Previous Article | Next Article ![]()
Infection and Immunity, May 2009, p. 1981-1991, Vol. 77, No. 5
0019-9567/09/$08.00+0 doi:10.1128/IAI.01382-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Section of Microbial Pathogenesis, Yale University School of Medicine, New Haven, Connecticut 06536
Received 12 November 2008/ Returned for modification 23 December 2008/ Accepted 12 February 2009
|
|
|---|
|
|
|---|
Caspase-1 activation occurs following stimulation of a group of cytosolic sensor proteins known as the nucleotide-binding domain and leucine-rich repeat proteins, called NLRs (44). Similar to Toll-like receptors, the NLRs represent a group of pattern recognition molecules capable of sensing pathogen-associated molecular patterns as well as endogenous signals indicating host damage. The NLRs known to be involved in caspase-1 activation include Ipaf (NLRC4, CARD12), pyrin domain-containing NLRs (including the Nalps), and the Naip proteins (NLRB and BIRC1). Although the roles for many NLRs remain unclear, it is evident that different NLRs enable the host to respond to a variety of different stimuli upon infection by microbial pathogens. For instance, Salmonella enterica serovar Typhimurium (21), Shigella flexneri (41), and Pseudomonas aeruginosa (12, 29, 38) activate caspase-1 by a pathway involving Ipaf, an NLR capable of directly interacting with caspase-1 through homotypic association of the CARD domains of these proteins (33). Bacterial flagellin has been shown to be important in the sensing of S. enterica serovar Typhimurium by Ipaf (10, 28); however, Ipaf-mediated caspase-1 activation in response to Shigella flexneri (41) and at least one strain of P. aeruginosa (38) is flagellin independent. Francisella tularensis activation of caspase-1 is Ipaf independent and involves stimulation of one or more Nalps (22). Caspase-1 activation by most Nalp proteins requires Asc, an adapter protein capable of interactions with Nalps and caspase-1 through pyrin-pyrin and CARD-CARD interactions, respectively (25). Nalp3 activation of caspase-1 has been studied extensively, and there is evidence that Nalp3 responds to various triggers of both endogenous and bacterial origin (14, 16, 17, 23, 24, 26, 32, 39, 40, 42). Interestingly, activation of caspase-1 through Nalp3 is inhibited in the presence of high extracellular potassium levels (32). In vitro data suggest that potassium inhibition of caspase-1 activation may be common among all of the Asc-dependent Nalp pathways due to the ability of high potassium levels to prevent Asc oligomerization, a key step for caspase-1 activation (5).
The facultative intracellular bacterium Legionella pneumophila induces caspase-1 activation in macrophages (1, 45). Normally found in freshwater environments where it parasitizes several protozoan organisms (6), L. pneumophila can invade and replicate within alveolar macrophages upon inhalation of water droplets from a contaminated source, potentially leading to a severe pneumonia known as Legionnaires' disease (13, 15, 27). Activation of caspase-1 by L. pneumophila requires the type IV secretion system called Dot/Icm (45), an apparatus that facilitates translocation of L. pneumophila proteins from the bacterial cytoplasm into the host cell cytosol (31). Translocation of bacterial proteins upon entry into macrophages allows L. pneumophila to inhibit fusion of the vacuole in which it resides with early and late endocytic organelles and to recruit vesicles exiting the endoplasmic reticulum (ER), resulting in the formation of an ER-derived compartment that supports replication of L. pneumophila (35). Caspase-1 activation occurs independently of correct trafficking of the Legionella-containing vacuole because Legionella mutants that fail to efficiently create an ER-derived vacuole but produce a functional Dot/Icm apparatus will activate caspase-1 to levels that are similar to those in wild-type bacteria (45). These data indicate that caspase-1 activation by L. pneumophila requires the type IV secretion machinery, which likely facilitates perturbations in the macrophage membrane and allows access of bacterial products to the host cytosol.
