This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iovine, N. M.
Right arrow Articles by Weinrauch, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iovine, N. M.
Right arrow Articles by Weinrauch, Y.

 Previous Article  |  Next Article 

Infection and Immunity, March 2008, p. 986-993, Vol. 76, No. 3
0019-9567/08/$08.00+0     doi:10.1128/IAI.01063-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Reactive Nitrogen Species Contribute to Innate Host Defense against Campylobacter jejuni{triangledown}

Nicole M. Iovine,1,2* Seema Pursnani,2 Alex Voldman,1 Gregory Wasserman,3 Martin J. Blaser,1,2 and Yvette Weinrauch1

Department of Microbiology, New York University School of Medicine, 550 First Avenue, New York, New York 10016,1 Department of Medicine, New York University School of Medicine, 550 First Avenue, New York, New York 10016,2 University of Vermont, 85 South Prospect Street, Burlington, Vermont 054053

Received 1 August 2007/ Returned for modification 4 October 2007/ Accepted 20 December 2007


arrow
ABSTRACT
 
Campylobacter jejuni, a gram-negative, invasive organism, is a common cause of food-borne bacterial diarrheal disease. However, the relationship between C. jejuni and the innate immune system is not well described. To better characterize host defense against C. jejuni, we investigated the ability of nitric oxide/reactive nitrogen species to kill two strains of C. jejuni. C. jejuni viability was measured after exposure to reactive nitrogen species produced biochemically as acidified nitrite and by bone marrow-derived macrophages. We report that acidified nitrite caused a 3-log-increased kill of C. jejuni (P < 0.05) at doses that did not affect the viability of Salmonella enterica serovar Typhimurium. Expression of NOS2, the gene responsible for the production of inducible nitric oxide, was increased >100-fold in murine macrophages after incubation with C. jejuni (P < 0.001). These macrophages effected a 2-log-increased kill of C. jejuni over 24 h compared to that by NOS2–/– macrophages unable to produce nitric oxide (P < 0.05). These findings suggest that the mammalian host upregulates the production of nitric oxide in response to exposure to C. jejuni and that nitric oxide and reactive nitrogen species comprise part of the innate defense mechanisms that contribute to the resolution of C. jejuni infection.


arrow
INTRODUCTION
 
Campylobacter jejuni is a motile, microaerophilic, gram-negative rod (6) and a common cause of food-borne diarrheal disease (9). Within 2 to 4 days after exposure, symptomatic infection is most commonly manifested as malaise, fever, abdominal pain, and diarrhea that can range in severity from loose stools to copious watery or bloody diarrhea (6) and may become persistent in AIDS patients (41). The usual self-limited nature of C. jejuni (6) suggests that innate immune mechanisms may be important in controlling the organism. Despite the large burden of disease imposed by C. jejuni, little is known about its interactions with the host immune system compared to what is known about other common enteric pathogens, such as Salmonella spp.

Reactive nitrogen species (RNS) are a family of antimicrobial molecules derived from nitric oxide (NO·) produced via the enzymatic activity of inducible nitric oxide synthase 2 (NOS2) (19, 38). NOS2 is expressed primarily in macrophages after induction by cytokines and microbial products, notably gamma interferon (IFN-{gamma}) and lipopolysaccharide (LPS) (12, 13, 31). The importance of NO·/RNS in host defense against such pathogens as Mycobacterium tuberculosis, Salmonella enterica, Listeria monocytogenes, coxsackie B3 virus, Toxoplasma gondii, and Leishmania spp. is supported by the increased susceptibility of NOS2–/– mice (33) to infection and/or death from these organisms (19, 38). In humans, a link between NOS2 promoter polymorphisms affecting enzyme expression levels and the development of malaria supports a role for NO·/RNS in resistance to infection (28, 30).

An additional source of NO· and RNS arises from dietary nitrate, which undergoes enterosalivary circulation; from the blood, nitrate is concentrated in the salivary glands, where it is secreted in saliva. Certain bacteria present on the tongue produce nitrate reductases, thereby forming nitrite. After the nitrite is swallowed, NO· forms in the low-pH environment of the stomach. Depending on the amount of dietary nitrate ingested, physiological levels of nitrite reached as high as ~2 mM (4, 14). These amounts of nitrite have been shown to exert an antimicrobial effect against many microorganisms, including Candida spp., Enterobacteriaceae, and Helicobacter pylori. Therefore, the enterosalivary circulation of dietary nitrite may comprise an element of innate host defense against ingested bacteria (4, 15, 16, 35, 66).

The presence of bacterial gene products in the detoxification of nitric oxide, such as globins, cytochrome reductases, and peroxiredoxins in Salmonella spp., Escherichia coli, Erwinia spp., and Mycobacterium spp., among others, suggests that microbes are well served by mechanisms to withstand the antimicrobial activities of NO·/RNS (44). In Campylobacter, the product of an inducible, single-domain globin gene, Cgb, scavenges and detoxifies NO· produced biochemically and by Caco-2 cells (17). A gene involved in electron transport, nrfA, may also function in the protection against nitrosative stress, as mutants exhibited decreased viability when exposed to various NO· donors (43). However, a role for NO·/RNS in the control of C. jejuni infection remains unclear. To test the hypothesis that NO·/RNS effect the killing of virulent C. jejuni, we measured bacterial survival after exposure to biochemically and macrophage-derived NO·/RNS.


arrow
MATERIALS AND METHODS
 
Reagents. Sodium nitrite, gentamicin, Triton X-100, and Shigella flexneri LPS serotype 1a were obtained from Sigma (St. Louis, MO). Campy-Paks, brucella broth, and Luria broth were obtained from Beckton-Dickinson (Sparks, MD). Dulbecco's modified Eagle's medium (DMEM), phosphate-buffered saline (PBS), and a 100x penicillin-streptomycin solution was obtained from Mediatech, Inc. (Herndon, VA). Heat-inactivated fetal bovine serum (FBS) was obtained from Atlanta Biologicals (Norcross, GA), and EDTA was obtained from Biowhittaker (Walkersville, MD). Bacto agar, ACK lysis buffer (0.15 M ammonium chloride, 1 mM potassium bicarbonate, 0.1 mM ethylenediaminetetraacetic acid, pH 7.4), Hanks’ balanced salt solution lacking divalent cations, L-glutamine, sodium pyruvate, nonessential amino acids, mercaptoethanol, and HEPES were obtained from Gibco/Invitrogen (Carlsbad, CA). Amphotericin was obtained from HyClone/Fisher Scientific (Pittsburgh, PA); trimethoprim from MP Biomedicals, Inc./Fisher Scientific; vancomycin from American Pharmaceutical Partners, Inc. (Los Angeles, CA); cefoperazone from Fluka/Sigma Aldrich (St. Louis, MO); and gentamicin sulfate from Sigma Aldrich. Murine IFN-{gamma} was obtained from BD Biosciences/Pharmingen (San Jose, CA).

Bacterial strains and growth conditions. Campylobacter jejuni strain 81-176, a human isolate from an outbreak of milk-borne diarrheal disease (45), has been extensively studied. Experimental inoculation resulted in diarrheal illness in humans (5) and macaques (47), and it has been shown to invade epithelial cells in vitro (21, 27) and in vivo (29, 40, 47, 48, 57, 61). C. jejuni 84-25 was isolated from the cerebrospinal fluid of an apparently immunologically normal infant with meningitis (7). The C. jejuni strains were passaged twice on sheep blood agar plates for 2 days prior to being harvested in brucella broth containing 2 µg/ml amphotericin, 5 µg/ml trimethoprim, 20 µg/ml cefoperazone, and 10 µg/ml vancomycin. The starting optical density at 600 nm was adjusted to 0.1, and growth at 37°C proceeded for 24 h in vented tissue culture-type flasks (Sarstedt, Newton, NC) placed in Campy-Paks to achieve a 10 to 15% CO2 environment. Salmonella enterica serovar Typhimurium strain SL1344 (Salmonella Genetic Stock Center, Calgary, Canada) was grown in Luria broth overnight at 37°C.

