This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shaughnessy, J.
Right arrow Articles by Ram, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shaughnessy, J.
Right arrow Articles by Ram, S.

 Previous Article  |  Next Article 

Infection and Immunity, May 2009, p. 2094-2103, Vol. 77, No. 5
0019-9567/09/$08.00+0     doi:10.1128/IAI.01561-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Functional Comparison of the Binding of Factor H Short Consensus Repeat 6 (SCR 6) to Factor H Binding Protein from Neisseria meningitidis and the Binding of Factor H SCR 18 to 20 to Neisseria gonorrhoeae Porin{triangledown} ,{dagger}

Jutamas Shaughnessy,1,{ddagger} Lisa A. Lewis,1*,{ddagger} Hanna Jarva,2 and Sanjay Ram1

Division of Infectious Diseases and Immunology, University of Massachusetts Medical School, Worcester, Massachusetts 01605,1 Haartman Institute, Department of Bacteriology and Immunology, University of Helsinki, 00014 Helsinki, Finland2

Received 23 December 2008/ Returned for modification 3 February 2009/ Accepted 26 February 2009


arrow
ABSTRACT
 
Both Neisseria meningitidis and Neisseria gonorrhoeae recruit the alternative pathway complement inhibitory protein factor H (fH) to their surfaces to evade complement-dependent killing. Meningococci bind fH via fH binding protein (fHbp), a surface-exposed lipoprotein that is subdivided into three variant families based on one classification scheme. Chimeric proteins that comprise contiguous domains of fH fused to murine Fc were used to localize the binding site for all three fHbp variants on fH to short consensus repeat 6 (SCR 6). As expected, fH-like protein 1 (FHL-1), which contains fH SCR 6, also bound to fHbp-expressing meningococci. Using site-directed mutagenesis, we identified histidine 337 and histidine 371 in SCR 6 as important for binding to fHbp. These findings may provide the molecular basis for recent observations that demonstrated human-specific fH binding to meningococci. Differences in the interactions of fHbp variants with SCR 6 were evident. Gonococci bind fH via their porin (Por) molecules (PorB.1A or PorB.1B); sialylation of lipooligosaccharide enhances fH binding. Both sialylated PorB.1B- and (unsialylated) PorB.1A-bearing gonococci bind fH through SCR 18 to 20; PorB.1A can also bind SCR 6, but only weakly, as evidenced by a low level of binding of FHL-1 relative to that of fH. Using isogenic strains expressing either meningococcal fHbp or gonococcal PorB.1B, we discovered that strains expressing gonococcal PorB.1B in the presence of sialylated lipooligosaccharide bound more fH, more effectively limited C3 deposition, and were more serum resistant than their isogenic counterparts expressing fHbp. Differences in fH binding to these two related pathogens may be important for modulating their individual responses to host immune attack.


arrow
INTRODUCTION
 
Factor H (fH) is a 155-kDa soluble plasma glycoprotein that negatively regulates the alternative pathway (AP) of complement by inhibiting the assembly of active C3 convertases, accelerating the decay of the AP C3 convertase (C3b,Bb), and acting as a cofactor in factor I-mediated cleavage of C3b to the hemolytically inactive molecule, iC3b (7, 36, 51, 52). fH is composed entirely of 20 short consensus repeat (SCR) domains (also called complement control protein domains, or CCPs); each SCR is ~60 amino acid residues in length and contains four invariant cysteines that coordinate folding of the domain (44). fH also binds to polyanions such as sialic acid, heparin, and sulfated glycosaminoglycans (31). Numerous human pathogens recruit fH to circumvent the deleterious effects of the AP of complement. Microbial fH binding proteins that contribute to pathogenicity have been described for several organisms, including group A (18) and group B streptococci, Streptococcus pneumoniae (20), Yersinia enterocolitica (1, 4), human immunodeficiency virus, Fusobacterium necrophorum (14), and Borrelia spp. (2, 3).

