Previous Article | Next Article ![]()
Infection and Immunity, July 2008, p. 3312-3320, Vol. 76, No. 7
0019-9567/08/$08.00+0 doi:10.1128/IAI.01475-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
,
Queensland Institute of Medical Research, 300 Herston Road, Herston, Queensland 4006, Australia,1 School of Population Health, Public Health Building, University of Queensland, Herston Road, Herston, Queensland 4006, Australia2
Received 4 November 2007/ Returned for modification 13 December 2007/ Accepted 3 May 2008
|
|
|---|
|
|
|---|
Experimental CM (ECM) caused by infection of C57BL/6 (B6) or CBA/CaH (CBA) mice with Plasmodium berghei ANKA displays many features of human CM and has been useful in identifying host factors involved in CM pathogenesis. The host immune response to parasites plays a significant role in ECM. Conventional dendritic cells (14), CD4+ and CD8+ T cells (5, 6, 22, 49), natural regulatory T (Treg) cells (3, 48), NK T cells (21, 41), NK cells (20), and platelets (26, 46, 47) have been implicated in ECM and appear to play a negative role in disease outcome. In addition, several pro- and anti-inflammatory cytokines have been shown to influence the outcome of ECM pathogenesis. These include gamma interferon (IFN-
; 2, 19, 49), TNF (18), lymphotoxin alpha (LT
; 16), and interleukin-10 (IL-10) (24). All of these cytokines, except IL-10, play negative roles in disease outcome. Interestingly, susceptibility/resistance loci have been mapped to different chromosomes within the genome of CBA and B6 mice (4, 32, 34), indicating that factors critical to ECM development may be different between the two strains of mice (34). This is consistent with human CM, which is considered to be a syndrome with significant heterogeneity in disease development and manifestation between affected individuals (11, 27).
In this study, we investigated changes in gene expression in brain tissue following the development of severe ECM symptoms in B6 and CBA mice. We also examined immune responses in these different mouse strains throughout P. berghei ANKA infection. We found significant heterogeneity in brain gene expression profiles between B6 and CBA mice with ECM and many differences in the immune responses of these mouse strains to P. berghei ANKA infection. However, modulating the function of Treg cells could prevent ECM and depletion of CD8+ cells could treat ECM in both mouse strains. These data indicate that common strategies might be used to prevent CM across a broad population base.
|
|
|---|
Sample preparation and RNA extraction. Mice were sacrificed by CO2 asphyxiation, and blood was obtained by cardiac puncture for serum cytokine analyses. Mice were then perfused with 20 ml ice-cold phosphate-buffered saline via the heart in order to remove blood and other nonadherent cells from the brain microvasculature. Brains were isolated, halved, and preserved in either RNAlater (Qiagen, Doncaster, Australia) or Tissue-Tek O.C.T. Compound (Sakura, Torrance, CA). Total RNA was extracted from brain tissue as previously described (3), and RNA quality was assessed with RNA 6000 Nano Assay Kits on a Bioanalyzer 2100 (Agilent Technologies, Forest Hill, Australia). Samples included in this study had 260:280-nm absorbance readings between 1.8 and 2.0. Equal quantities of six samples of naïve and P. berghei ANKA-infected brain tissue from B6 and CBA mice were pooled for microarray analysis.