Acidified nitrite assay. Bacteria were suspended at 106/ml in brucella broth containing increasing concentrations of sodium nitrite adjusted to pH 7.0 or pH 5.0 (acidified nitrite); the latter pH was used to promote the production of NO·/RNS. The bacterium-nitrite mixtures were incubated for 150 min at 37°C in Campy-Paks, followed by a determination of bacterial survival by enumeration of the CFU on 1.3% brucella agar.

Tissue culture medium. Conditioned medium (complete medium [CM]) from the murine fibroblast cell line L929 (ATCC, Manassas, VA) was generated to provide a source of macrophage colony-stimulating factor to foster the differentiation of bone marrow cell precursors into macrophages (25, 54, 55). Briefly, fibroblasts were cultured in DMEM supplemented with 10% FBS, 10 mM HEPES buffer (pH 7.4), 2 mmol/liter L-glutamine, 1 µmol/liter mercaptoethanol, 0.1 mmol/liter nonessential amino acids, and 1 mmol/liter sodium pyruvate. After the cells reached confluence plus 1 day, the medium was harvested and the 0.2-µm filter sterilized.

The medium used for experiments with the bone marrow-derived macrophages (BMDM) consisted of DMEM supplemented with 10% FBS, 10 mM HEPES buffer (pH 7.4), 2 mmol/liter L-glutamine, 1 mmol/liter sodium pyruvate, and 25% L929 CM. Where indicated below, penicillin-streptomycin at final concentrations of 50 IU/ml penicillin and 50 µg/ml streptomycin was used.

BMDM. Four- to six-week-old C57BL/6 or isogenic NOS2–/– mice unable to produce NO·/RNS (33) (Jackson Laboratory, Bar Harbor, ME) were sacrificed by CO2 narcosis and their femurs and tibias harvested. After removal of the muscle tissue with gauze, the bones were washed in PBS and disinfected with 70% alcohol for 3 min, washed twice with PBS, and transferred into a fresh petri dish containing DMEM. Using sterile instruments, both ends of the bones were cut, and the marrow was flushed out with ~5 ml of DMEM by using a syringe and a 25-gauge, hollow-bore needle. The tissue was suspended by pipetting, passed through a sterile 70-µm nylon mesh to remove bone and other debris, and centrifuged at 650 x g in a swinging bucket rotor (Sorvall rotor 6-98 04 976-006; Fisher, Asheville, NC) for 5 min at room temperature (RT). The pellet was resuspended in 15 ml ACK lysis buffer per mouse for 10 min at RT to lyse erythrocyte precursors, followed by centrifugation. The cell pellet was resuspended in 15 ml DMEM per mouse and centrifuged. The cell pellet was resuspended in CM with antibiotics, adjusted to 4 x 106 cells/ml, and added to 100-mm by 15-mm untreated sterile tissue culture plates (BD Falcon/Fisher Scientific, Pittsburgh, PA) to select for adherent macrophages. Fresh CM with antibiotics was added after 3 days, and the cells were then allowed to expand for 3 days. Cells were harvested on the sixth day by washing them twice with Hanks’ balanced salt solution and adding 10 ml 0.2 mg/ml EDTA per plate for 20 min, followed by gentle scraping to remove tightly adherent cells. The suspension was centrifuged at 650 x g for 5 min, resuspended in DMEM, and then suspended in CM at 3 x 105/ml; 1 ml of the suspension was added to each well of a 24-well plate 36 h before the start of additional experiments. The BMDM approximately doubled from the time of seeding.

The principles outlined in the National Research Council's Guide for the Care and Use of Laboratory Animals (39) were followed, and all studies utilizing mice were reviewed and approved by the New York University Institutional Animal Care and Use Committee.

Gentamicin protection assay. BMDM were stimulated or not stimulated with 10 ng/ml murine IFN-{gamma} and 100 ng/ml LPS for 3 h. The medium was replaced with 900 µl CM, and 100 µl of bacteria diluted to 5 x 106/ml in CM to yield a multiplicity of infection (MOI) of 1:1 was centrifuged onto the monolayer at 500 x g for 10 min with a swinging bucket Sorvall rotor at RT to synchronize infection. Cells and bacteria were cocultured for 60 min in a 5% CO2 incubator at 37°C and then washed once with PBS. To kill extracellular bacteria, the cell-impermeant antibiotic gentamicin at 100 µg/ml in CM was added for 60 min. Next, the medium was aspirated, and the cells were washed once with PBS, followed by lysis with 1% Triton X-100 to yield the 2-h time point result, or alternatively, fresh CM (lacking gentamicin) was added for an additional 22 h, followed by a PBS wash and detergent lysis to yield the 24-h time point result. The viability of C. jejuni was determined by enumeration of the CFU on brucella agar. C. jejuni incubated in CM in the absence of BMDM was included as a control for assessing bacterial viability under tissue culture conditions.

Bacterial binding assay. For the bacterial binding assay, the procedures for the gentamicin protection assay described above were performed except that C. jejuni was cocultured with BMDM for only 1 h prior to a wash with PBS. Fresh CM with or without 100 µg/ml gentamicin was added for 60 min. The cells were washed again with PBS and lysed with 1% Triton X-100. The viability of C. jejuni was determined by enumeration of the CFU on the brucella agar. Since the number of CFU in the samples not treated with gentamicin represents the total number of bacteria associated with the macrophages, subtraction of the number of CFU in the samples treated with gentamicin (representing intracellular bacteria only) yields the number of CFU representative of the bacteria bound to the surfaces of the macrophages.

Determination of macrophage cytotoxicity. At the 24-h time point for the replicate samples of the gentamicin protection assay, the cells were flooded with 1% trypan blue for 10 min at RT, washed once with PBS, and visually inspected via microscopy to determine the number of viable, nonblue cells. At least 100 cells per condition were counted. To quantitate the potentially cytotoxic effects of IFN-LPS treatment and/or bacterial infection, supernatants from the gentamicin protection assay were evaluated for the presence of the cytoplasmic enzyme lactate dehydrogenase (LDH) and the total LDH present after the gentamicin protection assay was compared to the total LDH present after lysis of the macrophages with 1% Triton X-100 using the Cytotox 96 kit (Promega, Madison, WI). The cytotoxicity percentage was calculated as follows: 100 x (LDH in the macrophage supernatant – LDH in medium alone)/(LDH in 1% Triton X-100 lysates). No LDH was detected in medium containing C. jejuni cells alone.

