groups of mutants showed similar phenotypes (Table 1), these results indicate that the ESX-1 secretion system plays a critical role in the escape of M. marinum from the MCV.


Figure 1
View larger version (86K):
[in this window]
[in a new window]

 
FIG. 1. ESX-1 secretion plays an essential role in the escape of M. marinum from the vacuole. BMDMs were infected with WT M. marinum or the ESX-1 mutants at an MOI of 2. At 72 h postinfection, the cells were stained with DiI. For the ESX-1 mutants, only the results for mh3868::tn are shown; the results for the rest of the mutants are shown in Table 1. The top panels show the phase (A), DiI fluorescence (B), and merge (C) images from a representative macrophage infected by WT M. marinum. The bottom panels show the phase (D), DiI fluorescence (E), and merge (F) images from a representative macrophage infected by mh3868::tn. The insert in the lower right corner is an enlarged section of the indicated area in each panel. Arrowheads indicate M. marinum bacteria on the tips of actin stalks (refer to the paper by Stamm et al. [42] for details of actin stalks), which show no colocalization with DiI, suggesting their cytosolic localization. Information on duplication of experiments, the number of cells examined, and statistical analyses is shown in Table 1.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Analysis of WT M. marinum and the ESX-1 mutants for colocalization with MCV membranes and polymerization of actin


Figure 2
View larger version (143K):
[in this window]
[in a new window]

 
FIG. 2. Transmission electron microscopy confirming the role of ESX-1 in M. marinum escape from the vacuole. BMDMs were infected with WT M. marinum or the ESX-1 mutants at an MOI of 2. At 72 h postinfection, the cells were processed for electron microscopy. For the ESX-1 mutants, only the results for mh3868::tn are shown; the results for the rest of the mutants are shown in Table 1. Panel A shows a section of a representative macrophage infected by WT M. marinum. The upper left insert shows an enlarged area of the cell. No host cell membranes are visible surrounding the bacteria. Note that a bacterium on the right shows an actin tail (indicated by arrows). Panel B shows a section of a representative macrophage infected by mh3868::tn. Almost all of the mutant bacteria are surrounded by vacuole membranes (indicated by arrowheads). The insert on the mid-left shows an enlarged area of the cell. Information on duplication of experiments, the number of cells examined, and statistical analyses is shown in Table 1.

M. marinum escape from the vacuole is required for the polymerization of actin. Next, we determined if ESX-1 is required for M. marinum to initiate actin polymerization. At 72 h postinfection, 34% of the WT bacteria showed actin polymerization at one pole of the bacterium, forming the "actin comet tail" (Fig. 3A to C and Table 1), similar to previous observations (42, 43). In contrast, none of the nine ESX-1 mutants were able to polymerize actin (Fig. 3D to F and Table 1).


Figure 3
View larger version (115K):
[in this window]
[in a new window]

 
FIG. 3. ESX-1 secretion plays an essential role in polymerization of actin by M. marinum in macrophages. BMDMs were infected with WT M. marinum or the ESX-1 mutants at an MOI of 2. At 72 h postinfection, the cells were stained with Alexa Fluor phalloidin to detect F-actin. For the ESX-1 mutants, only the results for mh3868::tn are shown; the results for the rest of the mutants are shown in Table 1. The top panels show the images of phase (A), F-actin (B), and merge (C) from a representative macrophage infected by WT M. marinum. The bottom panels show the images of phase (D), F-actin (E), and merge (F) from a representative macrophage infected by mh3868::tn. The insert in the lower left corner is an enlarged section of the area indicated in each panel. Arrowheads indicate actin tails. Information on duplication of experiments, the number of cells examined, and statistical analyses is shown in Table 1.

One possible explanation for the above results is that an ESX-1-secreted protein is directly involved in the recruitment and polymerization of actin. Alternatively, an ESX-1-secreted protein could be involved in compromising the integrity of MCV membranes to facilitate M. marinum escape into the host cell cytosol. To distinguish between these two possibilities, we treated the infected macrophages with a hypotonic solution to artificially deliver the ESX-1 mutant bacteria into the cytosol and then reexamined actin polymerization. Okada and Rechsteiner (31) showed elegantly that hypotonic shock treatment causes lysis of pinocytic/endocytic vesicle membranes without disrupting the plasma membrane. This finding supports that the hypotonic shock treatment could facilitate entry of the ESX-1 mutant bacteria into the host cell cytosol. Indeed, as shown in Fig. 4, after the treatment, mh3868::tn gained the ability to polymerize actin. Similar results were observed with mh3881c::tn (data not shown). These results indicate that the defect in the ability of the ESX-1 mutants to polymerize actin is due to their inability to escape from the vacuole rather than a deficiency in initiation of actin polymerization. They also provide direct evidence that M. marinum initiates actin polymerization only after it enters the host cell cytosol. Moreover, they suggest that ESX-1 is involved in secreting a pore-forming protein that may compromise the integrity of the MCV membranes to facilitate the escape of M. marinum.


Figure 4
View larger version (88K):
[in this window]
[in a new window]

 
FIG. 4. ESX-1 mutants acquire the ability to polymerize actin after being delivered into the macrophage cytosol by hypotonic shock treatment. BMDMs were infected by mh3868::tn at an MOI of 2. At 48 h postinfection, the cells were treated with a hypotonic solution (see Materials and Methods) to lyse the vacuole membranes without disrupting the plasma membranes (31). This treatment is expected to facilitate the escape of M. marinum into the macrophage cytosol. At 24 h after hypotonic shock treatment, the cells were processed for F-actin staining with Alexa Fluor phalloidin. Panel A shows F-actin staining, and panel B shows a merged phase and F-actin staining image. Actin tails are indicated by arrowheads. With one hypotonic shock treatment, more than 10% of the infected macrophages show actin polymerization by the mutant bacteria. Within these macrophages, an average of 46% of the bacteria show actin polymerization. Duplicate experiments were performed in which a total of 100 cells were observed.