Expression profiling with microarrays. Pooled RNA samples were converted to cDNA and antisense cRNA, labeled, and hybridized to GeneChip Mouse Genome 430 2.0 arrays (Affymetrix, Surrey Hills, Australia) by the Australian Genome Research Facility (Parkville, Australia) according to Affymetrix protocols. Each array analyzed the expression of more than 39,000 transcripts and variants representing the entire mouse transcribed genome. Arrays were scanned with the GeneChip Scanner 3000 (Affymetrix) and GeneChip Operating Software v1.1.1 (Affymetrix). Normalization and initial analyses were carried out in GeneSpring v7 (Agilent Technologies). Values below 0.01 were set to 0.01. Each measurement was divided by the 50th percentile of all measurements in that sample. The data were filtered for genes flagged as present which had an expression level of at least 50 Affymetrix units, a measurement of signal intensity generated directly from Affymetrix chips. The samples analyzed had similar numbers of transcripts and variants tagged as present on the arrays (naïve CBA, 25,801; CBA ECM, 25,833; naïve B6, 26,407; B6 ECM, 26,437). Overall, when focusing on naïve brain tissue, 24,033 probes were tagged as present in both naïve CBA and B6 brain tissue while only 1,800 and 2,404 probes were tagged as uniquely present in naïve B6 or CBA brain tissue, respectively. To determine differences in gene expression profiles, the ECM samples were normalized to the naive sample such that each measurement for each gene in the ECM samples was divided by the median of that gene's measurements in the corresponding naïve sample. All of the pooled ECM samples (B6 and CBA separately) were then independently considered to be duplicate samples of each other for statistical analyses. Likewise, the naïve samples (B6 and CBA separately) were also treated as duplicates. This consideration generated two ratio values for each treatment group (naïve and ECM). A t test was then used to analyze whether the expression of each probe set in the ECM sample was significantly different from the naïve brain sample for each CBA or B6 mouse. Transcripts were deemed to be differentially expressed when the P value was equal to or less than 0.05.
Once normalized, 98 transcripts were found to be expressed significantly more in naïve CBA brain tissue than in naïve B6 brain tissue. Importantly, the increased level of these transcripts in naïve tissue did not result in higher expression in CBA ECM brain tissue. Likewise, 181 transcripts were found to have a higher resting expression levels in naïve B6 brain tissue than in naïve CBA brain tissue. Of these, only six genes were also found to be significantly upregulated in B6 ECM brain tissue. Therefore, differences in brain gene expression profiles observed between the two strains are likely to reflect differences in cellular recruitment, responses to the presence of parasites, and signaling pathways initiated in the brain during ECM rather than simply to reflect variations in experimental conditions.
Real-time RT-PCR.
Individual RNA samples were reverse transcribed into cDNA with the cDNA Archive Kit (Applied Biosystems, Scoresby, Australia). Real-time reverse transcription (RT)-PCR analyses were performed on a Corbett Rotorgene 3000 (Corbett Life Sciences, Sydney, Australia). Platinum SYBR green master mix (Invitrogen) was used when measuring TNF (5'GGTACAACCCATCGGCTGGCA [forward] and 5'GATTCAACCTTGCGCTCATCTTAGGC [reverse]), LT
(5'CTGCTCACCTTGTTGGGTACCC [forward] and 5'GACAAAGTAGAGGCCACTGGTG [reverse]), LTβ (5'CTCAGAGATCCAATGCTTCC [forward] and 5'CCAAGCGCCTATGAGGTG [reverse]), TNFR1 (5'GCCACAAAGGAACCTACTTGG [forward] and 5'CACTCAGGTAGCGTTGGAACTGG [reverse]), and TNFR2 (5'GAAAACCCATTCTGGCAGCTGTCG [forward] and 5'CAGGATGCTACAGATGCGGTGG [reverse]) mRNA levels. All measurements were normalized against the expression of the hypoxanthine phosphoribosyltransferase housekeeping gene (5'GTTGGATACAGGCCAGACTTTGTTG [forward] and 5'GATTCAACCTTGCGCTCATCTTAGGC [reverse]).
Anti-CD8 monoclonal antibody (MAb) and anti-CD25 MAb treatment.