The NLR proteins Naip5 and Ipaf are important for caspase-1 activation by L. pneumophila (1, 20, 45). A C-terminal region of the L. pneumophila flagellin protein was recently shown to be sufficient to activate caspase-1 through Ipaf and Naip5 (20). Flagellin or peptide fragments of the flagellin protein presumably gain access to the macrophage cytosol during infection by subverting the translocation functions provided by the Dot/Icm system, but this has not been demonstrated. In vitro data suggest that Naip5 and Ipaf interact directly (3, 45). These data indicate that Naip5, Ipaf, and bacterial flagellin comprise a pathway for caspase-1 activation in response to L. pneumophila.
In addition to Ipaf and Naip5, it has been shown that the adapter protein Asc has a role in IL-1β secretion by macrophages in response to L. pneumophila (45), but the role that Asc plays in this process is unclear. Here, we investigated whether Asc is a component of the caspase-1 activation pathway regulated by Naip5 and Ipaf in response to flagellin or whether Asc defines an alternate pathway used for caspase-1 activation.
|
|
|---|
Mice. Ipaf–/–, Asc–/–, Nalp3–/–, and Casp1–/– mice have been described previously (19, 21, 26, 39). Ipaf–/–, Asc–/–, Nalp3–/–, and Casp1–/– mice were backcrossed to the C57BL/6 background for 5, 9, 10, and 10 generations, respectively. C57BL/6 mice were purchased from Jackson Laboratories. For the generation of Ipaf–/– Asc–/– mice, Ipaf–/– and Asc–/– mice were crossed, and the resulting heterozygous progeny (F1) were crossed. The progeny resulting from this secondary cross (F2) were screened for the absence of Ipaf and Asc by PCR using tail DNA and the following primer sets: for Ipaf, Mill29-28 (GCAGGAATCAATCCAGAGTCTGAG), Mill29-37 (GAAGCCTCAACGGCAACGAGCACTC), and Neo3A GCAGCGCATCGCCTTCTATC; for Asc, Card5-018-F2 (GTGGACGGAGTGCTGGATG), Card5-018-F2 (GTCCATCACCAAGTAGGGATG), and NeoF (GCTGACCGCTTCCTCGTGCTTTAC). All animals were maintained in accordance with the guidelines of the Yale Institutional Animal Use and Care Committee (protocol 07847).
Ex vivo macrophage infections. Bone marrow cells were collected from the femurs and tibiae of mice and cultured for 7 days in RPMI 1640 containing 20% fetal bovine serum (FBS), 25% macrophage colony-stimulating factor (M-CSF), and penicillin-streptomycin (100 units/ml). Macrophages were replated 1 day prior to infection in RPMI 1640 containing 10% FBS and 10% M-CSF for all experiments except where specified. Supernatants from L-929 fibroblast cells (ATCC) served as the source of M-CSF. All infections were carried out by centrifuging bacteria onto macrophage monolayers for 5 min at 400 x g. For experiments involving potassium inhibition, KCl or NaCl was added to the medium immediately following infection to a level of 50 mM above the basal concentration of these salts. For proteasome inhibition experiments, cells were pretreated with 1 µg/ml lipopolysaccharide (LPS) (Sigma) for 3 hours, washed to remove LPS, and infected with L. pneumophila for 6 h in the presence of 10 µM MG132 (Calbiochem).
Cytokine assays.
Macrophages were added to 24-well plates (2 x 105 cells per well) and infected with L. pneumophila at a multiplicity of infection (MOI) of 10. Unless otherwise indicated, supernatants were harvested at 8 h postinfection and cleared by centrifugation prior to cytokine measurements. IL-1β was measured using a mouse IL-1β enzyme-linked immunosorbent assay (ELISA) kit (BD Biosciences). IL-18 was captured using an antibody specific to mature mouse IL-18 (R&D Systems) and detected with a biotinylated antibody to mouse IL-18 (R&D Systems). Tumor necrosis factor alpha (TNF-
) was measured using antibodies against mouse TNF-
(R&D Systems).