Evidence for membrane pore formation by M. marinum ESX-1. Listeria monocytogenes represents a group of bacteria that are able to disrupt the vacuole membranes to enter the host cell cytosol by the secretion of pore-forming proteins (41). We hypothesized that the ESX-1 secretion system may play a similar role to facilitate M. marinum escape into the host cell cytosol. A direct test of this hypothesis would require the analysis of pore formation in the MCV membranes of infected cells, which is technically challenging. In an attempt to address this hypothesis, we took an alternative approach. We incubated M. marinum with host cells at a relatively high MOI and examined pore formation in the cell plasma membranes. Membrane pore formation was determined by an osmoprotection assay (40) which has been used in a number of studies to demonstrate membrane pore formation and estimate pore size. This assay has been used to detect membrane pores and estimate the size of pores induced by pathogens such as Gardnerella vaginalis (30), Legionella pneumophila (26), Shigella flexneri (3), and Pseudomonas aeruginosa (8). We first determined if the hemolysis of red blood cells induced by M. marinum could be blocked by PEGs of various molecular weights. The lysis of red blood cells (hemolysis) by pore-forming proteins occurs through osmotic shock, which can be prevented by osmoprotectants that have larger sizes than the membrane pores (3, 8, 26, 29). As shown in Fig. 5A, WT M. marinum caused contact-dependent hemolysis of red blood cells, which was blocked completely by PEG8000 (6.4 nm in diameter) and 60% by PEG6000 (5.0 nm) but not blocked by PEG3350 (3.8 nm). Importantly, the blocking effect of PEG8000 is reversible, as indicated by the recovery of hemolysis after the removal of PEG8000 (Fig. 5A). We then examined pore formation in macrophage cell membranes with a similar assay in which different-size PEGs were used to block the release of LDH from infected macrophages. We found that WT M. marinum caused the release of LDH from macrophages, which was blocked completely by PEG8000 but not by PEG3350. Together, the results of both assays suggest that M. marinum causes contact-dependent pore formation in host cell membranes.


Figure 5
View larger version (31K):
[in this window]
[in a new window]

 
FIG. 5. M. marinum induces pore formation in red blood cell membranes. (A) Pore formation in red blood cell membranes as determined by an osmoprotection assay with different-sized PEGs to prevent hemolysis. PEG8000-R indicates recovery of hemolysis after the removal of PEG8000. The bacterium-to-red blood cell ratio is 25:1. Mm indicates M. marinum. (B) Estimation of the size of the pores induced by M. marinum. The osmolarity of each of the PEGs (PEG1000, PEG3350, PEG6000, and PEG8000) required to provide 50% protection from hemolysis is plotted as a function of its Einstein-Stokes molecular diffusion radium, RES (40). The RES value for each PEG is as follows: PEG1000, 1.0 nM; PEG3350, 1.9 nM; PEG6000, 2.5 nM; PEG8000, 3.2 nM. The graphs are the summation of two independent experiments, each performed in duplicate, and error bars indicate standard deviations.

To estimate the size of the membrane pores produced by M. marinum, PEGs of different sizes were used at various concentrations to determine the osmolarity required for each PEG to provide 50% protection from hemolysis (26, 40). Figure 5B shows the osmolarity of each PEG that provides 50% protection as a function of its Einstein-Stokes molecular diffusion radium, RES (40). The response curve is hyperbolic and approaches a membrane stabilization limit asymptotically. By using a similar method developed by Scherrer and Gerhardt (40), we estimated pore size by extrapolating to the zero abscissa the linear regression between PEG1000 and PEG3350, and the intercept at RES of 2.25 is believed to represent the radius of the membrane pore.

We then determined if ESX-1 plays a role in membrane pore formation. As shown in Fig. 6A and B, mutations in either the ESX-1 secretion apparatus (mh3877::tn and mh3871::tn) or the secreted substrate ({Delta}esat-6) completely abolished the ability of M. marinum to induce membrane pore formation, demonstrating that ESX-1 secretion plays an essential role in this process. To determine if continuous ESX-1 secretion or predeposition of ESX-1-secreted proteins on the bacterial surface is necessary to cause pore formation, we treated WT M. marinum with CCCP, a membrane deenergizer that blocks energy-dependent pathways including ESX-1. Figure 6C shows that the CCCP treatment abolished hemolysis completely and in a reversible manner, indicating that continuous energy- dependent ESX-1 secretion is required for M. marinum to induce membrane pore formation.


Figure 6
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 6. ESX-1 secretion plays an essential role in the induction of pore formation in host cell membranes by M. marinum. (A) ESX-1-dependent induction of pore formation in red blood cell membranes. WT M. marinum or the ESX-1 mutants were mixed with red blood cells at a ratio of 25:1, centrifuged to allow close bacterium-cell contact, and incubated for 2 h before measurement of hemolysis. (B) ESX-1-dependent induction of pore formation in macrophage cell membranes. WT M. marinum or the ESX-1 mutants were incubated with Raw264 murine macrophages at a ratio of 50:1. Pore formation in macrophage cell membranes was detected by release of LDH and its blockage by different-sized PEGs. LDH release (percent) is the percentage of LDH released by the infected macrophages with respect to the total amount of LDH produced by lysis of the macrophages with H2O. (C) Induction of membrane pore formation by M. marinum requires continuous energy-dependent secretion. WT M. marinum was left untreated or treated with CCCP prior to incubation with red blood cells. CCCP-R indicates recovery of pore formation after removal of CCCP. The values are means of two independent experiments, each performed in duplicate, and error bars indicate standard deviations.