B6 and CBA mice were depleted of Treg cells by the administration of a single intraperitoneal (i.p.) injection of 0.5 mg anti-CD25 MAb (PC61; rat immunoglobulin G1 [IgG1]; American Type Culture Collection, Manassas, VA) either 1 or 14 days prior to P. berghei ANKA infection. Mice were depleted of CD8+ T cells when ECM symptoms were apparent and all clinical scores in the group were above 2. Animals received a single i.p. injection of 0.5 mg of anti-CD8
MAb (YTS169.1; rat IgG2a; European Collection of Cell Cultures, Porton Down, United Kingdom). The efficiency of Treg cell and CD8+ T-cell depletion was tested by flow cytometry in each experiment performed.
Assessment of cell types in brain tissue. Brain tissue was collected into collagenase solution (1 mg/ml type IV collagenase [Worthington, Lakewood, NJ] and 0.5 mg/ml DNase I [Worthington] in RPMI medium) prior to the isolation of brain mononuclear cells for fluorescence-activated cell sorter (FACS) analysis, as previously described (3). Cells were stained for CD4 (clone GK1.5), CD8 (clone 53-6.7), TCRβ (clone H57-597), NK1.1 (clone PK136), B220 (clone RA3-6B2), CD19 (clone 6D5), CD11b (clone M1/70), Ly6C (clone AL-21), Ly6G (clone 1A8), CD11c (clone N418), or CD45.2 (clone 104) expression with anti-mouse MAbs purchased from BD Bioscience or Biolegend, and cell populations were defined as previously described (3).
Measurement of serum cytokine levels. Serum was collected prior to the commencement of experiments and on day 5 p.i. or at ECM onset via the tail vein. Blood samples were allowed to clot overnight at 4°C, and sera were collected following centrifugation. Cytokines in individual serum samples were quantified with the Cytometric Bead Array Inflammatory kit (BD Bioscience) on a FACScan cytometer equipped with CellQuest Pro and CBA software (BD Bioscience).
In vivo bioluminescence imaging. In some experiments, mice were infected with P. berghei ANKA transgenic for a luciferase gene. The location of parasites in vivo, as well as the bioluminescence generated, was determined with an I-CCD photon-counting video camera and imaging system (IVIS 100; Xenogen, Alameda, CA) as previously reported (3).
Statistics. Differences in the survival of treatment groups were analyzed by the Kaplan-Meier log rank test with GraphPad Prism version 4.03 for Windows (GraphPad Software, San Diego, CA). Differences in blood parasitemia, cytokine levels, and cell numbers in brain tissue between treatment groups and mouse strains were determined by two-way analysis of variance, followed by a Bonferroni post-hoc test with GraphPad Prism. For all statistical tests, P < 0.05 was considered significant.
Nucleotide sequence accession number. All of the nucleotide sequence data obtained in this study have been submitted to the Gene Expression Omnibus (GEO) and accepted and can be accessed by using accession number GSE6019 (http://www.ncbi.nih.gov/geo/).
|
|
|---|
IP-10) (20, 29), as well as granzyme A and granzyme B, products of cytolytic CD8+ T cells (5, 38, 49). However, gene expression profiling was performed only once in this study with pooled samples. Therefore, the data were primarily used to provide a general contrast of response to infection between the two mouse strains, as well as a tool for the generation of preliminary hypotheses. Thus, these data indicate extensive heterogeneity in gene expression profiles between B6 and CBA mice and also suggest that CBA mice have greater overall immunological activity in the brain during ECM than B6 mice.
![]() View larger version (26K): [in a new window] |
FIG. 1. P. berghei ANKA-infected B6 and CBA mice show heterogeneous brain gene expression during ECM. (A) B6 (closed diamonds) or CBA (open diamonds) mice were infected with 105 P. berghei ANKA pRBC intravenously. Mice were sacrificed upon the development of severe ECM symptoms (n = 6 mice per group). The hatched area indicates the time when mice displayed ECM symptoms. (B) Parasitemia was also monitored (mean ± standard error of the mean, n = 6 mice per group). (C) RNA was extracted from perfused brain tissue from both P. berghei ANKA-infected and naïve CBA and B6 mice and hybridized to Affymetrix GeneChip Mouse Genome 430 2.0 arrays. Total-brain gene expression profiles were compared between CBA and B6 mice based on significant upregulation or downregulation of genes during ECM, following normalization and statistical testing.