Quantitative reverse transcriptase PCR. CM with or without C. jejuni was centrifuged onto macrophage monolayers at 500 x g for 10 min in a swinging bucket Sorvall rotor at RT to synchronize infection. The cells were incubated for 2 h in a 5% CO2 incubator at 37°C, under one of the following four conditions: (i) 10 ng/ml murine IFN-{gamma} and 100 ng/ml LPS, (ii) C. jejuni 81-176 or 84-25 at an MOI of 100 bacteria to 1 macrophage, (iii) both IFN-{gamma}-LPS and C. jejuni 81-176 or 84-25, or (iv) none of the above. Medium was aspirated and replaced with fresh CM containing 100 µg/ml gentamicin for 1 h. The cells were washed with cold PBS (pH 7.4) and kept on ice during RNA isolation, according to the manufacturer's protocol (Absolutely RNA miniprep kit; Stratagene, La Jolla, CA). For each sample, ~1 µg total RNA measured spectrophotometrically was reverse transcribed into cDNA, according to the manufacturer's instructions (RETROscript; Ambion, Austin, TX). Quantitative PCR was performed using the Rotor Gene 3000 thermal cycler and analyzed using Rotor Gene software version 6.0.14 (Corbett Robotics, San Francisco, CA). Reactions were performed using the FastStart Sybr green master kit (Roche Applied Science, Indianapolis, IN) with 2.5 µl cDNA and NOS2 or GAPDH (glyceraldehyde-3-phosphate dehydrogenase) primers (Invitrogen, Carlsbad, CA) in a final volume of 20 µl. NOS2 primers 5' GCTCATCCGGTACGCTGGCTA and 3' ATGTACCCGTGGCTCTAACCT and GAPDH primers 5' TGTGTCCGTCGTGGATCTGA and 3' AGTTCTTCCACCACTTCGTCC were used at a final concentration of 100 nM each. To calculate the NOS2 primer efficiency, a NOS2 standard curve was prepared using 10x dilutions of purified NOS2 DNA (Ambion, Inc., Austin, TX) to yield input values of 105 to 101 NOS2 DNA copies. To determine the GAPDH primer efficiency, a standard curve for this primer set was created using undiluted cDNA from BMDM not exposed to IFN-{gamma}-LPS or C. jejuni (the negative control [condition iv described above]) and diluted 101-fold, 102-fold, 103-fold, and 104-fold. Primer efficiency and the cycle at which the threshold was reached (CT) were used to calculate the geometric means and standard deviations (SD) of the induction of NOS2 relative to that of BMDM not exposed to IFN-{gamma}-LPS or C. jejuni according to the Pfaffl equation (42) as follows: NOS2 induction = efficiency of the NOS2 primers(CT of the negative control – CT of the sample)/efficiency of the GAPDH primers(CT of the negative control – CT of the sample).

Primer efficiencies averaged 1.73 for NOS2 and 1.92 for GAPDH. All quantitative PCR assays from two independent series of infections were performed at least in triplicate for each of the four conditions. Amplification conditions consisted of an initial incubation at 95°C for 10 min to allow DNA polymerase activation, followed by 40 cycles of 20 s at 94°C to melt the DNA, 30 s at 60°C for primer annealing, and 35 s at 72°C for extension. The protocol was completed by a final elongation time of 5 min at 72°C. Melting curve analysis was performed immediately after amplification at a linear temperature transition rate of 0.1°C/s from 65 to 95°C with continuous fluorescence acquisition. A sample containing all ingredients except a cDNA template was included to control reagent contamination.

Detection of nitrite. The total nitrite present in the macrophage tissue culture supernatants generated from the gentamicin protection assay after 24 h was measured according to the manufacturer's instructions (Assay Designs, Inc., Ann Arbor, MI). Briefly, 50 µl of each sample was added to a 96-well plate, followed by the addition of nitrate reductase to form nitrite from nitrate. Therefore, the total nitrite measured reflects the sum of the nitrate and nitrite produced. Nitrite was detected spectrophotometrically via the Griess reaction and compared to a standard curve. The lower limit of detection was 3.125 µM nitrite. The amount of nitrite in the CM alone (in the absence of macrophages) was minimal and subtracted from all values. No nitrite was detected after the 2-h time point defined in the description of the gentamicin protection assay.

Statistics. Significance, defined as a P of <0.05, was determined by using the unpaired, two-tailed Student t test.


arrow
RESULTS
 
Susceptibility to acidified nitrite. The microaerophilic nature of C. jejuni and its susceptibility to reactive oxygen species (ROS) and oxidative stress (3, 11, 58, 67) suggest that it also might be susceptible to NO·/RNS. To test this possibility, bacterial survival was measured after exposure to increasing concentrations of sodium nitrite. Although sodium nitrite is stable and biologically inert at a neutral pH, an acidic pH allows nitrite to act as an NO· donor and so fosters the production of RNS (acidified nitrite). To compare bacterial strains with potential differences in resistance to NO·/RNS, C. jejuni 81-176, a diarrheal-outbreak strain (45), and C. jejuni 84-25, a systemic isolate from a patient with meningitis (7), were examined. Salmonella enterica serovar Typhimurium strain 1344 also was compared, since its susceptibility to NO·/RNS has been reported (20, 51). Although the same number of bacteria were present for all three strains at the start of the 150-min experiment, the doubling time of S. enterica serovar Typhimurium (~20 min) compared to that of C. jejuni (~120 min) resulted in the ~10-fold-more S. enterica serovar Typhimurium shown on the y axes in Fig. 1.


Figure 1
View larger version (11K):
[in this window]
[in a new window]

 
FIG. 1. C. jejuni is susceptible to killing by acidified nitrite. C. jejuni (CJ) 81-176, C. jejuni 84-25, and S. enterica serovar Typhimurium (ST) 1344 were grown to the late log phase, diluted to 106/ml in brucella broth adjusted to pH 5.0 (A) or 7.0 (B), and incubated with increasing doses of sodium nitrite (NaNO2) for 150 min at 37°C. Viability is shown as numbers of CFU per ml. The data shown for C. jejuni 81-176 are the means ± SD from six experiments performed in duplicate or triplicate; for C. jejuni 84-25 and S. enterica serovar Typhimurium, the data shown are the means from two experiments performed in triplicate. *, P was <0.05 in a comparison with strain 81-176.

In the absence of nitrite, exposure to pH 5 alone for 150 min resulted in an ~0.5-log-increased killing of all strains under the experimental conditions used (0 mM NaNO2 in Fig. 1A versus Fig. 1B). However, under acidic conditions, which promote the production of NO· (14), sodium nitrite decreased the viability of both C. jejuni strains in a dose-dependent fashion, while S. enterica serovar Typhimurium was much less affected (Fig. 1A). There also was a marked difference in the susceptibilities of the two C. jejuni strains, with 81-176 showing an ~3-log-greater level of sensitivity than the systemic strain 84-25. At a neutral pH, all three strains survived similarly for all doses of sodium nitrite (Fig. 1B), which is consistent with the inability of sodium nitrite to act as a NO· donor at a neutral pH. These results indicate that physiologic doses of acidified nitrite (i.e., 1.6 mM) (4) are effective in killing C. jejuni in a strain-specific manner.

Macrophage-derived NO·/RNS effects the killing of C. jejuni. Having shown that C. jejuni is susceptible to killing by RNS generated from sodium nitrite (Fig. 1), the ability of macrophage-derived RNS to kill C. jejuni was determined. The survival of C. jejuni strains 81-176 and 84-25 after a 2- or 24-h coculture with wild-type or NOS2–/– macrophages was determined using the gentamicin protection assay. Since earlier experiments showed that MOIs of 100:1 and 10:1 led to significant macrophage cell death after a 24-h coculture (data not shown), the MOI was reduced to 1:1. Incubation of C. jejuni under tissue culture conditions in the absence of macrophages showed full viability under the experimental conditions used (data not shown).

Two hours after ingestion by wild-type, IFN-{gamma}-LPS-stimulated macrophages, an ~1-log-increased killing of C. jejuni strain 81-176 was observed compared to that by the unstimulated wild-type macrophages (P < 0.05) (Fig. 2A). There was no killing by NOS2–/– macrophages, regardless of stimulation. After 24 h of coculture, an ~2-log-increased killing by the IFN-{gamma}-LPS-stimulated wild-type macrophages was observed (Fig. 2B) compared to that of the unstimulated macrophages (P < 0.01). There was little change in C. jejuni recovery from unstimulated wild-type macrophages from that from the 2-h cocultures. Again, there was no killing by the NOS2–/– macrophages, regardless of stimulation (Fig. 2B).