The complement system is an important arm of the innate immune defense against pathogenic Neisseria spp. Individuals with deficiencies in components of the terminal complement pathway (C5 to C9) or the AP (such as properdin and factor D) are at an increased risk for disseminated neisserial infections (8, 9, 45). Neisseria meningitidis and Neisseria gonorrhoeae have evolved several mechanisms to combat complement-mediated killing. Each of these organisms recruits fH to its surface; however, the surface structures involved in binding to fH are different (27, 28, 34, 41-43, 46). Subtle differences in the ways these organisms bind fH may be important for survival in the unique niche occupied by each organism.

N. meningitidis is an encapsulated gram-negative bacterium that causes meningitis and sepsis worldwide. N. meningitidis colonizes the nasopharyngeal epithelium of 5 to 10% of the population and in susceptible individuals may cross the epithelial barrier into the bloodstream and cause systemic infection. Essentially all isolates of N. meningitidis recovered from the bloodstream or cerebrospinal fluid are encapsulated, and expression of the polysaccharide capsule is critical for high-level resistance to complement-mediated killing by normal human serum (NHS) (10). Meningococci employ numerous mechanisms to avoid complement-mediated killing. These include binding of complement regulatory proteins such as C4b binding protein (C4BP) and fH, which regulate the classical and alternative complement pathways, respectively (22, 28, 46). fH promotes conversion of C3b bound to the bacterial surface to iC3b, a hemolytically inactive form of C3b, and also results in an overall decrease in total C3 deposition that results in decreased opsonization. Binding of fH to meningococci is mediated by fH binding protein (fHbp; also named GNA1870 or lipoprotein 2086), a 28-kDa surface-exposed lipoprotein present in all strains of N. meningitidis that have been examined (28). fHbp is a prominent component of an experimental recombinant polyvalent vaccine currently in phase III clinical trials. Based on amino acid sequence comparisons, two different classification systems for fHbp have been proposed. One system divides this protein into subfamilies A and B, while the other classification system divides fHbp into three variant families called variant 1, variant 2, and variant 3 (11, 29). Amino acid identity is 74.1% between variants 1 and 2, 62.8% between variants 1 and 3, and 84.7% between variants 2 and 3 (29). Despite these variations in amino acid sequence, all three variants of fHbp bind to fH (28). fHbp expression varies widely among different strains, and expression levels correlate directly with the level of fH binding; strains that express larger amounts of fHbp bind more fH (28, 29).

N. gonorrhoeae is the causative agent of gonorrhea, a serious health problem worldwide. Host defenses successfully limit most cases of gonorrhea to the genital tract. Invasion of the bloodstream and dissemination occur in fewer than 5% of cases and are highly dependent on the strain attributes, particularly intrinsic resistance to complement-mediated killing (termed stable serum resistance) (40). One way that gonococci evade complement-mediated killing is by binding human fH (41, 42). Gonococci bind fH via the porin molecules PorB.1A and PorB.1B. In vivo, the lacto-N-neotetraose (LNT) epitope of neisserial lipooligosaccharide (LOS) is modified with sialic acid (37), and sialylation of the LNT epitope of LOS facilitates the binding of fH to all gonococcal porins and renders gonococci resistant to killing by nonimmune NHS (32). The binding of fH to gonococci that express PorB.1B is dependent upon LOS sialylation (42) and is mediated by fH SCR 18 to SCR 20 (SCR 18-20) (34, 42). Gonococci expressing PorB.1B bind fH very weakly or not at all in the absence of LOS sialylation. Gonococcal strains that express PorB.1A proteins can bind to fH directly, even in the absence of LOS sialylation. LOS sialylation enhances the binding of fH to PorB.1A-bearing gonococci. This interaction involves both fH SCR 6 and SCR 18-20; however, SCR 18-20 is the preferred site of binding (34).