Evidence for membrane pore formation by ESX-1-secreted ESAT-6. Three known ESX-1-secreted proteins, ESAT-6, CFP-10, and Mh3881c, are codependent for secretion (50). To determine the relative role of each individual protein in pore formation, we compared the hemolysis levels induced by different M. marinum strains producing various amounts of these proteins. We have shown previously that Mh3881c is cleaved during secretion to produce an N-terminal 50-kDa and a C-terminal 11-kDa fragment (apparent molecular masses) (50; Fig. 7, lane 1). The 50-kDa fragment is relatively stable and present at abundant levels in the culture supernatant, while the majority of the 11-kDa fragment is degraded proteolytically (50; data not shown). As shown in Fig. 7, mh3881c::tn fails to secrete these three proteins and is defective in pore formation (lane 2). Both the secretion and pore formation defects of this mutant are almost fully restored by expression of the WT mh3881c gene (lane 3). On the other hand, when only the N-terminal 50-kDa fragment of Mh3881c was expressed in this mutant, it was secreted by the mutant at levels comparable to those produced by WT bacteria, but ESAT-6 secretion was not detected and CFP-10 secretion was minimal (lane 4). Because this strain shows a complete defect in pore formation, the data suggest that Mh3881c, or at least the 50-kDa fragment, does not contribute directly to pore formation. To determine if the secretion of ESAT-6 or CFP-10 plays a role, we examined pore formation by {Delta}esat-6 and the complementation strain. {Delta}esat-6 fails to secrete these three proteins and is defective in pore formation (lane 5). Expressing esat-6-His(6) in {Delta}esat-6 substantially restored the secretion of ESAT-6 and Mh3881c, although CFP-10 secretion was only recovered by a marginal level (lane 6). The reason that we used esat-6-His(6) instead of esat-6 was to express this protein in a form that is exactly the same as the recombinant protein used in other assays (see below). Because this strain shows a substantial increase in hemolysis, which correlates with the much increased ESAT-6 secretion, the results suggest that ESAT-6 secretion plays a more important role in pore formation.


Figure 7
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 7. Membrane pore formation induced by M. marinum correlates with ESAT-6 secretion. (A) The steady-state cellular levels of Mh3881c, CFP-10, and ESAT-6 in the WT, mh3881c::tn, resat-6, and complemented strains. mh3881c::tn plus mh3881c indicates the mh3881c::tn mutant complemented with the WT mh3881c gene. mh3881c::tn plus mh3881c-N indicates the mh3881c::tn mutant complemented with only the N-terminal 50-kDa fragment of Mh3881c. resat-6 plus esat-6-His indicates the resat-6 mutant complemented with esat-6-His(6). CL, cell lysate. (B) Secretion of Mh3881c, CFP-10, and ESAT-6 by the WT, mh3881c::tn, resat-6, and complemented strains. The lane order is the same as in panel A. The single asterisk indicates full-length Mh3881c with an apparent molecular mass of 61 kDa; the double asterisks indicate the N-terminal fragment of Mh3881c with an apparent molecular mass of 50 kDa. CF, culture filtrate. (C) Membrane pore formation (measured by hemolysis) induced by the WT, mh3881c::tn, resat-6, and complemented strains. The hemolysis level obtained with the WT bacteria is normalized to 100%. The bar order is the same as the lane order in panel A.

To determine if ESAT-6 has a direct role in membrane pore formation, we examined the pore-forming activity of recombinant ESAT-6 [rESAT-6-His(6)] purified from Escherichia coli and compared it to that of rCFP-10-His(6) or rMh3881c-His(6). These recombinant proteins were affinity purified and free of detergents and had endotoxins removed (see Materials and Methods for details). As shown in Fig. 8A, rESAT-6-His(6) from M. tuberculosis produced dose-dependent hemolysis after a 2-h incubation, i.e., partial hemolysis at 15 µg/ml and complete hemolysis at 30 µg/ml, almost equivalent to lysis with H2O. In contrast, neither rCFP-10-His(6) from M. tuberculosis nor rMh3881c-His(6) from M. marinum caused hemolysis, even at a higher concentration of 60 µg/ml (Fig. 8B) or 120 µg/ml (data not shown). The combination of rESAT-6-His(6) with rCFP-10-His(6) or with rMh3881c-His(6) produced hemolysis at levels similar to those produced by rESAT-6-His(6) alone (data not shown). Hemolysis induced by rESAT-6-His(6) was not due to the residual endotoxins present in the recombinant protein preparations (≤0.24 ng/mg protein), since lipopolysaccharide at a concentration of 0.007 ng/ml [equivalent to the level of endotoxins present in rESAT-6-His(6) at a concentration of 30 µg/ml] failed to induce a detectable level of hemolysis (data not shown). Consistent with the hemolysis results, rESAT-6-His(6) at 60 µg/ml, but not rCFP-10-His(6) or rMh3881c-His(6) (even at 120 µg/ml), caused release of LDH from macrophages (Fig. 8C). Permeation of macrophage cell membranes was similarly observed by microscopic detection of penetration of ethidium homodimer-1 across the plasma membrane into the cytosol to stain the nuclei red (Fig. 8D). These results together suggest that ESAT-6 may play a direct role in membrane pore formation.


Figure 8
View larger version (50K):
[in this window]
[in a new window]

 
FIG. 8. Purified ESAT-6, but not CFP-10 or Mh3881c, plays a direct role in causing pore formation in host cell membranes. (A) rESAT-6-His(6) induces dose-dependent pore formation in red blood cell membranes. The protein was incubated with red blood cells for 2 h before measurement of hemolysis. (B) rESAT-6-His(6), but not rCFP-10-His(6) or rMh3881c-His(6), induces pore formation in red blood cell membranes. The proteins were incubated with red blood cells for 2 h before measurement of hemolysis. (C) rESAT-6-His(6), but not rCFP-10-His(6) or rMh3881c-His(6), induces pore formation in macrophage cell membranes. J774 macrophages were incubated with the proteins in cell culture medium for 2 h before measurement of LDH release. H2O was used to obtain complete lysis of the macrophages. (D) Detection of ESAT-6-induced membrane pore formation by fluorescence microscopy. J774 macrophages were incubated with rESAT-6-His(6), rCFP-10-His(6), or rMh3881c-His(6) for 2 h before detection of penetration of ethidium homodimer-1 across the macrophage cell membranes to stain the nuclei red. The bar graph shows the quantification of the representative images. Error bars indicate standard deviations of data from two experiments, with each performed in duplicate.