|
(16) have been implicated in the pathogenesis of CM. However, our microarray analysis revealed few changes in TNF family members, although TNFR1 was significantly upregulated in both CBA and B6 mice with ECM (see Table S1 in the supplemental material). Previous microarray studies have reported difficulty in identifying changes in cytokine expression levels (44). For this reason and the potential importance of TNF and LT
in CM pathogenesis, we investigated the expression of these cytokines and their receptors in individual naïve and ECM brains taken from CBA and B6 mice by real-time RT-PCR (Fig. 2). TNFR1 mRNA levels were significantly upregulated during ECM in CBA (P < 0.001) and B6 (P < 0.01) brain tissue compared with the naïve control brain tissue, validating the microarray results. TNF mRNA levels were significantly (P < 0.001) upregulated in brain tissue taken from both strains of mice with ECM, compared to the naïve control brain tissue, and this upregulation was significantly (P < 0.001) greater in the CBA mice (Fig. 2). TNFR2 mRNA expression was also upregulated in both strains during ECM (P < 0.001), but there was no difference between strains. Similarly, there were increased levels of LTβ (P < 0.001) in ECM brain tissue taken from both strains of mice, although the total levels did not differ between the strains of mice (Fig. 2). Notably, although LT
expression in B6 mouse brains during ECM only reached the levels of constitutive gene expression observed in naïve CBA brain tissue, the relative change in expression was greater than that observed for CBA mice (Fig. 2). Together, these data further suggest that CBA mice had greater overall immunological activity in the brain during ECM than B6 mice but that there were different patterns of TNF and LT
expression in these two mouse strains.
![]() View larger version (11K): [in a new window] |
FIG. 2. Differential expression of mRNAs encoding TNF, LT , and their receptors in ECM brain tissue from P. berghei ANKA-infected CBA and B6 mice. TNF, LT , LTβ, TNFR1, and TNFR2 mRNA levels were measured in brain tissue taken from naïve and P. berghei ANKA-infected B6 and CBA mice during ECM, relative to the expression of 1,000 hypoxanthine phosphoribosyltransferase mRNA molecules (mean ± standard error of the mean; n = 6 mice per group; left panel). The relative change in the expression of each cytokine or receptor in ECM brain tissue, relative to naïve brain tissue, was also calculated (right panel). The data presented are from one representative experiment of two performed. Statistically significant differences of P < 0.01 (**) and P < 0.001 (***) are shown.
|
![]() View larger version (36K): [in a new window] |
FIG. 3. P. berghei ANKA-infected B6 mice show expansion of microglia during ECM. Mononuclear cells were prepared from brain tissue obtained during ECM and analyzed by FACS. The total numbers of CD4+ T cells, CD8+ T cells, DCs, neutrophils, monocytes/macrophages, and microglia were measured in naïve and infected CBA and B6 mouse brain tissue (mean ± standard error of the mean; n = 5 mice per group), as indicated (A). Representative FACS profiles of brain CD4+ T cells (CD4+, TCRβ+) and microglia (CD11b+, CD45int) in B6 and CBA mice, as indicated, are shown with corresponding percentages of total leukocytes (B). Data are from one representative experiment of two performed. Statistically significant differences of P < 0.05 (*), P < 0.01 (**), and P < 0.001 (***) are shown.
|
, IL-10, and IL-6 than CBA mice with ECM. Thus, despite B6 mice having reduced overall immunological activity in the brain during ECM compared with CBA mice, they generated greater levels of systemic cytokines during infection.