Figure 2
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 2. C. jejuni is efficiently killed by wild-type macrophages induced to produce NO·/RNS. C. jejuni 81-176 (A and B) and 84-25 (C and D) were cocultured at an MOI of 1:1 with macrophages pretreated with IFN-{gamma} and LPS or not treated for 3 h prior to the addition of bacteria, and the surviving bacteria were enumerated in the gentamicin protection assay after 2 h (A and C) or 24 h (B and D). The data shown in panels A and B are the means ± standard errors of the means from three experiments performed in duplicate or triplicate; panels C and D show the means ± standard errors of the means from two experiments performed in triplicate. WT, wild-type macrophages; KO, knockout macrophages; *, P was <0.05 in a comparison of results for WT macrophages without IFN-LPS and NOS2–/– macrophages with and without IFN-LPS; {dagger}, P was <0.01 in a comparison of results for the 2-h cocultured WT macrophages with and without IFN-LPS.

There was little or no killing of the systemic strain 84-25 after 2 h of coculture with wild-type or NOS2–/– macrophages, regardless of IFN-{gamma}-LPS stimulation (Fig. 2C). However, after a 24-h coculture with wild-type IFN-{gamma}-LPS-stimulated macrophages, an ~1-log-increased killing was observed compared to that by the unstimulated cells and an ~2-log-increased killing was observed compared to that at the 2-h time point (P < 0.01). After 24 h, a 1-log-increased reduction in viability was observed with the unstimulated wild-type macrophages and with the NOS2–/– macrophages, regardless of IFN-{gamma}-LPS stimulation, suggesting NO·-independent bacterial killing of this strain (P < 0.05) (Fig. 2D). In summary, both the diarrheal and systemic C. jejuni strains were efficiently killed by IFN-{gamma}-LPS-stimulated wild-type macrophages after 24 h of coculture in an NO·/RNS-dependent manner. In contrast, the systemic strain 84-25 was susceptible to NO·-independent killing, a phenomenon not observed with the diarrheal strain 81-176.

C. jejuni strains bind similarly to macrophages. Whereas ~20% of the input C. jejuni 81-176 bacteria were recovered from the unstimulated wild-type and all NOS2–/– macrophages after 2 h of coculture, only 2% of the input C. jejuni 84-25 bacteria were similarly recovered. To determine whether these differences were due to differential macrophage-bacterium surface interactions between the two strains, we measured the binding of the bacteria to macrophages after 1 hour of coculture. The numbers of bacterial CFU of C. jejuni 81-176 or 84-25 recovered from the macrophages subsequently treated with gentamicin for 1 hour, reflecting intracellular bacteria, were compared to those recovered from macrophages not exposed to gentamicin, reflecting both surface-bound and intracellular bacteria. There were no significant differences in the numbers of recovered CFU, regardless of the C. jejuni strain, macrophage exposure to IFN-{gamma}-LPS, or exposure to gentamicin (data not shown). These results suggest that both C. jejuni strains interacted with the macrophage surfaces to similar extents and that the exposure of macrophages to IFN-{gamma}-LPS did not alter the macrophages in ways that affected C. jejuni binding.

Macrophages survive infection with C. jejuni. Several pathways leading to macrophage cell death are triggered after macrophage exposure to IFN-{gamma} (50), LPS (49, 64), and certain pathogens, including Salmonella (8, 10, 37, 62), Yersinia (46), and Shigella (56) and C. jejuni itself (52). To determine the effect of C. jejuni coculture on macrophage survival in our system, cells were inspected by microscopy after the addition of the vital dye trypan blue. More than 90% of the cells excluded trypan blue under all conditions tested (medium alone, IFN-{gamma}-LPS alone, C. jejuni alone, and IFN-{gamma}-LPS plus C. jejuni), indicating no substantial loss of macrophage viability (data not shown). To confirm these results and quantitate the amount of cell death, release of the intracellular enzyme LDH into the supernatants was examined. We studied the yields of LDH after the incubation of macrophages for 24 h with medium alone, C. jejuni 81-176 or 84-25 at an MOI of 1:1, IFN-{gamma}-LPS, or both C. jejuni and IFN-{gamma}-LPS and compared them to the total LDH obtained after detergent lysis of the macrophages. A culture of C. jejuni 81-176 or 84-25 in the absence of macrophages did not yield detectable LDH, and under all conditions tested with both C. jejuni strains, <10% of the total LDH was released into the supernatants (data not shown). Similar results were obtained after 2 h of coculture with C. jejuni. Thus, >90% of the macrophages remained viable under all conditions tested, indicating that macrophage cell death did not interfere with subsequent assays.

C. jejuni induces NOS2 expression in macrophages. NOS2 expression in macrophages is transcriptionally regulated by inflammatory mediators, principally IFN-{gamma} and LPS (60, 65). C. jejuni-mediated induction of NOS2 from an avian kidney cell line and a macrophage-like cell line (HD11 cells) has been reported (53). To determine whether C. jejuni would similarly induce NOS2 expression in mammalian cells, we performed quantitative PCR using macrophages from wild-type C57BL/6 mice incubated with C. jejuni and/or IFN-LPS or mock treated. Although the large doses of IFN-{gamma}-LPS used reliably triggered NOS2 induction at early time points, no induction was found at any time point using C. jejuni alone at an MOI of 1:1 (data not shown). This finding indicates that macrophages might kill low numbers of C. jejuni mainly by using the constitutive antimicrobial systems at their disposal (i.e., ROS and defensins, etc.) (24) and/or that the bacteria are killed too rapidly for NOS2 induction to occur. Furthermore, given the relative insensitivity of the Griess assay, either a long incubation time is necessary to permit the accumulation of a detectable quantity of nitrate or the magnitude of the stimulus (IFN-{gamma}, LPS, or the bacterial load) must be increased if shorter measurement periods are desired. Since NOS2 induction is likely to be temporally restricted (22, 23, 60) and because others have used higher MOIs to measure NOS2 induction (53), we chose to increase the MOI to determine whether C. jejuni affected the expression of NOS2. Therefore, an MOI of 100:1 was used and total macrophage RNA was harvested 3 h after exposure to C. jejuni and/or IFN-{gamma}-LPS for use as a template in a subsequent quantitative reverse transcriptase PCR. IFN-LPS increased NOS2 expression ~5,000-fold relative to that in unstimulated, uninfected macrophages (Fig. 3). Coculture with C. jejuni 81-176 or 84-25 alone also triggered a substantial (500-fold) increase in NOS2 expression. Macrophages exposed to both C. jejuni and IFN-LPS showed levels of NOS2 induction similar to that triggered by IFN-{gamma}-LPS alone, suggesting that these amounts of IFN-{gamma}-LPS already maximally stimulated NOS2 expression. Under all conditions, macrophage cell death was <15%, as determined by LDH release (data not shown). This provides the first evidence that when C. jejuni is present in large numbers, the expression of NOS2 is triggered in macrophages.


Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 3. C. jejuni (CJ) induces NOS2 expression in macrophages. Wild-type BMDM stimulated with 10 ng/ml IFN-{gamma} and 100 ng/ml LPS or not stimulated were incubated at an MOI of 100:1 with C. jejuni 81-176, C. jejuni 84-25, or medium alone for 2 h, followed by the replacement of the medium containing 100 µg/ml gentamicin for 1 h. NOS2 induction was normalized to GAPDH expression and is expressed relative to NOS2 expression in BMDM neither stimulated with IFN-{gamma}-LPS nor infected with C. jejuni by using the Pfaffl equation. For 81-176, the data shown are the geometric means + SD from five experiments performed in duplicate or triplicate, yielding at least 11 independent samples; for 84-25, the data shown are the geometric means + SD from three experiments performed in duplicate or triplicate, yielding at least seven independent samples. *, P was <0.001 in a comparison with unstimulated, uninfected macrophages; {dagger}, P was <0.05 in a comparison with C. jejuni 81-176 without IFN-{gamma}-LPS.