Immunoblot analysis. Macrophages (5 x 105) were added to 12-well plates and infected with L. pneumophila at an MOI of 10. Supernatants were treated with 10% trichloroacetic acid in the presence of protease inhibitor cocktail (Roche), and precipitated proteins were pelleted by centrifugation at 16,000 x g for 20 min at 4°C. The resulting pellets were washed with cold acetone, dried, and resuspended in sample buffer. Trichloroacetic acid-precipitated supernatants were combined with cell lysates prior to gel electrophoresis. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to Immobilon-P membranes (Millipore), and blocked overnight at 4°C in Tris-buffered saline with 0.1% Tween 20 and 5% nonfat dry milk, followed by incubation in Tris-buffered saline with 0.1% Tween 20 and 5% bovine serum albumin at 25°C for 1 h. Caspase-1 cleavage was detected using a rabbit polyclonal antibody against the p10 subunit (Santa Cruz Biotechnology) and goat anti-rabbit secondary antibody conjugated to horseradish peroxidase (Zymed).
Cell death and pore formation assays. Cell death was measured by lactate dehydrogenase (LDH) release assay. Macrophages (8 x 104) were added to 48-well plates and infected with L. pneumophila at an MOI of 50. Supernatants were harvested at various time points after infection for analysis of LDH release. Release of LDH by cells was quantified using the Cytotox 96 kit (Promega).
Pore formation in macrophages was determined by quantification of propidium iodide (PI) uptake. Macrophages (5 x 105) were added to non-tissue-culture-treated 12-well plates in RPMI 1640 containing 20% FBS and 25% M-CSF. Macrophages were infected at an MOI of 50 for 2 h, followed by gentle washing in cold phosphate-buffered saline (PBS), and then resuspended in 400 µl cold PBS containing 2 mM EDTA. PI was added to a final concentration of 62.5 µg/ml, and cells were analyzed by fluorescence-activated cell sorting.
In vivo mouse infections. Seven- to 11-week-old mice were used for in vivo infections. Mice were anesthetized by subcutaneous injection of a ketamine (100 mg/kg)-xylazine (10 mg/kg) solution and then intranasally inoculated with 5 x 106 CFU of L. pneumophila. For bacterial growth studies, mice were euthanized with CO2 at 4 h postinfection or by subcutaneous injection of a ketamine (250 mg/kg)-xylazine (25 mg/kg) solution at 24 or 48 h postinfection. Lungs were harvested and homogenized in sterile distilled water for 30 s using a PowerGen 125 hand-held homogenizer (Fisher Scientific). Lung homogenates were plated on charcoal-yeast extract agar plates and incubated for 72 h at 37°C prior to counting colonies. For cytokine measurements, mice were euthanized by injection of a ketamine (250 mg/kg)-xylazine (25 mg/kg) solution at 24 h postinfection. Bronchoalveolar lavage was performed using 400 µl of PBS, and the resulting fluid was assayed for IL-1β and IL-18 by ELISA as described above.
Statistical analysis. Statistical significance for cytokine assays and bacterial growth assays was calculated using the unpaired Student t test. Differences were considered statistically significant if the P value was <0.05.
|
|
|---|
![]() View larger version (21K): [in a new window] |
FIG. 1. Caspase-1 activation by macrophages in response to L. pneumophila involves both Ipaf and Asc. BMMs from wild-type (WT), Asc–/–, Ipaf–/–, or Casp1–/– mice were either noninfected or infected with wild-type or dotA L. pneumophila at an MOI of 10. (A and B) IL-1β (A) and IL-18 (B) levels in culture supernatants at 8 h postinfection were quantified by ELISA. Data are represented as averages ± standard deviations. (C) Immunoblot of the p10 fragment of caspase-1 from combined supernatants and pellets of BMMs obtained at 4 h postinfection. Data are representative of four (A) or three (B and C) experiments. ND, measurable quantities not detected.