![]() View larger version (16K): [in a new window] |
FIG. 4. Levels of serum cytokines differ between CBA and B6 mice during infection. Serum cytokine levels were measured in naïve CBA and B6 mice and P. berghei ANKA-infected mice during ECM (mean ± standard error of the mean; n = 3 to 5 mice per group), as indicated. Data shown are from one representative experiment of two performed. Statistically significant differences of P < 0.001 (***) are shown. IL-10 levels were below the level of detection in naïve mice (n.d, not detected). IL-6 levels were below the level of detection in naïve CBA mice.
|
![]() View larger version (54K): [in a new window] |
FIG. 5. Depletion of Treg cells prior to infection protects both B6 and CBA mice from ECM. Mice were administered the Treg-depleting anti-CD25 antibody (open symbols) or control rat IgG (closed symbols) 14 days prior to infection and monitored for ECM. B6 (squares; n = 8) and CBA mice (circles; n = 8) depleted of Treg cells (open symbols) did not develop ECM and survived longer than mice administered control rat IgG (closed symbols) (A). Clinical scores were similar between CBA (open circles) and B6 mice (open squares) depleted of Treg cells (B; mean ± standard error of the mean). Parasite burdens were compared between rat IgG- and anti-CD25 MAb-treated B6 and CBA mice by bioluminescence (C). Mice were administered control rat IgG or anti-CD25 MAb 14 days prior to infection with luciferase-expressing P. berghei ANKA. When control mice developed ECM, when clinical scores were 3, all groups were anesthetized and injected with luciferin firefly potassium salt and the whole-body parasite burden was visualized with an I-CCD photon-counting video camera and in vivo imaging system. Differences in parasite burdens between control and Treg-depleted mice are depicted in bar graphs as a measurement of bioluminescence. Data shown are from one representative experiment of two performed. Statistically significant differences of P < 0.01 (**) and P < 0.001 (***) are shown.
|
![]() View larger version (14K): [in a new window] |
FIG. 6. CD8+ T cells are critical for ECM in B6 and CBA mice, and depletion of these cells halts ECM progression. Anti-CD8 MAb (open symbols) or control rat IgG (closed symbol) was administered i.p. to P. berghei ANKA-infected B6 (squares) and CBA (circles) mice on day 6 p.i., when clinical scores were 2, and mice were monitored for further disease development (A). B6 (open squares) and CBA (open circles) mice had similar clinical scores upon the administration of anti-CD8 MAb (B; arrow), and these mice were monitored until the development of severe anemia (B). Parasitemia was monitored in anti-CD8 MAb-treated B6 and CBA mice. At 72 h postadministration of the anti-CD8 MAb, differences in parasitemia between the two ECM-susceptible mouse strains were observed (C). Ten mice were included in each group. Statistically significant differences of P < 0.001 (***) and P < 0.002 (**) are shown.
|
|
|
|---|
B6 and CBA mice both had increased levels of mRNAs encoding TNF, LT
, and their receptors in brain tissue at the onset of ECM. However, changes in TNF and LT
mRNA levels differed between the two mouse strains following P. berghei ANKA infection. These trends are in accordance with a study of P. berghei ANKA-infected CBA brain tissue taken at day 6 p.i., where increased expression of TNF and LT
mRNAs was also observed (39). Overall, the relative increase in TNF mRNA expression in the brains of CBA mice with ECM was greater than in B6 mice whereas the relative increase in LT
mRNA expression was greater in B6 mice following the onset of ECM. These findings were not unexpected, given the proposed roles for TNF in ECM in CBA mice (18) and LT
in ECM in B6 mice (16).