In this communication, we characterized the interaction of fH with fHbp on N. meningitidis by identifying amino acids in fH that are involved in binding to all three variants of fHbp. Our studies revealed salient differences in the way meningococci and gonococci bind fH. We also examined the functional consequences of the different mechanisms that these organisms use to bind fH.


arrow
MATERIALS AND METHODS
 
Bacterial strains and mutants. Neisserial strains and their relevant characteristics are listed in Table 1. Bacteria were grown on chocolate agar plates supplemented with an IsoVitaleX equivalent at 37°C in an atmosphere enriched with 5% CO2. For immunological assays, organisms were grown for 10 to 12 h and then suspended in Hanks' balanced salt solution (HBSS) containing 0.15 mM CaCl2 and 1 mM MgCl2 (HBSS++). Escherichia coli strains (Invitrogen, Carlsbad, CA) were cultured in Luria-Bertani (LB) broth or on LB agar.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Bacterial strains used in this study

Serum and complement reagents. Sera from seven healthy adult volunteers with no history of neisserial infections and who had not received a meningococcal vaccine were pooled and stored at –70°C. Complement activity in the sera was abrogated by heating at 56°C for 30 min. Purified human fH was purchased from Advanced Research Technologies (Tyler, TX).

Recombinant fH fragment/Fc fusion proteins. fH/murine Fc fusion constructs were used to examine the binding of fH to fHbp. These constructs contained contiguous fH SCR domains (SCR 1-5, 1-6, 5-8, 6-10, 11-15, or 16-20) fused in frame at their C-terminal ends to the N terminus of the Fc fragment of murine immunoglobulin G2a (IgG2a) (fH/Fc fusion proteins). The construction of these chimeric fH/murine Fc fusion proteins and the estimation of the concentration of the fusion proteins in concentrated cell culture supernatants have been described in detail previously (34). These constructs permit use of the Fc region as a detection site (tag) for equal detection of each fusion molecule, using anti-mouse IgG. Collectively, the fH fragments spanned the entire length of the fH molecule.

Site-directed mutagenesis of SCR 6. Amino acids in fH SCR 6 important for binding to each variant of fHbp were identified by replacing individual amino acids in human SCR 6 with the corresponding rhesus macaque SCR 6 amino acids in the background of the human SCR 5-8/Fc construct. Point mutations were created using a QuikChange site-directed mutagenesis kit according to the manufacturer's instructions (Stratagene, La Jolla, CA). The sequences of all constructs were validated by DNA sequencing. The quality and quantity of the constructs were analyzed as discussed above. Based on the sequence dissimilarity between human and rhesus fH SCR 6 (see Fig. 2A) and the lack of binding of rhesus fH to Neisseria spp. (15), the following SCR 6 point mutations were constructed: T321S, K323R, H337Y, N339S, A348P, Y352H, Y353F, H360P, and H371Y. Similarly, we created three double mutants (H337Y H360P, H337Y H371Y, and H360P H371Y).


Figure 2
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 2. Site-directed mutagenesis of human fH SCR 6. (A) Amino acid sequence comparison of human and rhesus fH SCR 6. Identical amino acid residues are denoted by dots. Asterisks indicate amino acids in SCR 6 that are involved in binding to the polyanion SOS, identified by Prosser et al. (38). The histidine residues mutated and examined below in panel B are boxed. (B) Binding of human SCR 5-8/Fc (wild-type) and human SCR 5-8/Fc constructs containing point mutations in the indicated histidine residues (mutant protein) to meningococcal strains H44/76, RM1090, and M1239. No fusion protein is present in the control tube. The x axis represents fluorescence on a log10 scale, and the y axis represents the number of events. The results of one experiment representative of at least three independent experiments are shown.

Recombinant FHL-1. Recombinant fH-like protein 1 (FHL-1) was generated by PCR, using pBluescript containing the cloned human fH cDNA (a gift of Michael K. Pangburn, University of Texas Health Science Center, Tyler, TX) as a template. The fH SCR 1-7 fragment was cloned into the KpnI and NotI sites of the eukaryotic expression vector pcDNA3 (Invitrogen Life Technologies), using the forward primer FHL-1 KpnI Forward (CGGGGTACCAAAAAATGAGACTTCTAGCAAA) and reverse primer FHL-1 NotI Reverse (GCGGCCGCTTAGAGTGTAAAACTGACACGGATACATCTTGGAGTA). The reverse primer adds four C-terminal amino acids (SFTL) found in FHL-1 that are not present in fH. All clones were confirmed by DNA sequencing. Chinese hamster ovary (CHO) cells were transfected with the FHL-1 construct, using lipofectin (Invitrogen Life Technologies) according to the manufacturer's instructions. Media from transfected cells were collected over a 2-day period, and FHL-1 was purified from culture supernatant by passage over a polyclonal anti-fH column. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting were used to assess the purity of the FHL-1. Protein concentrations were determined by absorbance at 280 nm and by using a bicinchoninic acid protein assay kit (Pierce).