To provide a more direct demonstration that ESAT-6 by itself can induce pore formation in cell membranes, we performed an osmoprotection assay similar to that described above. As shown in Fig. 9A, the hemolysis induced by rESAT-6-His(6) was blocked completely by 30 mM PEG8000 and PEG6000, ~40% by PEG3350, and to a small extent by PEG1000. The facts that hemolysis is induced by rESAT-6-His(6) and that it can be blocked by PEGs of increasing sizes indicate that ESAT-6 indeed plays a direct role in membrane pore formation. It was noticed that the membrane pores induced by rESAT-6-His(6) are somewhat smaller than those produced by the bacteria (see Discussion). We further characterized the ESAT-6-induced membrane pores by determining the kinetics of hemolysis produced by rESAT-6-His(6). Figure 9B shows that rESAT-6-His(6) at 30 µg/ml caused 75% hemolysis after a 5-min incubation, which increased to 93% after 10 min. This is almost equivalent to the hemolysis produced by H2O, which caused 95% and complete hemolysis after 5 and 20 min of incubation, respectively.


Figure 9
View larger version (43K):
[in this window]
[in a new window]

 
FIG. 9. Purified ESAT-6 induces pore formation in red blood cell membranes. (A) Membrane pores induced by rESAT-6-His(6) were blocked by PEGs of appropriate sizes in an osmoprotection assay. Hemolysis was also completely blocked by 30 mM PEG6000 (data not shown). (B) The kinetics of membrane pore formation induced by ESAT-6. The concentration of rESAT-6-His(6) was 30 µg/ml for both panels. Error bars indicate standard deviations of data from two or three independent experiments, with each performed in duplicate.


arrow
DISCUSSION
 
The ESX-1 (type VII) secretion system plays an important role in the virulence of M. tuberculosis and M. marinum, but the precise molecular and cellular mechanisms by which it enhances virulence are not clearly defined. This paper describes a comprehensive study of these mechanisms which has led to several important observations. Firstly, by examining nine M. marinum ESX-1 mutants and the WT by fluorescence and electron microscopy detecting MCV membranes, this study demonstrates conclusively that ESX-1 plays an essential role in the escape of M. marinum from the MCV. The role of vacuole escape in mycobacterial pathogenesis is not clearly understood. The observations that M. marinum can polymerize actin inside host cell cytosol and spread from cell to cell (17, 42, 43) suggest that vacuole escape may play a role in mycobacterial spreading.

Secondly, we show that the ESX-1 mutant bacteria are able to polymerize actin after being delivered into the host cell cytosol by hypotonic shock treatment. This result suggests that the defect in the ability of the ESX-1 mutants to polymerize actin during normal cell infection is due to their inability to escape from the MCV rather than a deficiency in initiation of actin polymerization. This conclusion helps to redirect future research efforts aimed at identifying the mycobacterial molecules directly responsible for initiating actin polymerization. In addition, since this assay clearly shows that M. marinum induces actin polymerization only after it enters the cytosol, it suggests that actin tails can be used as a readout of cytosolic localization for M. marinum.

Thirdly, this study demonstrates for the first time that M. marinum utilizes ESX-1 to produce membrane pores ~4.5 nm in diameter in red blood cells and macrophages. Importantly, purified ESAT-6 by itself at a concentration of 30 µg/ml is sufficient to cause pore formation in cell membranes. These observations are a significant advancement of the previously published works. For example, M. tuberculosis (24) and M. marinum (17) have been shown to induce the permeation of cell membranes, and here we demonstrate that the cause of this permeation is pore formation. In addition, earlier studies show that purified ESAT-6 can cause permeation of liposome membranes (9, 24), and here we show that it causes pore formation in cell membranes. Our study suggests that ESAT-6 secreted by M. marinum ESX-1 could play a direct role in causing pore formation in MCV membranes to facilitate mycobacterial escape from the vacuoles.

We have noticed that purified ESAT-6 induces membrane pores that are somewhat smaller than those produced by bacteria. We hypothesize that the membrane pores could be formed by the insertion of multimers of ESAT-6, exposing their hydrophobic surface to the lipid bilayer and their hydrophilic surface to the center of the pore. This model suggests that the number of ESAT-6 molecules inserted to form a pore could determine the size of the pore. It is possible that ESAT-6 secreted by M. marinum ESX-1 at the bacterium-cell contact site could have optimal insertion and/or multimerization to produce pores larger than those produced by the protein alone. Alternatively, it is possible that certain bacterial surface structures or molecules or some other secreted molecules could enhance membrane pore formation. For example, the secretion of phospholipases C by Listeria plays a role in enhancing membrane pore formation by the pore-forming toxin listeriolysin O (21). M. marinum and M. tuberculosis contain multiple copies of phospholipase C (6, 45), and M. tuberculosis has been shown to secrete phospholipase C (35). The involvement of phospholipase C in membrane pore formation is worthy of further investigation.