In addition, some differences in brain leukocyte populations were found when B6 and CBA mice developed ECM, as well as major differences in serum cytokine levels throughout P. berghei ANKA infection. These data suggest that there may be distinct immunological mechanisms involved in ECM pathogenesis in B6 and CBA mice. However, we showed that manipulation of the host immune response to P. berghei ANKA infection by depletion of Treg cells or CD8+ T cells resulted in the protection of both B6 and CBA mice from ECM. Of interest, following depletion of CD8+ T cells, B6 mice recovered rapidly, albeit transiently, while CBA mice continued to display clinical signs of P. berghei ANKA infection. This observation suggests that physical recovery following CD8+ T-cell depletion depends on different factors in the two strains. Blood parasitemia was transiently reduced in B6 mice receiving anti-CD8 MAb, and this may contribute to their temporary reversal of clinical scores (Fig. 6). This transient reduction in blood parasitemia in B6 mice could be due to several reasons. First, CD8+ cell depletion may cause the parasites to be sequestered to tissue sites and therefore be absent from blood. Second, there may be a population of CD8+ cells that suppresses antiparasitic responses. The removal of all CD8+ cells may remove these suppressor cells, thereby allowing effective immune responses to be generated against the parasite. Third, we cannot discount the possibility that new CD8+ T cells or CD8+ DCs are generated and that these new cells are capable of transient control of parasite growth. The above possibilities are not mutually exclusive and may impact on each other to affect the response of B6 mice to P. berghei ANKA infection. Nevertheless, these effects appear to have been different in CBA mice, whose clinical scores stabilize, rather than improve, as is the case with B6 mice.
Parasites sequestered in tissue are thought to be critical for disease pathogenesis during malaria infection (8, 15). Therefore, it is likely that the reduced parasite burdens observed in B6 and CBA mice that received anti-CD25 MAb is a simple explanation for why these animals do not develop ECM. However, we cannot exclude the possibility that this treatment has also altered a critical pathogenic component of the host immune response following P. berghei ANKA infection, as this treatment does significantly change antiparasitic immunity (3, 48). Furthermore, our previous data indicate that many of the effects caused by anti-CD25 MAb treatment result from the depletion of Treg cells (3). Others have interpreted the results of this treatment differently and, in particular, have attributed many of the effects of the treatment to the depletion of activated T cells (48). However, we have observed increased CD4+ T-cell activation in mice that have received anti-CD25 MAb, rather than reduced responses (3). Other differences due to the use of this antibody are in the effectiveness of depletion and the duration of this effect, whereby there have been reports of incomplete elimination of CD25+ FoxP3+ CD4+ T cells (12). In our experiments, the anti-CD25 MAb treatment resulted in 85 to 95% depletion of CD25+ FoxP3+ CD4+ T cells and these cells were reduced in number for at least 14 days, although they did reemerge relatively rapidly following P. berghei ANKA infection (3). The reason for the different effects of anti-CD25 MAb treatment may reflect differences in antibody preparation and administration or the immune status of the experimental animals used.
Identifying key molecules involved in CM pathogenesis is vital for the development of treatments to delay or prevent this disease. Information generated from comparisons between ECM-susceptible mouse strains, such as the genes commonly upregulated, may prove important for identifying universal factors that are critical for CM development. These could then be used as potential targets for therapies aimed at preventing or treating CM in humans. Our data suggest that common strategies to delay or prevent CM may be feasible, despite great heterogeneity between individuals in their immune responses during malaria infection.
This work was supported by grants from the Australian NHMRC. L.M.R. is an Australian Postgraduate Award recipient, C.R.E. is an Australian NHMRC Career Development Fellow, and G.R.H. is an Australian NHMRC Practitioner Fellow.
Published ahead of print on 12 May 2008. ![]()
Supplemental material for this article may be found at http://iai.asm.org/. ![]()
|
|
|---|
receptor-medicated signaling in pathology and anti-malarial immunity induced by Plasmodium berghei infection. Eur. J. Immunol. 30:1646-1655.[CrossRef][Medline]
β CD8+ T cells in experimental cerebral malaria. J. Immunol. 169:6369-6375.
IIb) mAb injection early but not late in the course of disease protects against Plasmodium berghei pathogenesis by altering the levels of pathogenic cytokines. Blood 105:1956-1963.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»