Flow cytometry. Bacteria grown overnight on chocolate agar plates were washed with HBSS++ and suspended to a final concentration of 3 x 108 cells/ml; 108 organisms were used in each fluorescence-activated cell sorter (FACS) assay. To detect the binding of recombinant fH/Fc fusion proteins, bacteria were incubated with concentrated tissue culture supernatant containing 0.5 µg of recombinant fH/Fc protein (as determined by enzyme-linked immunosorbent assay) in a final reaction volume of 100 µl for 30 min at 37°C. After a washing, fluorescein isothiocyanate (FITC)-labeled goat anti-mouse IgG (Sigma-Aldrich) diluted 1:100 in 1% bovine serum albumin-HBSS++ was used to detect bacterium-bound fH/Fc fusion proteins. To detect the binding of fH, bacteria were incubated with either purified human fH (0.5 µg or as indicated) or heat-inactivated (HI) NHS (at the concentrations indicated in Fig. 5). HI serum does not support the activation of C3 to C3b and was used to prevent fH-C3b interactions that would confound measurements intended to detect direct binding of fH in serum to bacterial surfaces. Bound fH was detected by using monoclonal antibody 90X (MAb 90X; specific for SCR 1; detects both full-length fH and FHL-1) and FITC-conjugated anti-mouse IgG (Sigma) as previously described (34). The binding of FHL-1 was detected similarly, following the incubation of bacteria with 0.5 µg of purified FHL-1. The binding of C3 to bacteria was detected as previously described, using anti-human C3c-FITC (Biodesign/Meridian Life Science, Inc.) (34). Flow cytometry was performed using a FACSCalibur instrument (Becton Dickinson), and data analysis was performed using the FlowJo data analysis software package (Tree Star, Inc.).


Figure 5
View larger version (35K):
[in this window]
[in a new window]

  		FIG. 5. The amounts of fH bound to Y2220 siaD porF62 and Y2220 siaD fHbpH44/76 were compared, using a FACS assay over a range of fH concentrations. Representative histogram plots of full-length fH binding to Y2220 siaD fHbpH44/76 and Y2220 siaD porF62 when the strains were incubated with either HI NHS (upper panel) concentrations of 5, 10, 25, 50, or 100% or purified fH (lower panel), the latter at concentrations of 1.25, 2.5, 5, or 10 µg/ml. Median values for each histogram are indicated. HI-NHS and pure fH were omitted from controls (dashed lines). The x axis represents fluorescence on a log10 scale, and the y axis represents the number of events. The results of an experiment representative of at least three independent experiments are shown.

Serum bactericidal assay. The susceptibility of meningococci to complement-mediated killing was determined by using a serum bactericidal assay as described previously (30). Bacteria from an overnight culture on chocolate agar plates were inoculated onto fresh chocolate agar and allowed to grow for ~6 h at 37°C in 5% CO2. Briefly, ~2,000 CFU of meningococci were incubated with sera (concentrations specified for each experiment in Fig. 6) in a final reaction volume of 150 µl. Aliquots of 25 µl were plated in duplicate at the start of the assay (t0) and after the reaction mixture was incubated at 37°C for 30 min (t30). The percent survival was calculated as the number of viable colonies at t30 relative to the baseline colony counts at t0. Each experiment was repeated a minimum of three times.