|
![]() View larger version (26K): [in a new window] |
FIG. 2. L. pneumophila activates caspase-1 through Asc, independent of the Ipaf/flagellin pathway. BMMs from wild-type (WT), Asc–/–, Ipaf–/–, or Casp1–/– mice were infected with the indicated L. pneumophila variants at an MOI of 10. (A and B) IL-1β (A) and IL-18 (B) levels in culture supernatants at 8 h postinfection were quantified by ELISA. Data are represented as averages ± standard deviations. (C) Immunoblot of the p10 fragment of caspase-1 from combined supernatants and pellets of BMMs obtained at 4 h postinfection. Data are representative of four (A) or three (B and C) experiments. ND, measurable quantities not detected.
|
(Fig. 3C). These data indicate that the caspase-1-mediated IL-1β and IL-18 release inhibited by the presence of high extracellular potassium levels was dependent on Asc. Additionally, Ipaf–/– macrophages infected with wild-type L. pneumophila in the presence of high extracellular potassium secreted IL-1β and IL-18 to levels similar to those observed with caspase-1–/– macrophages and phenotypically resembled Asc-deficient cells infected with the L. pneumophila flaA mutant.
![]() View larger version (14K): [in a new window] |
FIG. 3. Asc-dependent IL-1β and IL-18 release by macrophages in response to L. pneumophila is inhibited by high extracellular potassium. BMMs from wild-type, Asc–/–, Ipaf–/–, or Casp1–/– mice were infected with wild-type or flaA L. pneumophila at an MOI of 10. During infection, cells were cultured in the presence of an additional 50 mM KCl; control cells were incubated with an additional 50 mM NaCl. IL-1β (A), IL-18 (B), and TNF- (C) levels in culture supernatants at 8 h postinfection were quantified by ELISA. Data are represented as averages ± standard deviations. Data are representative of four (A) or three (B and C) experiments.
|
![]() View larger version (25K): [in a new window] |
FIG. 4. High extracellular potassium levels inhibit Asc-dependent caspase-1 activation. An immunoblot of the p10 fragment of caspase-1 from combined supernatants and pellets of BMMs from wild-type (WT), Asc–/–, or Ipaf–/– mice is shown. Cells were infected for 4 h with wild-type, dotA, or flaA L. pneumophila at an MOI of 10 in the presence of an additional 50 mM NaCl or 50 mM KCl. Data are representative of three experiments.
|
![]() View larger version (23K): [in a new window] |
FIG. 5. Macrophages deficient in both Ipaf and Asc fail to activate caspase-1 in response to L. pneumophila. BMMs from wild-type (WT), Asc–/–, Ipaf–/–, Ipaf–/– Asc–/–, or Casp1–/– mice were infected with the indicated L. pneumophila variants at an MOI of 10. (A and B) IL-1β (A) and IL-18 (B) levels in culture supernatants at 8 h postinfection were quantified by ELISA. Data are represented as averages ± standard deviations. (C) Immunoblot of the p10 fragment of caspase-1 from combined supernatants and pellets of BMMs obtained at 4 h postinfection. Data are representative of four (A and C) or two (B) experiments. ND, measurable quantities not detected.
|
![]() View larger version (14K): [in a new window] |
FIG. 6. L. pneumophila pathways for caspase-1 activation do not involve Nalp3 or the proteasome. (A) BMMs from wild-type (WT), Asc–/–, Nalp3–/–, or Casp1–/– mice were infected with wild-type or flaA L. pneumophila at an MOI of 10 and assayed for IL-1β in supernatants at 8 h postinfection. (B and C) Wild-type or Asc-deficient (Asc–/–) BMMs were pretreated with LPS (1 µg/ml) for 3 hours, followed by infection with wild-type or dotA L. pneumophila in the presence of dimethyl sulfoxide (DMSO) (mock treated) or MG132 and assayed for IL-1β or IL-18 in culture supernatants at 6 h postinfection. Data are represented as averages ± standard deviations. (D) LDH release assays were performed at 6 h postinfection for wild-type macrophages infected with wild-type or dotA L. pneumophila in the presence or absence of MG132. Values represent the percentage of LDH released compared to that for cells lysed with Triton X-100. Data are represented as averages ± standard deviations. Data are representative of two experiments.