Production of nitrate/nitrite from macrophages. To correlate NOS2 gene induction (Fig. 3) with the production of RNS and to provide a mechanism that explains how IFN-{gamma}-LPS-stimulated wild-type macrophages efficiently killed C. jejuni (Fig. 2), we next measured the levels of macrophage production of nitrate/nitrite, stable end products of NO metabolism. Nitrate/nitrite was not detected in the supernatants of C. jejuni-macrophage cocultures after 3 h at an MOI of 100:1, as this was presumably not sufficient time to allow the accumulation of a detectable level of nitrate/nitrite, but longer incubation times at this high MOI led to significant macrophage cytotoxicity (data not shown). Therefore, the supernatants generated in the gentamicin protection assay at an MOI of 1:1 (Fig. 2) and harvested after 24 h were assayed for the presence of nitrate/nitrite, since we reasoned that this would allow enough time for the accumulation of detectable levels of nitrate/nitrite.

No nitrate/nitrite was detected from the NOS2–/– macrophages or from C. jejuni when cultured in the absence of macrophages (data not shown). In the absence of IFN-{gamma}-LPS or C. jejuni, little nitrate/nitrite was detected from macrophages (Fig. 4). The addition of C. jejuni alone to the macrophages triggered a low level of production of nitrate/nitrite (P was <0.05 in a comparison with production in the unstimulated macrophages). Macrophages stimulated with IFN-{gamma}-LPS alone produced high levels of nitrate/nitrite, and nitrite production was potentiated when macrophages were prestimulated with IFN-{gamma}-LPS and then infected with C. jejuni. These findings are in concert with the quantitative PCR data and suggest that NOS2 induction triggered by C. jejuni results in RNS production.


Figure 4
View larger version (8K):
[in this window]
[in a new window]

 
FIG. 4. C. jejuni (CJ) augments RNS production from IFN-LPS-stimulated macrophages. Wild-type macrophages were incubated in medium without IFN-{gamma}-LPS or with IFN-{gamma}-LPS and infected with C. jejuni 81-176 at an MOI of 1:1 or not infected, as described in the legend to Fig. 2B and D. Total nitrite in the supernatant was detected via the Griess reaction after reduction of the nitrite to nitrate. Data shown are the means + SD from two experiments performed in triplicate. *, P was <0.05 in a comparison with unstimulated, uninfected macrophages.


arrow
DISCUSSION
 
C. jejuni usually causes illness within 72 h of ingestion, and symptoms generally resolve after several days (6). Since the clinical manifestations usually resolve before an adaptive immune response can be mounted, the interaction with the innate immune system must be determinative. As such, we need a better understanding of the components of innate immunity that effect the clearance of C. jejuni. The aim of our studies was to determine whether C. jejuni was susceptible to killing by NO·/RNS produced by mammalian cells involved in innate immunity. We examined a diarrheal-outbreak strain (strain 81-176) that is likely typical of the C. jejuni strains that cause the most disease in humans and are known to be virulent in experimentally challenged macaques (47) and humans (5) and a systemic strain from an apparently immunologically normal patient who developed C. jejuni meningitis (strain 84-25); our aim was to determine whether these phenotypically dissimilar strains would reveal different interactions with the nitrosative arm of molecular innate defenses. For example, the substantial serum resistance of the systemic C. jejuni strain 84-25 compared to that of the diarrheal strain 81-176 may imply that differences in the surface properties of these strains also might underlie the observed difference in acidified nitrite susceptibility. Since NO· is a small, uncharged molecule, capsules or lipooligosaccharides are unlikely to be barriers to diffusion or to cause biologically important steric hindrance, although this may not be true for other RNS. Alternatively, bacterial surface structures could participate in nonspecific scavenging via interactions with thiol groups on outer membrane proteins (20).

Both C. jejuni strains were more sensitive to killing by acidified nitrite than S. enterica serovar Typhimurium, used as an example of another common etiologic agent of bacterial intestinal disease (Fig. 1). This result underscores the potential importance of stomach-derived acidified nitrite as an important host defense (4, 15, 16, 35, 66) against C. jejuni. The greater acidified nitrite resistance of the systemic strain 84-25 relative to that of the diarrheal strain 81-176 (Fig. 1) might contribute to strain 84-25's ability to cause systemic infection rather than remaining confined to the intestinal tract, although it is likely that other strain differences also contribute to the two disease phenotypes.

To determine how RNS generated in the context of an intact cell would affect the two C. jejuni strains, levels of bacterial survival after ingestion by murine macrophages were compared. Salmonella was not compared in this assay due to its propensity to induce macrophage apoptosis (37). In contrast to the divergent results in the acidified nitrite assay, both C. jejuni strains were efficiently killed after 24 h of exposure to macrophages that were induced to produce RNS (Fig. 2). This finding provides evidence that macrophage production of RNS contributes to the innate host defense against C. jejuni infection.

The differing results with strain 84-25 in the acidified nitrite assay versus the bioassay could be due to differences in RNS production between the two assays. For example, macrophage production of other molecular defenses, such as ROS, with which RNS can synergize (19, 38), would lead to more-effective bacterial killing than expected with acidified nitrite alone. The contribution of the NO·-independent mechanism(s) to the killing of C. jejuni is supported by the 1-log-unit reduction in the viability of the systemic strain 84-25 when incubated for 2 to 24 h with unstimulated wild-type macrophages or with NOS2–/– macrophages, regardless of their exposure to IFN-{gamma}-LPS (Fig. 2C and D). However, C. jejuni organisms not killed by the NO·-independent mechanism(s), such as ROS, may nonetheless suffer sublethal damage that is amplified when NO·/RNS are later produced (19, 32, 34, 38, 59). These results indicate that NO·/RNS as well as NO·-independent antimicrobial mechanisms are important in restricting the growth and survival of the systemic strain 84-25 in infected macrophages and suggest that NO·/RNS provide long-lived antimicrobial activity compared to that of potentially temporally restricted host defenses such as ROS (19, 38).

Unlike with the contribution of the NO·-independent mechanism(s) to the killing of the systemic strain 84-25, no difference in viability of diarrheal-strain 81-176 was observed in unstimulated wild-type and NOS2–/– macrophages. Along with the different susceptibilities to acidified nitrite between the two strains, this result provides further evidence that these strains have differing susceptibilities to the various components of host defense. However, the lack of significant differences in binding of the two strains to macrophages suggests that at least their initial interactions with these cells may be similar and that cells of both C. jejuni strains are rapidly internalized after encountering the macrophage surface. Although it remains unknown whether opsonins would alter the initial interactions between bacteria and macrophages, events subsequent to the binding and ingestion of bacteria by macrophages may underlie the differing intracellular survival rates of these two strains.

NO·/RNS have widely divergent chemistries and half-lives, implying that any one assay will detect only a portion of the total RNS produced. Consequently, it is convenient to measure nitrite, a relatively stable RNS, via the Griess reaction. However, the Griess reaction measures only this particular RNS and requires relatively large (micromolar) amounts. Therefore, lower but biologically important nitrite concentrations as well as other RNS produced by macrophages go undetected by this method. This may explain our inability to detect nitrite in macrophage supernatants in the 2 h after infection with C. jejuni (data not shown), despite a clear difference in NO·-dependent killing of the diarrheal strain (Fig. 2A). In this scenario, the lack of killing of the systemic C. jejuni strain 84-25 at this early, 2-h time point (Fig. 2C) is consistent with the acidified nitrite results (Fig. 1) showing the relative resistance of the systemic strain to nitrosative stress.