Figure 6
View larger version (36K):
[in this window]
[in a new window]

  		FIG. 6. fH that binds to PorF62 regulates the alternative pathway of complement more efficiently than fH that binds to fHbpH44/76. C3 binding to Y2220 siaD porF62 is diminished compared to C3 binding to Y2220 siaD fHbpH44/76 or the control Y2220 siaD. Organisms were incubated in 10% NHS, and C3 was measured by FACS, using FITC-conjugated anti-human C3c. Y2220 siaD meningococci that expressed PorF62 showed diminished C3 deposition (at both 3 and 30 min) compared to strains that expressed fHbpH44/76. The x axis represents fluorescence on a log10 scale, and the y axis represents the number of events. The numbers represent the median fluorescence intensity of C3 binding. The results of an experiment representative of at least three independent experiments are shown.


arrow
RESULTS
 
fH SCR 6 binds to all three variant fHbp families. Full-length human fH binds to all three variant families of fHbp (28). To determine the fH SCRs that are involved in binding to fHbp, we constructed fusion proteins that contain contiguous fH SCRs fused at their C termini to the Fc portion of IgG2a. We examined the ability of six fH/Fc fusion constructs (SCR 1-5/Fc, SCR 1-6/Fc, SCR 5-8/Fc, SCR 6-10/Fc, SCR 11-15/Fc, and SCR 16-20/Fc) to bind to meningococcal strains H44/76, RM1090, and M1239, which express variant 1, 2, or 3 fHbp proteins, respectively. Previously, we established that none of these strains bind fH in the absence of fHbp (28). As seen in Fig. 1 and 2 (SCR 5-8/Fc shown in Fig. 2), only those fH/Fc proteins that contained SCR 6 (SCR 1-6/Fc, SCR 5-8/Fc, and SCR 6-10/Fc) bound to all three strains. These data suggest that SCR 6 is important for the binding of fH to all fHbp variant proteins. These data do not unequivocally exclude the possibility that other fH SCRs, for example, SCR 7 and SCR 8, may also play a role in the binding of fH to fHbp. Furthermore, another recombinant fH molecule that contained SCR 8-20 was tested using the variant 1 fHbp meningococcal strain H44/76, and it did not bind (data not shown). Attempts to construct an fH/Fc fusion molecule containing SCR 7-10 were not successful.


Figure 1
View larger version (28K):
[in this window]
[in a new window]

  		FIG. 1. Binding of fH/Fc fusion proteins to N. meningitidis. H44/76, RM1090, and M1239 represent meningococcal strains that express variant 1, 2, or 3 fHbp proteins, respectively. All three fHbp variants bound only to fH/Fc fusion constructs that contained SCR 6 (SCR 1-6/Fc and SCR 6-10/Fc) of fH. In all graphs, the x axis represents fluorescence intensity on a log10 scale, and the y axis represents the number of events. No fusion protein is present in the control tube. The results for one experiment representative of at least three independent experiments are shown.

Histidine residues in human SCR 6 are important for fH binding to meningococci. Site-directed mutagenesis was employed to examine the amino acids in human fH SCR 6 that are required for binding to fHbp. Nine SCR 6 amino acids were selected for mutagenesis after the following considerations were addressed. The recently solved crystal structure of human fH SCR 6-8402H (His 402 is a polymorphism in SCR 7 that is associated with age-related macular degeneration) in complex with the polyanion sucrose octasulfate (SOS) (38) identified six surface-exposed amino acid residues in SCR 6 that are important for binding to polyanions (His 337, Arg 341, Tyr 352, Ser 354, His 360, and His 371) (Fig. 2A). Binding to SCR 6 was pH dependent, supporting a major role for the histidine side chains in glycan coordination (38) and prompting our speculation that these amino acids might be important for the binding of fH to fHbp. In addition, a comparison of the amino acid sequence of human SCR 6, which binds fHbp, with rhesus fH SCR 6, which does not bind N. meningitidis (15), revealed differences in 9 amino acids (Fig. 2A). We hypothesized that one or more of these species-specific amino acids may also be involved in the binding of human SCR 6 to fHbp. A similar species-specific approach was used successfully to define the amino acids in C4BP that are required for binding to gonococci (21, 33). Four of the nine species-specific amino acids (His 337, Tyr 352, His 360, and His 371) were also identified in the crystal structure as important for SOS binding. Of note, two of the amino acids (Arg 341 and Ser 354) are conserved in both rhesus and human fH SCR 6, and these amino acids were not investigated further.