|
B, and NF-
β activation requires proteasome activity. To overcome pro-IL-1β inhibition at the transcriptional level, macrophages were treated with LPS for 3 hours prior to infection and proteasome treatment. To confirm that proteasome treatment did not significantly affect cell viability, LDH release assays were performed on culture supernatants prior to cytokine measurements (Fig. 6D). Secreted IL-1β and IL-18 levels were relatively unaffected when wild-type and Asc-deficient macrophages were infected with L. pneumophila in the presence of proteasome inhibitor. Thus, caspase-1-mediated processing and release of IL-1β and IL-18 in response to L. pneumophila do not require proteasome activity. Pore formation induced by L. pneumophila requires Ipaf/flagellin-mediated caspase-1 activation and is independent of Asc-mediated caspase-1 activation. Because Ipaf- and Asc-deficient macrophages appear to define two different pathways for activation of caspase-1 in response to L. pneumophila, we investigated whether distinct responses were associated with the different inflammasome activities. Activation of caspase-1 can lead to pyroptotic cell death, a process by which macrophages lyse and release their intracellular contents. It has been demonstrated that cell death results from osmotic lysis due to formation of pores in cell membranes by a caspase-1-mediated process (9). It has been shown previously that L. pneumophila induces pore formation in macrophages by a type IV-dependent process (18). In addition, L. pneumophila has been shown to induce cell lysis through a caspase-1-dependent process involving Ipaf, Naip5, and bacterial flagellin (20, 30). Thus, it is possible that L. pneumophila-induced cell lysis results from caspase-1-mediated pore formation in the host cell membrane. To examine this possibility, the role of caspase-1 in L. pneumophila-induced pore formation was investigated. Pore formation was measured at 2 hours postinfection by flow cytometry following PI staining (Fig. 7A). L. pneumophila induced the formation of pores in macrophages at 2 hours by a Dot/Icm-dependent process. Although wild-type macrophages showed significant PI uptake, there was no detectable PI uptake by caspase-1-deficient macrophages. Because the Ipaf/flagellin pathway of caspase-1 activation by L. pneumophila induces cell death, we investigated whether this pathway was required for pore formation. Indeed, PI uptake was diminished in Ipaf–/– macrophages or macrophages infected with flagellin-deficient L. pneumophila, suggesting that pore formation requires Ipaf and bacterial flagellin. In contrast, macrophages deficient in Asc exhibited PI uptake similar to that of wild-type macrophages, indicating that Asc is dispensable for caspase-1-mediated pore formation during L. pneumophila infection. In addition to pore formation, LDH release was used to measure cell lysis following L. pneumophila infection of macrophages (Fig. 7B and C). These data show that rapid caspase-1-mediated lysis of macrophages following L. pneumophila infection requires Ipaf and flagellin but is independent of Asc. If Asc is dispensable for caspase-1-mediated pore formation and cell lysis, specific inhibition of Asc-dependent caspase-1 activation by high extracellular potassium levels should have no significant impact on pore formation or cell lysis. Indeed, high extracellular potassium, which inhibits Asc-dependent caspase-1 activation, did not significantly affect pore formation and cell lysis in L. pneumophila-infected macrophages as measured by PI uptake and LDH release, respectively (Fig. 7D and E). Thus, Ipaf and Asc control different downstream functions of caspase-1 in response to L. pneumophila.