Gram-negative organisms such as S. enterica serovar Typhimurium induce NOS2 expression in macrophages (18) via flagellin/Toll-like receptor 5 (TLR5) and LPS/TLR4 pathways that lead to Nf-{kappa}B activation (26, 36). We report for the first time that C. jejuni alone also increases NOS2 expression in macrophages (Fig. 3). Our finding that a low MOI (1:1) did not trigger NOS2 expression in macrophages suggests two possibilities that are not mutually exclusive: (i) these low numbers of bacteria were killed rapidly by the constitutively active antimicrobial mechanisms, such as ROS, defensins, and proteases, such that the amount of time and strength of the stimulus for NOS2 induction was insufficient, and/or (ii) the host restricts the production of NO·/RNS, molecules that also may injure host tissues, to situations where the bacterial burden is considerable. Since C. jejuni flagellin is known not to trigger signaling through TLR5 (2, 63), other microbe-associated molecules, such as LPS, are implicated. Although NOS2 activation has been reported to trigger apoptosis in macrophages (1, 49), as has C. jejuni itself (in THP-1 cells) (52), under the conditions of the gentamicin protection assay at both low and high MOIs (1:1 and 100:1), BMDM were >90% and 85% viable, respectively. These findings suggest that the host might upregulate NOS2 expression when confronted with a large inoculum of C. jejuni. Although it was not possible to directly compare NOS2 expression to nitrate/nitrite production, as it was necessary to use different experimental conditions, the results are mutually consistent. Together, these findings support the notion that in an in vivo inflammatory setting where IFN-{gamma}-LPS and other potential inducers of NOS2 are expected to be present along with C. jejuni, the resulting enhanced production of NO·/RNS contributes to an effective host defense against C. jejuni infection.

In conclusion, we show that both of the two strains of C. jejuni with distinct disease manifestations were susceptible to killing by NO·/RNS. Macrophages upregulated NOS2 expression in response to C. jejuni, which promotes increased RNS production. Macrophages able to produce NO·/RNS efficiently killed both C. jejuni strains over a 24-h period, although with differing kinetics. The relative resistance of the meningitis strain 84-25 to NO·/RNS-based killing may contribute to its apparently increased virulence and systemic disease manifestations. Whether this relative resistance is due to differential expression of cgb (17), nrfA (43), or other undescribed genes involved in resistance to nitrosative stress is unknown. In addition, the possibility that NO·/RNS also might serve a signaling function to marshal other antimicrobial defenses should be considered. Taken together, these data suggest that the host employs a NOS2-dependent mechanism to control C. jejuni and provides a basis for understanding the self-limited nature of C. jejuni infection.


arrow
ACKNOWLEDGMENTS
 
This work was supported by National Research Service Award Training Grant 5 T32 AI07180-24, Mentored Clinical Scientist Grant 5K08AI065676 from the National Institutes of Health, and the Michael Saperstein Medical Scholars Research Fund.

We thank Robert Holzman for statistical advice.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: New York University School of Medicine at the Veteran's Administration Medical Center, 423 East 23rd St., Room 6005AW, New York, NY 10010. Phone: (212) 263-4239. Fax: (212) 263-4108. E-mail: iovinn01{at}med.nyu.edu Back