A concern when making point mutations is the structural integrity of the resultant mutant protein. Taking into account that through evolution, the structure-function relationships of complement molecules are likely to have been preserved, we believe that mutating the amino acids in human fH to their counterparts in rhesus fH would be less likely to cause major alterations in the tertiary structure of the protein. We therefore constructed human-to-rhesus point mutations in human SCR 6 in the background of human fH SCR 5-8/Fc to study the effects of amino acid alterations of fH-fHbp binding. Here we present data on the mutation of His 337, His 360, and His 371, amino acids that are important for binding to polyanions and for species specificity. Mutation of the remaining six amino acids (T321S, K323R, N339S, A348P, Y352H, and Y353F) did not impact the binding of the mutated human fH SCR 5-8/Fc construct to fHbp-bearing N. meningitidis (data not shown).

Each of the three His residues (H337Y, H360P, and H371Y) was mutated individually and in combination with the other two His residues. Binding of the mutated human SCR 5-8/Fc constructs to each of three meningococcal strains, each representative of one of the three fHbp variant families, was examined by flow cytometry. Replacement of H337 with the rhesus counterpart (H337Y) resulted in decreased binding to strains expressing fHbp variants 2 and 3 but had no impact on binding to the fHbp variant 1-expressing strain (Fig. 2). A single mutation of H360 or H371 did not impact binding to any fHbp variant. The H337Y H360P double mutant decreased binding of the human SCR 5-8/Fc construct to variant 2 and 3 strains (consistent with the H337Y mutation alone) but not to the variant 1 strain. Binding of this construct to fHbp variant 3 was completely abolished. The H337Y H371Y mutation resulted in a reduction in the binding of the fusion construct to all three fHbp variant proteins; of note, this is the only construct with decreased binding to the variant 1 fHbp. Binding of the H337Y H371Y construct to the variant 1 and 3 fHbp-bearing strains was completely lost; partial binding to the variant 2 protein was detected. The H360P H371Y construct bound well to all three fHbp variants, consistent with the single-mutation studies. Together, these data indicate that His 337 is important for the binding of human SCR 5-8 to fHbp from variant 2 and 3 families. Furthermore, His 337 in human SCR 5-8 acts cooperatively with His 371 to bind to the variant 1 protein. These results suggest that the manner in which human SCR 5-8 interacts with fHbp variant 1 differs slightly from the interactions with variant 2 and variant 3 proteins.

The binding (or partial binding) of mutated human SCR 5-8/Fc constructs to at least one fHbp variant family suggests that the approach of making human-to-rhesus point mutations was successful and did not result in disruption of the tertiary structure of the protein.

Meningococci bind FHL-1. Human serum contains both fH (~550 µg/ml) and FHL-1 (~10 to 50 µg/ml) (17, 26). FHL-1 is an alternatively spliced variant of fH. The first seven N-terminal SCRs of fH are also present in FHL-1. FHL-1 differs from fH in that SCR 7 of FHL-1 is spliced to a separate exon that encodes four unique C-terminal amino acids (SFTL) (53). FHL-1 has both complement regulatory and cell attachment properties, and binding of FHL-1 may contribute to serum resistance and attachment to host cells (17). The ability of meningococci to bind to fH via SCR 6 raises the possibility that meningococci might also bind to FHL-1. We examined the binding of purified recombinant FHL-1 to meningococci expressing variant 1, 2, or 3 fHbp by FACS, using MAb 90X. MAb 90X recognizes fH SCR 1 and therefore can detect both full-length fH and FHL-1. As seen in Fig. 3A, all three meningococcal strains bind FHL-1. Consistent with its high expression levels of fHbp, the variant 1 strain H44/76 exhibited the highest level of binding to FHL-1.