![]() View larger version (21K): [in a new window] |
FIG. 7. Pore formation and cell lysis induced by L. pneumophila requires caspase-1, Ipaf, and bacterial flagellin but not Asc. BMMs from wild-type (WT), Asc–/–, Ipaf–/–, or Casp1–/– mice were either noninfected or infected with the indicated L. pneumophila variants at an MOI of 50. (A and D) Macrophages were assayed for PI uptake at 2 h postinfection by flow cytometry. Noninfected controls are represented in gray with a dashed outline, and the overlaid samples are represented by a solid black line. (B, C, and E) LDH release assays were performed at the indicated times for wild-type BMMs infected with indicated L. pneumophila variants (B and E) or wild-type, Asc–/–, Ipaf–/–, or Casp1–/– BMMs infected with wild-type L. pneumophila (C). Values represent the percentage of LDH released compared to that for cells lysed with Triton X-100. Data points are averages ± standard deviations. Data for wild-type macrophages infected with wild-type L. pneumophila are the same in panels B and C. Macrophages were incubated in the presence of an additional 50 mM KCl or 50 mM NaCl where indicated (D and E). Data are representative of five (A), four (B and C), or three (D and E) experiments.
|
![]() View larger version (13K): [in a new window] |
FIG. 8. L. pneumophila induces IL-18 release through Ipaf/flagellin- and Asc-dependent pathways in the mouse lung. Wild-type (WT), Ipaf–/–, Asc–/–, and Casp1–/– mice were infected with wild-type, dotA, or flaA L. pneumophila through intranasal inoculation. (A) At 24 h postinfection, bronchoalveolar lavage fluid was assayed for IL-18 by ELISA as described above. IL-18 levels indicated are the averages ± standard errors for five mice in all groups except that of C57BL/6 mice infected with PBS or dotA L. pneumophila, which contained four mice. (B and C) For assaying L. pneumophila growth, wild-type mice infected with the indicated L. pneumophila variants (B) and wild-type, Ipaf–/–, Asc–/–, or Casp1–/– mice infected with wild-type L. pneumophila (C) were sacrificed at various time points, and the lungs were harvested for quantifying CFU. Each point is displayed as the average ± standard error for four mice. Data for C57BL/6 mice infected with wild-type L. pneumophila are the same in panels B and C. An asterisk indicates a significant difference (P < 0.05) when comparing the indicated sample to a wild-type mouse infected with wild-type L. pneumophila. Data are representative of three experiments.
|
|
|
|---|
Our data demonstrate a pathway that requires Asc and is independent of Ipaf that resulted in the activation of caspase-1 by L. pneumophila. This pathway was revealed by showing the activation of caspase-1 in macrophages deficient in Ipaf and infected with wild-type L. pneumophila and in wild-type macrophages infected with an L. pneumophila mutant deficient in flagellin. Caspase-1 activation under these infection conditions resulted in detectable levels of IL-1β and IL-18 release in response to L. pneumophila (Fig. 1 and 2). The ability of high levels of extracellular potassium to block Asc-dependent caspase-1 activation was examined because a number of Asc-mediated pathways of caspase-1 activation can be blocked by potassium without having an effect on Ipaf-dependent pathways (11, 32). We found that potassium inhibited L. pneumophila-induced caspase-1 activation and IL-1β/IL-18 release only for the Asc-dependent pathway (Fig. 3 and 4). Additionally, macrophages deficient in Ipaf or infected with flagellin-deficient L. pneumophila no longer activated caspase-1 or induced IL-1β/IL-18 release when cultured in the presence of high extracellular potassium levels (Fig. 3 and 4), which provides further support that Asc and Ipaf function independently to activate caspase-1 in response to L. pneumophila. Furthermore, it is likely that Ipaf- and Asc-mediated pathways represent the primary mechanisms for caspase-1 activation by macrophages in response to L. pneumophila, because macrophages deficient in both Ipaf and Asc no longer activated caspase-1 during infection with this pathogen (Fig. 5).