{triangledown} Published ahead of print on 3 January 2008. Back

Editor: V. J. DiRita


arrow
REFERENCES
 
    1
  1. Albina, J. E., S. Cui, R. B. Mateo, and J. S. Reichner. 1993. Nitric oxide-mediated apoptosis in murine peritoneal macrophages. J. Immunol. 150:5080-5085.[Abstract]
  2. 2
  3. Andersen-Nissen, E., K. D. Smith, K. L. Strobe, S. L. Barrett, B. T. Cookson, S. M. Logan, and A. Aderem. 2005. Evasion of Toll-like receptor 5 by flagellated bacteria. Proc. Natl. Acad. Sci. USA 102:9247-9252.[Abstract/Free Full Text]
  4. 3
  5. Baillon, M.-L. A., A. H. M. van Vliet, J. M. Ketley, C. Constantinidou, and C. W. Penn. 1999. An iron-regulated alkyl hydroperoxide reductase (AhpC) confers aerotolerance and oxidative stress resistance to the microaerophilic pathogen Campylobacter jejuni. J. Bacteriol. 181:4798-4804.[Abstract/Free Full Text]
  6. 4
  7. Benjamin, N., F. O'Driscoll, H. Dougall, C. Duncan, L. Smith, M. Golden, and H. McKenzie. 1994. Stomach NO synthesis. Nature 368:502.[Medline]
  8. 5
  9. Black, R. E., M. M. Levine, M. L. Clements, T. P. Hughes, and M. J. Blaser. 1988. Experimental Campylobacter jejuni infection in humans. J. Infect. Dis. 157:472-479.[Medline]
  10. 6
  11. Blaser, M., and B. M. Allos. 2005. Campylobacter and related species, p. 2548-2556. In G. Mandell, J. E. Bennett, and R. Dolin (ed.), Mandell, Douglas and Bennett's principles and practice of infectious diseases, 6th ed., vol. 2. Elsevier Churchill Livingstone, Philadelphia, PA.
  12. 7
  13. Blaser, M. J., G. P. Perez, P. F. Smith, C. Patton, F. C. Tenover, A. J. Lastovica, and W. I. Wang. 1986. Extraintestinal Campylobacter jejuni and Campylobacter coli infections: host factors and strain characteristics. J. Infect. Dis. 153:552-559.[Medline]
  14. 8
  15. Brennan, M. A., and B. T. Cookson. 2000. Salmonella induces macrophage death by caspase-1-dependent necrosis. Mol. Microbiol. 38:31-40.[CrossRef][Medline]
  16. 9
  17. Centers for Disease Control and Prevention. 2006. Preliminary FoodNet data on the incidence of infection with pathogens transmitted commonly through food—10 States, United States, 2005. Morb. Mortal. Wkly. Rep. 55:392-395.[Medline]
  18. 10
  19. Chen, L. M., K. Kaniga, and J. E. Galan. 1996. Salmonella spp. are cytotoxic for cultured macrophages. Mol. Microbiol. 21:1101-1115.[CrossRef][Medline]
  20. 11
  21. Day, W. A., Jr., J. L. Sajecki, T. M. Pitts, and L. A. Joens. 2000. Role of catalase in Campylobacter jejuni intracellular survival. Infect. Immun. 68:6337-6345.[Abstract/Free Full Text]
  22. 12
  23. Ding, A. H., C. F. Nathan, and D. J. Stuehr. 1988. Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of activating cytokines and evidence for independent production. J. Immunol. 141:2407-2412.[Abstract]
  24. 13
  25. Drapier, J. C., J. Wietzerbin, and J. B. Hibbs, Jr. 1988. Interferon-gamma and tumor necrosis factor induce the L-arginine-dependent cytotoxic effector mechanism in murine macrophages. Eur. J. Immunol. 18:1587-1592.[Medline]
  26. 14
  27. Duncan, C., H. Dougall, P. Johnston, S. Green, R. Brogan, C. Leifert, L. Smith, M. Golden, and N. Benjamin. 1995. Chemical generation of nitric oxide in the mouth from the enterosalivary circulation of dietary nitrate. Nat. Med. 1:546-551.[CrossRef][Medline]
  28. 15
  29. Dykhuizen, R. S., A. Fraser, H. McKenzie, M. Golden, C. Leifert, and N. Benjamin. 1998. Helicobacter pylori is killed by nitrite under acidic conditions. Gut 42:334-337.[Abstract/Free Full Text]
  30. 16
  31. Dykhuizen, R. S., R. Frazer, C. Duncan, C. C. Smith, M. Golden, N. Benjamin, and C. Leifert. 1996. Antimicrobial effect of acidified nitrite on gut pathogens: importance of dietary nitrate in host defense. Antimicrob. Agents Chemother. 40:1422-1425.[Abstract]
  32. 17
  33. Elvers, K. T., G. Wu, N. J. Gilberthorpe, R. K. Poole, and S. F. Park. 2004. Role of an inducible single-domain hemoglobin in mediating resistance to nitric oxide and nitrosative stress in Campylobacter jejuni and Campylobacter coli. J. Bacteriol. 186:5332-5341.[Abstract/Free Full Text]
  34. 18
  35. Eriksson, S., J. Bjorkman, S. Borg, A. Syk, S. Pettersson, D. I. Andersson, and M. Rhen. 2000. Salmonella typhimurium mutants that downregulate phagocyte nitric oxide production. Cell. Microbiol. 2:239-250.[CrossRef][Medline]
  36. 19
  37. Fang, F. C. 2004. Antimicrobial reactive oxygen and nitrogen species: concepts and controversies. Nat. Rev. Microbiol. 2:820-832.[CrossRef][Medline]
  38. 20
  39. Fang, F. C. 1997. Perspectives series: host/pathogen interactions. Mechanisms of nitric oxide-related antimicrobial activity. J. Clin. Investig. 99:2818-2825.[Medline]
  40. 21
  41. Friis, L. M., C. Pin, B. M. Pearson, and J. M. Wells. 2005. In vitro cell culture methods for investigating Campylobacter invasion mechanisms. J. Microbiol. Methods 61:145-160.[CrossRef][Medline]
  42. 22
  43. Geller, D. A., C. J. Lowenstein, R. A. Shapiro, A. K. Nussler, M. Di Silvio, S. C. Wang, D. K. Nakayama, R. L. Simmons, S. H. Snyder, and T. R. Billiar. 1993. Molecular cloning and expression of inducible nitric oxide synthase from human hepatocytes. Proc. Natl. Acad. Sci. USA 90:3491-3495.[Abstract/Free Full Text]
  44. 23
  45. Geller, D. A., A. K. Nussler, M. Di Silvio, C. J. Lowenstein, R. A. Shapiro, S. C. Wang, R. L. Simmons, and T. R. Billiar. 1993. Cytokines, endotoxin, and glucocorticoids regulate the expression of inducible nitric oxide synthase in hepatocytes. Proc. Natl. Acad. Sci. USA 90:522-526.[Abstract/Free Full Text]
  46. 24
  47. Gordon, S. 1999. Development and distribution of mononuclear phagocytes: relevance to inflammation, p. 39-46. In J. I. Gallin and R. Snyderman (ed.), Inflammation: basic principles and clinical correlates, 3rd ed. Lippincott, Williams and Wilkins, Philadelphia, PA.
  48. 25
  49. Havredaki, M., and T. A. McNeill. 1975. The effect of interferon inducers on colony stimulating factor production in L cell cultures. J. Gen. Virol. 27:107-110.[Abstract/Free Full Text]
  50. 26
  51. Kim, Y. M., B. S. Lee, K. Y. Yi, and S. G. Paik. 1997. Upstream NF-kappaB site is required for the maximal expression of mouse inducible nitric oxide synthase gene in interferon-gamma plus lipopolysaccharide-induced RAW 264.7 macrophages. Biochem. Biophys. Res. Commun. 236:655-660.[CrossRef][Medline]
  52. 27
  53. Kopecko, D. J., L. Hu, and K. J. Zaal. 2001. Campylobacter jejuni—microtubule-dependent invasion. Trends Microbiol. 9:389-396.[CrossRef][Medline]
  54. 28
  55. Kun, J. F., B. Mordmuller, B. Lell, L. G. Lehman, D. Luckner, and P. G. Kremsner. 1998. Polymorphism in promoter region of inducible nitric oxide synthase gene and protection against malaria. Lancet 351:265-266.[CrossRef][Medline]
  56. 29
  57. Lambert, M. E., P. F. Schofield, A. G. Ironside, and B. K. Mandal. 1979. Campylobacter colitis. Br. Med. J. 1:857-859.[Abstract/Free Full Text]
  58. 30
  59. Levesque, M. C., M. R. Hobbs, N. M. Anstey, T. N. Vaughn, J. A. Chancellor, A. Pole, D. J. Perkins, M. A. Misukonis, S. J. Chanock, D. L. Granger, and J. B. Weinberg. 1999. Nitric oxide synthase type 2 promoter polymorphisms, nitric oxide production, and disease severity in Tanzanian children with malaria. J. Infect. Dis. 180:1994-2002.[CrossRef][Medline]
  60. 31
  61. Lyons, C. R., G. J. Orloff, and J. M. Cunningham. 1992. Molecular cloning and functional expression of an inducible nitric oxide synthase from a murine macrophage cell line. J. Biol. Chem. 267:6370-6374.[Abstract/Free Full Text]
  62. 32
  63. MacMicking, J., Q. W. Xie, and C. Nathan. 1997. Nitric oxide and macrophage function. Annu. Rev. Immunol. 15:323-350.[CrossRef][Medline]
  64. 33
  65. MacMicking, J. D., C. Nathan, G. Hom, N. Chartrain, D. S. Fletcher, M. Trumbauer, K. Stevens, Q. W. Xie, K. Sokol, N. Hutchinson, et al. 1995. Altered responses to bacterial infection and endotoxic shock in mice lacking inducible nitric oxide synthase. Cell 81:641-650.[CrossRef][Medline]
  66. 34
  67. Mastroeni, P., A. Vazquez-Torres, F. C. Fang, Y. Xu, S. Khan, C. E. Hormaeche, and G. Dougan. 2000. Antimicrobial actions of the NADPH phagocyte oxidase and inducible nitric oxide synthase in experimental salmonellosis. II. Effects on microbial proliferation and host survival in vivo. J. Exp. Med. 192:237-248.[Abstract/Free Full Text]