A topic related to the above is whether ESAT-6 alone or ESAT-6 in complex with CFP-10 or the other ESX-1-secreted proteins forms the membrane pores during mycobacterial infection. Thus far, the published studies have assigned the membrane destabilization activity to ESAT-6 alone (9, 24). Our results are consistent with these studies in that ESAT-6 alone causes pore formation. Then, the question comes if the pore-forming activity of ESAT-6 is biologically plausible, considering that some studies show that ESAT-6 and CFP-10 can interact with each other and can form a tight 1:1 complex (36, 37). However, our studies suggest that not all of the ESAT-6 and CFP-10 molecules have to be held in an exact 1:1 complex, and this does not contradict the published results. We have shown that Mh3881c forms a complex with ESAT-6 (50). When Mh3881c is pulled down from M. marinum cell lysate, ESAT-6 coprecipitates with Mh3881c; however, no CFP-10 is detected in the precipitate (50). In addition, as shown in Fig. 7, the {Delta}esat-6 complementation strain produces a much more abundant level of ESAT-6 than CFP-10 in the culture supernatant. Both of our studies suggest that during M. marinum infection at least some of the ESAT-6 molecules could be targeted to the host cell membranes not in a complex with CFP-10. It remains a possibility that Mh3881c facilitates the pore-forming activity of ESAT-6, which warrants future investigation.

A recent study showed that ESAT-6 in a concentration range of 2 to 5 µg/ml can induce apoptosis of macrophages after overnight incubation (11). This result does not conflict with our observation in the present study. By using this concentration range of ESAT-6, we were not able to detect apparent membrane pore formation in red blood cells and macrophages (Fig. 8). It is possible that the insertion and multimerization of ESAT-6 in cell membranes also depend on the concentration of ESAT-6 (indeed, we have observed a dose-dependent induction of membrane pore formation by ESAT-6; Fig. 8A), and 2 to 5 µg/ml might be below a critical concentration of ESAT-6 required to induce pore formation. On the other hand, since this sub-pore-forming concentration of ESAT-6 was shown to induce cell apoptosis (11), it suggests that ESAT-6 might use one domain to induce pore formation and another to induce apoptosis. In this regard, it has recently been shown that the C-terminal six amino acids of ESAT-6 can bind to macrophage surface Toll-like receptor 2 to modulate host cell signaling (32). Whether this interaction plays a role in the induction of apoptosis remains elusive and deserves further investigation. It should also be noted that the time course in the induction of apoptosis is very different from that in pore formation. While apoptosis is observed after an overnight incubation (11), pore formation is detected in minutes (this study). This analysis suggests that ESAT-6 may change its mode of action quite dramatically when present at different concentrations: either apoptotic or pore forming. Further studies on the structure and function of ESAT-6 will not only provide insight into the virulence mechanisms of mycobacterial infection but also promote the development of important tools based on ESAT-6 for research in broad areas of cell biology and immunobiology studies.

Finally, several studies have observed that M. tuberculosis can also escape from vacuoles into the host cell cytosol (27, 49) and that ESX-1 plays a role in this process (49), although this has not been consistently observed by some other researchers (5, 10, 39). In these studies that have observed M. tuberculosis escape from the vacuole, most of the observations were made by detailed electron microscopic examinations. One argument in the field is that during sample processing for electron microscopy, some of the cell membranes may not be preserved well, causing false-positive results. Therefore, using alternative methods for detection of MCV membranes is crucial and should provide additional confirmation of the electron microscopic observations. In this regard, in this study we have used three additional methods besides electron microscopy to confirm the association of M. marinum with MCV membranes. One method detects fluorescent labeling of MCV membranes by using the DiI stain in live cells, which avoids the perturbation of membranes that could be generated by the other detection methods. The second method detects polymerization of actin by M. marinum by fluorescence microscopy. Since WT M. marinum, but not the ESX-1 mutants, is able to polymerize actin, the data indicate that WT bacteria, but not the ESX-1 mutants, are able to escape from the vacuole. The third method uses hypotonic shock treatment to artificially deliver the ESX-1 mutant bacteria into the host cell cytosol, and then actin polymerization by the mutant bacteria is determined. We show that the ESX-1 mutants acquire the ability to polymerize actin after hypotonic shock treatment, confirming that the mutant bacteria reside within MCV membranes before the treatment but enter the cytosol after. However, actin polymerization has not been observed for M. tuberculosis in host cells (49), which makes this method unavailable for the detection of escape of M. tuberculosis from the vacuole. Nonetheless, as several recent studies show that M. tuberculosis can cause lysis of host cell plasma membranes in vitro and in vivo (12, 24, 25), these results suggest that M. tuberculosis could compromise vacuole membranes at a certain step of infection. This analysis suggests that escaping into the host cell cytosol could be a common strategy of pathogenic mycobacteria, while it occurs frequently and evidently in M. marinum infection. The reproducibility of observations and ease of manipulation make M. marinum an ideal system for studying these cellular processes important for the pathogenesis of mycobacteria.


arrow
ACKNOWLEDGMENTS
 
We thank John Belisle (Colorado State University) for providing the rESAT-6-His(6) and rCFP-10-His(6) proteins under NIH TB Research Materials Contract HHSN266200400091C. We thank Tim Maugel of the Biological Ultrastructure Laboratory at the University of Maryland for technical assistance with transmission electron microscopy. We thank Hiroshi Morisaki for technical assistance with the hypotonic shock experiment. We also thank Eric Brown for helpful comments on this work and the manuscript. We thank Vincent Lee and Kevin McIver at University of Maryland for comments on the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: University of Maryland, College Park, 3109 Microbiology Building, College Park, MD 20742. Phone: (301) 405-7562. Fax: (301) 314-9489. E-mail: lygao{at}umd.edu Back