Figure 3
View larger version (27K):
[in this window]
[in a new window]

  		FIG. 3. Binding of N. meningitidis to FHL-1. (A) Binding of purified recombinant FHL-1 to N. meningitidis strains that express variant 1, 2, or 3 fHbp. In all graphs, the x axis represents fluorescence on a log10 scale, and the y axis represents the number of events. A representative isotype control (using variant 1 fHbp strain H44/76) in which purified FHL-1 was omitted from the reaction mixture is shown (broken line).

Comparison of fH binding to meningococcal fHbp and gonococcal porin in an isogenic background with sialylated LOS. The binding of fH to meningococcal fHbp involves SCR 6 and is independent of LOS sialylation. In contrast, the binding of fH to gonococci involves the porin molecules (PorB.1A and PorB.1B) and is enhanced by sialylation of LNT LOS (42). The binding of fH to sialylated gonococci involves SCR 18-20 (34). To compare the functional consequences of fH binding to meningococcal fHbp via SCR 6 with fH binding to gonococcal PorB.1B via SCR 18-20 in an isogenic background, we employed meningococcal strains Y2220 siaD fHbpH44/76 (see below), which expresses a variant 1 fHbp, and Y2220 siaD porF62, which expresses a gonococcal PorB.1B (27, 28). We did not include a comparison of fH binding to PorB.1A, as PorB.1A mediates binding to C4BP, which would confound interpretation of the results of functional tests such as serum bactericidal assays (40). Meningococcal porins in the context of intact bacteria do not bind to fH (27, 28, 46) or to C4BP when physiological isotonic buffers are used (22). Meningococcal strain Y2220 siaD is an unencapsulated (siaD::cat) serogroup Y strain that expresses its own variant 2/3 hybrid fHbp molecule in very small amounts, resulting in the barely detectable binding of fH (27) (Fig. 4A, upper panel). Consistent with its inability to bind the full-length fH molecule, Y2220 siaD also does not bind fH/Fc fusion proteins (Fig. 4A, upper panel). To study fH-fHbp interactions, we used a variant of Y2220 siaD in which the native fHbp (fHbpY2220) is replaced with fHbp from strain H44/76 (fHbpH44/76). This allelic replacement results in high-level expression of the variant 1 protein in the background of a meningococcus with a sialylated LNT LOS (28). This mutant binds full-length fH and, as expected, also binds SCR 6 (Fig. 4A, middle panel). To study fH-gonococcal PorB.1B interactions in an isogenic background, we used a variant of Y2220 siaD in which the native porB2Y2220 (meningococcal porins do not bind to fH in the context of intact bacteria) is replaced with porB.1B from N. gonorrhoeae strain F62 (Y2220 siaD porF62). Expression of PorF62 in the Y2220 siaD background results in increased fH binding (27). We have shown previously that sialylation of neisserial LNT LOS results in enhanced fH binding only when gonococcal Por is concomitantly expressed. This mutant binds the full-length fH and SCR 16-20/Fc (Fig. 4A, lower panel), which is consistent with our prior observations that the C-terminal region of fH binds to sialylated gonococci (34). These two isogenic strains allowed us to make comparisons between the properties of fH binding to Neisseria spp. through these two distinct receptors.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

  		FIG. 4. Binding of fH to fHbpH44/76 and PorF62 in an isogenic background. (A) Binding of the full-length fH or the indicated fH/Fc fusion proteins to N. meningitidis Y2220 siaD expressing either fHbpH44/76 (Y2220 siaD fHbpH44/76; middle row) or PorF62 (Y2220 siaD porF62; bottom row). Y2220 siaD expresses small amounts of a variant 2/3 hybrid fHbp and does not bind fH (top row). In all graphs, the x axis represents fluorescence on a log10 scale, and the y axis represents the number of events. (B) The influence of ionic strength on the binding of full-length fH to Y2220 siaD fHbpH44/76 and Y2220 siaD porF62 was studied by flow cytometry. The binding of fH to Y2220 siaD porF62 decreased as the ionic strength of the assay buffer was increased. The binding of fH to Y2220 siaD fHbpH44/76 was minimally diminished at NaCl concentrations of 0.4 M and 1 M. Control binding of these strains to full-length fH in HBSS++ is also shown. The x axis represents fluorescence on a log10 scale, and the y axis represents the number of events.