The mechanism by which extracellular potassium inhibits caspase-1 activation in response to microbial pathogens and toxins remains unclear. One hypothesis is that some NLRs respond directly to changes in potassium concentration (5, 32). It is possible that insertion of the type IV apparatus into the host cell membrane induces a potassium efflux due to a localized loss of membrane integrity. An alternate possibility is that addition of extracellular potassium prevents NLR signals from being "sensed" by inhibiting the formation of an active inflammasome complex. In support of the latter hypothesis, formation of an active Asc-containing inflammasome was shown to be inhibited by increasing potassium concentrations in vitro independent of the upstream signals (5, 32). Thus, it is equally plausible that bacterial molecules enter the host cell cytosol by a translocation process dependent on the type IV secretion apparatus and that detection of these molecules by a cytosolic receptor(s) coupled with an efflux of potassium results in caspase-1 activation through an Asc-dependent pathway.
It is likely that L. pneumophila stimulates activation of one or more Nalps during infection to activate caspase-1 by the Asc-dependent pathway. There are 14 Nalp proteins in mice, and the agonists that activate most of these remain unknown. Stimuli that can activate Nalp3 and Nalp1 have been reported (14, 16, 17, 23, 24, 26, 32, 39, 40, 42), and the presence of high extracellular potassium levels can prevent the activation of caspase-1 through Nalp3 or Nalp1 (32). Investigations on the roles of individual Nalp proteins in the activation of caspase-1 by L. pneumophila revealed no detectable defect in IL-1β release in response to L. pneumophila when Nalp3–/– macrophages were compared to wild-type macrophages (Fig. 6A), suggesting either that Nalp3 is not the sole Nalp activated or that Asc-mediated caspase-1 activation by L. pneumophila is independent of Nalp3. Additionally, the mechanism by which L. pneumophila induced Asc-dependent caspase-1 activation did not appear to require Nalp1, as inhibiting proteasome activity did not prevent activation of caspase-1 (Fig. 6B and C). Thus, it is possible that the Asc-mediated pathway for caspase-1 activation by L. pneumophila represents an uncharacterized mechanism that is distinct from the Nalp3 pathway and the mechanism for Nalp1 activation mediated by anthrax lethal toxin.
A number of studies have established that caspase-1, Ipaf, and bacterial flagellin are required for induction of pyroptotic cell death by L. pneumophila (20, 30, 34). Here, we show clearly that caspase-1 activity alone is not sufficient for cell death, because similar levels of caspase-1 activation were observed in the Ipaf-deficient macrophages and the Asc-deficient macrophages; however, in the absence of Ipaf or bacterial flagellin, formation of pores in the macrophage membrane, pyroptotic cell lysis, and restriction of L. pneumophila replication were all prevented. Importantly, by infecting Asc- and Ipaf-deficient mice, we were able to show that caspase-1-dependent cytokine responses to L. pneumophila in the lung were similar, validating ex vivo experiments with macrophages suggesting that Ipaf and Asc control independent pathways for caspase-1 activation. Additionally, these data indicate that Ipaf specifically, and not simply cytokine production in general, is important for the caspase-1-dependent restriction of L. pneumophila replication. These data support the hypothesis that pyroptosis is a physiologically important cell-autonomous mechanism for restricting L. pneumophila replication.
In conclusion, these data indicate that L. pneumophila stimulates at least two pathways for caspase-1 activation in macrophages. One pathway involves flagellin-mediated activation of Ipaf and Naip5. Formation of the Ipaf inflammasome appears to involve the correct assembly of molecules necessary for downstream events such as formation of pores in the host cell membrane, cell lysis, and restriction of L. pneumophila growth. A second pathway that involves the adapter protein Asc and most likely one or more Nalp proteins promotes caspase-1 activation and release of proinflammatory cytokines but does not appear to activate downstream events that can elicit pore formation, cell lysis, and restriction of L. pneumophila growth. Future studies are required to uncover how these pathways differentially regulate downstream events in response to L. pneumophila, as well as to identify possible upstream molecules in the Asc-mediated pathway of caspase-1 activation.
This research was supported by an NSF predoctoral award (C.L.C.), an Irvington Institute postdoctoral fellowship of the Cancer Research Institute (S.S.), and NIH grants R01-AI048770 and R01-AI041699 (C.R.R.).
Published ahead of print on 23 February 2009. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»