{triangledown} Published ahead of print on 13 October 2008. Back

Editor: J. L. Flynn

{dagger} These authors contribute equally to this work. Back


arrow
REFERENCES
 
    1
  1. Abdallah, A. M., N. C. Gey van Pittius, P. A. Champion, J. Cox, J. Luirink, C. M. Vandenbroucke-Grauls, B. J. Appelmelk, and W. Bitter. 2007. Type VII secretion—mycobacteria show the way. Nat. Rev. Microbiol. 5:883-891.[CrossRef][Medline]
  2. 2
  3. Behr, M. A., M. A. Wilson, W. P. Gill, H. Salamon, G. K. Schoolnik, S. Rane, and P. M. Small. 1999. Comparative genomics of BCG vaccines by whole-genome DNA microarray. Science 284:1520-1523.[Abstract/Free Full Text]
  4. 3
  5. Blocker, A., P. Gounon, E. Larquet, K. Niebuhr, V. Cabiaux, C. Parsot, and P. Sansonetti. 1999. The tripartite type III secreton of Shigella flexneri inserts IpaB and IpaC into host membranes. J. Cell Biol. 147:683-693.[Abstract/Free Full Text]
  6. 4
  7. Brodin, P., L. Majlessi, L. Marsollier, M. I. de Jonge, D. Bottai, C. Demangel, J. Hinds, O. Neyrolles, P. D. Butcher, C. Leclerc, S. T. Cole, and R. Brosch. 2006. Dissection of ESAT-6 system 1 of Mycobacterium tuberculosis and impact on immunogenicity and virulence. Infect. Immun. 74:88-98.[Abstract/Free Full Text]
  8. 5
  9. Clemens, D. L., B. Y. Lee, and M. A. Horwitz. 2000. Deviant expression of Rab5 on phagosomes containing the intracellular pathogens Mycobacterium tuberculosis and Legionella pneumophila is associated with altered phagosomal fate. Infect. Immun. 68:2671-2684.[Abstract/Free Full Text]
  10. 6
  11. Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, A. Krogh, J. McLean, S. Moule, L. Murphy, K. Oliver, J. Osborne, M. A. Quail, M. A. Rajandream, J. Rogers, S. Rutter, K. Seeger, J. Skelton, R. Squares, S. Squares, J. E. Sulston, K. Taylor, S. Whitehead, and B. G. Barrell. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-544.[CrossRef][Medline]
  12. 7
  13. Cosma, C. L., D. R. Sherman, and L. Ramakrishnan. 2003. The secret lives of the pathogenic mycobacteria. Annu. Rev. Microbiol. 57:641-676.[CrossRef][Medline]
  14. 8
  15. Dacheux, D., J. Goure, J. Chabert, Y. Usson, and I. Attree. 2001. Pore-forming activity of type III system-secreted proteins leads to oncosis of Pseudomonas aeruginosa-infected macrophages. Mol. Microbiol. 40:76-85.[CrossRef][Medline]
  16. 9
  17. de Jonge, M. I., G. Pehau-Arnaudet, M. M. Fretz, F. Romain, D. Bottai, P. Brodin, N. Honore, G. Marchal, W. Jiskoot, P. England, S. T. Cole, and R. Brosch. 2007. ESAT-6 from Mycobacterium tuberculosis dissociates from its putative chaperone CFP-10 under acidic conditions and exhibits membrane-lysing activity. J. Bacteriol. 189:6028-6034.[Abstract/Free Full Text]
  18. 10
  19. Deretic, V., S. Singh, S. Master, J. Harris, E. Roberts, G. Kyei, A. Davis, S. de Haro, J. Naylor, H. H. Lee, and I. Vergne. 2006. Mycobacterium tuberculosis inhibition of phagolysosome biogenesis and autophagy as a host defence mechanism. Cell Microbiol. 8:719-727.[CrossRef][Medline]
  20. 11
  21. Derrick, S. C., and S. L. Morris. 2007. The ESAT6 protein of Mycobacterium tuberculosis induces apoptosis of macrophages by activating caspase expression. Cell Microbiol. 9:1547-1555.[Medline]
  22. 12
  23. Dobos, K. M., E. A. Spotts, F. D. Quinn, and C. H. King. 2000. Necrosis of lung epithelial cells during infection with Mycobacterium tuberculosis is preceded by cell permeation. Infect. Immun. 68:6300-6310.[Abstract/Free Full Text]
  24. 13
  25. Dolin, P. J., M. C. Raviglione, and A. Kochi. 1994. Global tuberculosis incidence and mortality during 1990-2000. Bull. W. H. O. 72:213-220.[Medline]
  26. 14
  27. Fortune, S. M., A. Jaeger, D. A. Sarracino, M. R. Chase, C. M. Sassetti, D. R. Sherman, B. R. Bloom, and E. J. Rubin. 2005. Mutually dependent secretion of proteins required for mycobacterial virulence. Proc. Natl. Acad. Sci. USA 102:10676-10681.[Abstract/Free Full Text]
  28. 15
  29. Gao, L. Y., and Y. Abu Kwaik. 1999. Apoptosis in macrophages and alveolar epithelial cells during early stages of infection by Legionella pneumophila and its role in cytopathogenicity. Infect. Immun. 67:862-870.[Abstract/Free Full Text]
  30. 16
  31. Gao, L. Y., R. Groger, J. S. Cox, S. M. Beverley, E. H. Lawson, and E. J. Brown. 2003. Transposon mutagenesis of Mycobacterium marinum identifies a locus linking pigmentation and intracellular survival. Infect. Immun. 71:922-929.[Abstract/Free Full Text]
  32. 17
  33. Gao, L. Y., S. Guo, B. McLaughlin, H. Morisaki, J. N. Engel, and E. J. Brown. 2004. A mycobacterial virulence gene cluster extending RD1 is required for cytolysis, bacterial spreading and ESAT-6 secretion. Mol. Microbiol. 53:1677-1693.[CrossRef][Medline]
  34. 18