  68. 35
  69. McKnight, G. M., C. W. Duncan, C. Leifert, and M. H. Golden. 1999. Dietary nitrate in man: friend or foe? Br. J. Nutr. 81:349-358.[Medline]
  70. 36
  71. Mizel, S. B., A. N. Honko, M. A. Moors, P. S. Smith, and A. P. West. 2003. Induction of macrophage nitric oxide production by Gram-negative flagellin involves signaling via heteromeric Toll-like receptor 5/Toll-like receptor 4 complexes. J. Immunol. 170:6217-6223.[Abstract/Free Full Text]
  72. 37
  73. Monack, D. M., B. Raupach, A. E. Hromockyj, and S. Falkow. 1996. Salmonella typhimurium invasion induces apoptosis in infected macrophages. Proc. Natl. Acad. Sci. USA 93:9833-9838.[Abstract/Free Full Text]
  74. 38
  75. Nathan, C., and M. U. Shiloh. 2000. Reactive oxygen and nitrogen intermediates in the relationship between mammalian hosts and microbial pathogens. Proc. Natl. Acad. Sci. USA 97:8841-8848.[Abstract/Free Full Text]
  76. 39
  77. National Research Council. 1996. Guide for the care and use of laboratory animals. National Academy Press, Washington, DC.
  78. 40
  79. Newell, D. G., and A. Pearson. 1984. The invasion of epithelial cell lines and the intestinal epithelium of infant mice by Campylobacter jejuni/coli. J. Diarrhoeal Dis. Res. 2:19-26.[Medline]
  80. 41
  81. Perlman, D. M., N. M. Ampel, R. B. Schifman, D. L. Cohn, C. M. Patton, M. L. Aguirre, W. L. Wang, and M. J. Blaser. 1988. Persistent Campylobacter jejuni infections in patients infected with the human immunodeficiency virus (HIV). Ann. Intern. Med. 108:540-546.[Abstract/Free Full Text]
  82. 42
  83. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45.[Abstract/Free Full Text]
  84. 43
  85. Pittman, M. S., K. T. Elvers, L. Lee, M. A. Jones, R. K. Poole, S. F. Park, and D. J. Kelly. 2007. Growth of Campylobacter jejuni on nitrate and nitrite: electron transport to NapA and NrfA via NrfH and distinct roles for NrfA and the globin Cgb in protection against nitrosative stress. Mol. Microbiol. 63:575-590.[CrossRef][Medline]
  86. 44
  87. Poole, R. K. 2005. Nitric oxide and nitrosative stress tolerance in bacteria. Biochem. Soc. Trans. 33:176-180.[CrossRef][Medline]
  88. 45
  89. Robinson, D. A., and D. M. Jones. 1981. Milk-borne campylobacter infection. Br. Med. J. (Clin. Res. Ed.) 282:1374-1376.[Medline]
  90. 46
  91. Ruckdeschel, K., A. Roggenkamp, V. Lafont, P. Mangeat, J. Heesemann, and B. Rouot. 1997. Interaction of Yersinia enterocolitica with macrophages leads to macrophage cell death through apoptosis. Infect. Immun. 65:4813-4821.[Abstract]
  92. 47
  93. Russell, R. G., M. J. Blaser, J. I. Sarmiento, and J. Fox. 1989. Experimental Campylobacter jejuni infection in Macaca nemestrina. Infect. Immun. 57:1438-1444.[Abstract/Free Full Text]
  94. 48
  95. Russell, R. G., M. O'Donnoghue, D. C. Blake, Jr., J. Zulty, and L. J. DeTolla. 1993. Early colonic damage and invasion of Campylobacter jejuni in experimentally challenged infant Macaca mulatta. J. Infect. Dis. 168:210-215.[Medline]
  96. 49
  97. Sarih, M., V. Souvannavong, and A. Adam. 1993. Nitric oxide synthase induces macrophage death by apoptosis. Biochem. Biophys. Res. Commun. 191:503-508.[CrossRef][Medline]
  98. 50
  99. Schroder, K., P. J. Hertzog, T. Ravasi, and D. A. Hume. 2004. Interferon-gamma: an overview of signals, mechanisms and functions. J. Leukoc. Biol. 75:163-189.[Abstract/Free Full Text]
  100. 51
  101. Shiloh, M. U., and C. F. Nathan. 2000. Reactive nitrogen intermediates and the pathogenesis of Salmonella and mycobacteria. Curr. Opin. Microbiol. 3:35-42.[CrossRef][Medline]
  102. 52
  103. Siegesmund, A. M., M. E. Konkel, J. D. Klena, and P. F. Mixter. 2004. Campylobacter jejuni infection of differentiated THP-1 macrophages results in interleukin 1 beta release and caspase-1-independent apoptosis. Microbiology 150:561-569.[Abstract/Free Full Text]
  104. 53
  105. Smith, C. K., P. Kaiser, L. Rothwell, T. Humphrey, P. A. Barrow, and M. A. Jones. 2005. Campylobacter jejuni-induced cytokine responses in avian cells. Infect. Immun. 73:2094-2100.[Abstract/Free Full Text]
  106. 54
  107. Stanley, E. R., M. Cifone, P. M. Heard, and V. Defendi. 1976. Factors regulating macrophage production and growth: identity of colony-stimulating factor and macrophage growth factor. J. Exp. Med. 143:631-647.[Abstract/Free Full Text]
  108. 55
  109. Stanley, E. R., and P. M. Heard. 1977. Factors regulating macrophage production and growth. Purification and some properties of the colony stimulating factor from medium conditioned by mouse L cells. J. Biol. Chem. 252:4305-4312.[Free Full Text]
  110. 56
  111. Thirumalai, K., K.-S. Kim, and A. Zychlinsky. 1997. IpaB, a Shigella flexneri invasin, colocalizes with interleukin-1β-converting enzyme in the cytoplasm of macrophages. Infect. Immun. 65:787-793.[Abstract]
  112. 57
  113. van Spreeuwel, J. P., G. C. Duursma, C. J. Meijer, R. Bax, P. C. Rosekrans, and J. Lindeman. 1985. Campylobacter colitis: histological immunohistochemical and ultrastructural findings. Gut 26:945-951.[Abstract/Free Full Text]
  114. 58
  115. van Vliet, A. H., M. A. Baillon, C. W. Penn, and J. M. Ketley. 2001. The iron-induced ferredoxin FdxA of Campylobacter jejuni is involved in aerotolerance. FEMS Microbiol. Lett. 196:189-193.[Medline]
  116. 59
  117. Vazquez-Torres, A., J. Jones-Carson, P. Mastroeni, H. Ischiropoulos, and F. C. Fang. 2000. Antimicrobial actions of the NADPH phagocyte oxidase and inducible nitric oxide synthase in experimental salmonellosis. I. Effects on microbial killing by activated peritoneal macrophages in vitro. J. Exp. Med. 192:227-236.[Abstract/Free Full Text]
  118. 60
  119. Vodovotz, Y., N. S. Kwon, M. Pospischil, J. Manning, J. Paik, and C. Nathan. 1994. Inactivation of nitric oxide synthase after prolonged incubation of mouse macrophages with IFN-gamma and bacterial lipopolysaccharide. J. Immunol. 152:4110-4118.[Abstract]
  120. 61
  121. Vuckovic, D., M. Abram, and M. Doric. 1998. Primary Campylobacter jejuni infection in different mice strains. Microb. Pathog. 24:263-268.[CrossRef][Medline]
  122. 62
  123. Watson, P. R., A. V. Gautier, S. M. Paulin, A. P. Bland, P. W. Jones, and T. S. Wallis. 2000. Salmonella enterica serovars Typhimurium and Dublin can lyse macrophages by a mechanism distinct from apoptosis. Infect. Immun. 68:3744-3747.[Abstract/Free Full Text]
  124. 63
  125. Watson, R. O., and J. E. Galan. 2005. Signal transduction in Campylobacter jejuni-induced cytokine production. Cell. Microbiol. 7:655-665.[CrossRef][Medline]
  126. 64
  127. Xaus, J., M. Comalada, A. F. Valledor, J. Lloberas, F. Lopez-Soriano, J. M. Argiles, C. Bogdan, and A. Celada. 2000. LPS induces apoptosis in macrophages mostly through the autocrine production of TNF-alpha. Blood 95:3823-3831.[Abstract/Free Full Text]
  128. 65
  129. Xie, Q. W., H. J. Cho, J. Calaycay, R. A. Mumford, K. M. Swiderek, T. D. Lee, A. Ding, T. Troso, and C. Nathan. 1992. Cloning and characterization of inducible nitric oxide synthase from mouse macrophages. Science 256:225-228.[Abstract/Free Full Text]
  130. 66
  131. Xu, J., X. Xu, and W. Verstraete. 2001. The bactericidal effect and chemical reactions of acidified nitrite under conditions simulating the stomach. J. Appl. Microbiol. 90:523-529.[CrossRef][Medline]
  132. 67
  133. Yamasaki, M., S. Igimi, Y. Katayama, S. Yamamoto, and F. Amano. 2004. Identification of an oxidative stress-sensitive protein from Campylobacter jejuni, homologous to rubredoxin oxidoreductase/rubrerythrin. FEMS Microbiol. Lett. 235:57-63.[CrossRef][Medline]


Infection and Immunity, March 2008, p. 986-993, Vol. 76, No. 3
0019-9567/08/$08.00+0     doi:10.1128/IAI.01063-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Monk, C. E., Pearson, B. M., Mulholland, F., Smith, H. K., Poole, R. K. (2008). Oxygen- and NssR-dependent Globin Expression and Enhanced Iron Acquisition in the Response of Campylobacter to Nitrosative Stress. J. Biol. Chem. 283: 28413-28425 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iovine, N. M.
Right arrow Articles by Weinrauch, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iovine, N. M.
Right arrow Articles by Weinrauch, Y.