  35. Gao, L.-Y., F. Laval, E. H. Lawson, R. K. Groger, A. Woodruff, J. H. Morisaki, J. S. Cox, M. Daffe, and E. J. Brown. 2003. Requirement for kasB in Mycobacterium mycolic acid biosynthesis, cell wall impermeability and intracellular survival: implications for therapy. Mol. Microbiol. 49:1547-1563.[CrossRef][Medline]
  36. 19
  37. Gao, L. Y., M. Pak, R. Kish, K. Kajihara, and E. J. Brown. 2006. A mycobacterial operon essential for virulence in vivo and invasion and intracellular persistence in macrophages. Infect. Immun. 74:1757-1767.[Abstract/Free Full Text]
  38. 20
  39. Gauthier, D. T., M. W. Rhodes, W. K. Vogelbein, H. Kator, and C. A. Ottinger. 2003. Experimental mycobacteriosis in striped bass Morone saxatilis. Dis. Aquat. Org. 54:105-117.[Medline]
  40. 21
  41. Goldfine, H., C. Knob, D. Alford, and J. Bentz. 1995. Membrane permeabilization by Listeria monocytogenes phosphatidylinositol-specific phospholipase C is independent of phospholipid hydrolysis and cooperative with listeriolysin O. Proc. Natl. Acad. Sci. USA 92:2979-2983.[Abstract/Free Full Text]
  42. 22
  43. Gordon, S. V., R. Brosch, A. Billault, T. Garnier, K. Eiglmeier, and S. T. Cole. 1999. Identification of variable regions in the genomes of tubercle bacilli using bacterial artificial chromosome arrays. Mol. Microbiol. 32:643-655.[CrossRef][Medline]
  44. 23
  45. Guinn, K. M., M. J. Hickey, S. K. Mathur, K. L. Zakel, J. E. Grotzke, D. M. Lewinsohn, S. Smith, and D. R. Sherman. 2004. Individual RD1-region genes are required for export of ESAT-6/CFP-10 and for virulence of Mycobacterium tuberculosis. Mol. Microbiol. 51:359-370.[CrossRef][Medline]
  46. 24
  47. Hsu, T., S. M. Hingley-Wilson, B. Chen, M. Chen, A. Z. Dai, P. M. Morin, C. B. Marks, J. Padiyar, C. Goulding, M. Gingery, D. Eisenberg, R. G. Russell, S. C. Derrick, F. M. Collins, S. L. Morris, C. H. King, and W. R. Jacobs, Jr. 2003. The primary mechanism of attenuation of bacillus Calmette-Guerin is a loss of secreted lytic function required for invasion of lung interstitial tissue. Proc. Natl. Acad. Sci. USA 100:12420-12425.[Abstract/Free Full Text]
  48. 25
  49. Junqueira-Kipnis, A. P., R. J. Basaraba, V. Gruppo, G. Palanisamy, O. C. Turner, T. Hsu, W. R. Jacobs, Jr., S. A. Fulton, S. M. Reba, W. H. Boom, and I. M. Orme. 2006. Mycobacteria lacking the RD1 region do not induce necrosis in the lungs of mice lacking interferon-gamma. Immunology 119:224-231.[CrossRef][Medline]
  50. 26
  51. Kirby, J. E., J. P. Vogel, H. L. Andrews, and R. R. Isberg. 1998. Evidence for pore-forming ability by Legionella pneumophila. Mol. Microbiol. 27:323-336.[CrossRef][Medline]
  52. 27
  53. McDonough, K. A., Y. Kress, and B. R. Bloom. 1993. Pathogenesis of tuberculosis: interaction of Mycobacterium tuberculosis with macrophages. Infect. Immun. 61:2763-2773.[Abstract/Free Full Text]
  54. 28
  55. McLaughlin, B., J. S. Chon, J. A. MacGurn, F. Carlsson, T. L. Cheng, J. S. Cox, and E. J. Brown. 2007. A mycobacterium ESX-1-secreted virulence factor with unique requirements for export. PLoS Pathog. 3:e105.[CrossRef][Medline]
  56. 29
  57. Menestrina, G., C. Moser, S. Pellet, and R. Welch. 1994. Pore-formation by Escherichia coli hemolysin (HlyA) and other members of the RTX toxins family. Toxicology 87:249-267.[CrossRef][Medline]
  58. 30
  59. Moran, O., O. Zegarra-Moran, C. Virginio, L. Gusmani, and G. D. Rottini. 1992. Physical characterization of the pore forming cytolysine from Gardnerella vaginalis. FEMS Microbiol. Immunol. 5:63-69.[Medline]
  60. 31
  61. Okada, C. Y., and M. Rechsteiner. 1982. Introduction of macromolecules into cultured mammalian cells by osmotic lysis of pinocytic vesicles. Cell 29:33-41.[CrossRef][Medline]
  62. 32
  63. Pathak, S. K., S. Basu, K. K. Basu, A. Banerjee, S. Pathak, A. Bhattacharyya, T. Kaisho, M. Kundu, and J. Basu. 2007. Direct extracellular interaction between the early secreted antigen ESAT-6 of Mycobacterium tuberculosis and TLR2 inhibits TLR signaling in macrophages. Nat. Immunol. 8:610-618.[CrossRef][Medline]
  64. 33
  65. Pym, A. S., P. Brodin, R. Brosch, M. Huerre, and S. T. Cole. 2002. Loss of RD1 contributed to the attenuation of the live tuberculosis vaccines Mycobacterium bovis BCG and Mycobacterium microti. Mol. Microbiol. 46:709-717.[CrossRef][Medline]
  66. 34
  67. Pym, A. S., P. Brodin, L. Majlessi, R. Brosch, C. Demangel, A. Williams, K. E. Griffiths, G. Marchal, C. Leclerc, and S. T. Cole. 2003. Recombinant BCG exporting ESAT-6 confers enhanced protection against tuberculosis. Nat. Med. 9:533-539.[CrossRef][Medline]
  68. 35
  69. Raynaud, C., C. Guilhot, J. Rauzier, Y. Bordat, V. Pelicic, R. Manganelli, I. Smith, B. Gicquel, and M. Jackson. 2002. Phospholipases C are involved in the virulence of Mycobacterium tuberculosis. Mol. Microbiol. 45:203-217.[CrossRef][Medline]
  70. 36
  71. Renshaw, P. S., K. L. Lightbody, V. Veverka, F. W. Muskett, G. Kelly, T. A. Frenkiel, S. V. Gordon, R. G. Hewinson, B. Burke, J. Norman, R. A. Williamson, and M. D. Carr. 2005. Structure and function of the complex formed by the tuberculosis virulence factors CFP-10 and ESAT-6. EMBO J. 24:2491-2498.[CrossRef][Medline]
  72. 37
  73. Renshaw, P. S., P. Panagiotidou, A. Whelan, S. V. Gordon, R. G. Hewinson, R. A. Williamson, and M. D. Carr. 2002. Conclusive evidence that the major T-cell antigens of the Mycobacterium tuberculosis complex ESAT-6 and CFP-10 form a tight, 1:1 complex and characterization of the structural properties of ESAT-6, CFP-10, and the ESAT-6*CFP-10 complex. Implications for pathogenesis and virulence. J. Biol. Chem. 277:21598-21603.[Abstract/Free Full Text]
  74. 38
  75. Roach, T. I., S. E. Slater, L. S. White, X. Zhang, P. W. Majerus, E. J. Brown, and M. L. Thomas. 1998. The protein tyrosine phosphatase SHP-1 regulates integrin-mediated adhesion of macrophages. Curr. Biol. 8:1035-1038.[CrossRef][Medline]
  76. 39
  77. Russell, D. G. 2007. Who puts the tubercle in tuberculosis? Nat. Rev. Microbiol. 5:39-47.[CrossRef][Medline]
  78. 40
  79. Scherrer, R., and P. Gerhardt. 1971. Molecular sieving by the Bacillus megaterium cell wall and protoplast. J. Bacteriol. 107:718-735.[Abstract/Free Full Text]
  80. 41
  81. Schnupf, P., and D. A. Portnoy. 2007. Listeriolysin O: a phagosome-specific lysin. Microbes Infect. 9:1176-1187.[Medline]
  82. 42
  83. Stamm, L. M., J. H. Morisaki, L. Y. Gao, R. L. Jeng, K. L. McDonald, R. Roth, S. Takeshita, J. Heuser, M. D. Welch, and E. J. Brown. 2003. Mycobacterium marinum escapes from phagosomes and is propelled by actin-based motility. J. Exp. Med. 198:1361-1368.[Abstract/Free Full Text]
  84. 43
  85. Stamm, L. M., M. A. Pak, J. H. Morisaki, S. B. Snapper, K. Rottner, S. Lommel, and E. J. Brown. 2005. Role of the WASP family proteins for Mycobacterium marinum actin tail formation. Proc. Natl. Acad. Sci. USA 102:14837-14842.[Abstract/Free Full Text]
  86. 44
  87. Stanley, S. A., S. Raghavan, W. W. Hwang, and J. S. Cox. 2003. Acute infection and macrophage subversion by Mycobacterium tuberculosis require a specialized secretion system. Proc. Natl. Acad. Sci. USA 100:13001-13006.[Abstract/Free Full Text]
  88. 45
  89. Stinear, T. P., T. Seemann, P. F. Harrison, G. A. Jenkin, J. K. Davies, P. D. Johnson, Z. Abdellah, C. Arrowsmith, T. Chillingworth, C. Churcher, K. Clarke, A. Cronin, P. Davis, I. Goodhead, N. Holroyd, K. Jagels, A. Lord, S. Moule, K. Mungall, H. Norbertczak, M. A. Quail, E. Rabbinowitsch, D. Walker, B. White, S. Whitehead, P. L. Small, R. Brosch, L. Ramakrishnan, M. A. Fischbach, J. Parkhill, and S. T. Cole. 2008. Insights from the complete genome sequence of Mycobacterium marinum on the evolution of Mycobacterium tuberculosis. Genome Res. 18:729-741.[Abstract/Free Full Text]
  90. 46
  91. Swaim, L. E., L. E. Connolly, H. E. Volkman, O. Humbert, D. E. Born, and L. Ramakrishnan. 2006. Mycobacterium marinum infection of adult zebrafish causes caseating granulomatous tuberculosis and is moderated by adaptive immunity. Infect. Immun. 74:6108-6117.[Abstract/Free Full Text]
  92. 47
  93. Talaat, A. M., R. Reimschuessel, S. S. Wasserman, and M. Trucksis. 1998. Goldfish, Carassius auratus, a novel animal model for the study of Mycobacterium marinum pathogenesis. Infect. Immun. 66:2938-2942.[Abstract/Free Full Text]
  94. 48
  95. Taunton, J., B. A. Rowning, M. L. Coughlin, M. Wu, R. T. Moon, T. J. Mitchison, and C. A. Larabell. 2000. Actin-dependent propulsion of endosomes and lysosomes by recruitment of N-WASP. J. Cell Biol. 148:519-530.[Abstract/Free Full Text]
  96. 49
  97. van der Wel, N., D. Hava, D. Houben, D. Fluitsma, M. van Zon, J. Pierson, M. Brenner, and P. J. Peters. 2007. M. tuberculosis and M. leprae translocate from the phagolysosome to the cytosol in myeloid cells. Cell 129:1287-1298.[CrossRef][Medline]
  98. 50
  99. Xu, J., O. Laine, M. Masciocchi, J. Manoranjan, J. Smith, S. J. Du, N. Edwards, X. Zhu, C. Fenselau, and L. Y. Gao. 2007. A unique Mycobacterium ESX-1 protein cosecretes with CFP-10/ESAT-6 and is necessary for inhibiting phagosome maturation. Mol. Microbiol. 66:787-800.[Medline]


Infection and Immunity, December 2008, p. 5478-5487, Vol. 76, No. 12
0019-9567/08/$08.00+0     doi:10.1128/IAI.00614-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, J.
Right arrow Articles by Gao, L.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, J.
Right arrow Articles by Gao, L.-Y.