Qualitative differences in the binding of fH to meningococcal fHbp and gonococcal porin. The binding of fH to PorF62 is mediated through an interaction with SCR 16-20, while the interaction of fH with fHbp H44/76 is mediated through an interaction with SCR 6. The nature of the binding of fH to each of these ligands (Y2220 siaD porF62 and Y2220 siaD fHbpH44/76) was examined in the presence of buffers of increasing ionic strength. The binding of fH to Y2220 siaD porF62 decreased as the ionic strength of the assay buffer was increased (Fig. 4B). This finding is consistent with an ionic interaction between these two molecules. In contrast, the binding of fH to Y2220 siaD fHbpH44/76 was minimally affected by the increase in ionic strength, suggesting that this interaction is nonionic and possibly hydrophobic. While the most likely cause of this difference is charge neutralization or a change in the charge of the substrate and/or receptor, we cannot rule out the possibility of conformational changes to Por or the sialylated LOS in the high salt environment. Nevertheless, these data highlight differences in the binding of fH SCR 6 to fHbpH44/76 and fH SCR 16-20 to PorF62.

Meningococci with sialylated LOS that express gonococcal porin bind more fH than meningococci with sialylated LOS that express fHbp. Porin is the most abundant protein found in the outer membrane of gonococci (23, 35). The amount of fHbp expressed varies among strains, but it is expressed at a much lower level than porin, even in strains that express high levels of fHbp (29). The effects of copy number on fH binding were compared by measuring the amount of fH bound to Y2220 siaD porF62 and Y2220 siaD fHbpH44/76, using a FACS assay and a range of fH concentrations. Strains that expressed PorF62 bound more fH at all concentrations tested (Fig. 5). This binding trend was observed in assays using both purified fH (1 to 10 µg/ml) and HI NHS (5 to 100%) as sources of human fH. Human fH is present in serum at a concentration of ~550 µg/ml. These data suggest that gonococcal Por may be able to bind more fH. This finding is likely to be biologically relevant because gonococci reside in the genital tract, an environment with a low concentration of fH (6).

fH bound to PorF62 on Neisseria with sialylated LOS regulates the AP of complement more efficiently than fH bound to fHbp. fH controls activation of the AP by dissociating the AP C3 and C5 convertases and by serving as a cofactor for the inactivation of C3b to iC3b (7, 36, 51, 52). C3 deposition can be used as a measure of fH function. We have demonstrated previously that fH possesses functional activity when it is recruited by fHbp and Por/sialylated LOS to the surfaces of meningococci and gonococci, respectively (28, 42). Above we have shown that PorF62 expression results in increased binding of fH to Y2220 siaD porF62 compared to fH binding to fHbpH44/76 on Y2220 siaD fHbpH44/76. To determine the functional consequences of these differences, we compared C3 deposition at different time points after the exposure of organisms to NHS. The amounts of C3 binding to Y2220 siaD porF62 (binds fH through SCR 16-20) and Y2220 siaD fHbpH44/76 (binds fH through SCR 6) were compared after bacteria were incubated with NHS. The expression of PorF62 more effectively limited deposition of C3 than the expression of fHbpH44/76 (Fig. 6).

Correlation of the degree of serum resistance with the mechanism of fH binding. The binding of fH to PorF62 is mediated through an ionic interaction with SCR 16-20, while the interaction of fH with fHbpH44/76 is most likely mediated through a nonionic/hydrophobic interaction with SCR 6. The expression of PorF62 allows for quantitatively more fH binding than the expression of fHbpH44/76 and is associated with less C3 deposition. To determine if these differences in fH binding translated into differences in protection from complement-dependent killing, we measured the relative percent survival of the recombinant strains in NHS. We observed that Y2220 siaD porF62 was more serum resistant than Y2220 siaD fHbpH44/76 (Fig. 7). The levels of IgG and IgM binding to the two mutant strains were similar, indicating that differences in antibody binding did not account for differences in survival in NHS (data not shown). These data suggest that PorF62, in association with sialylated LOS, is more effective at regulating complement activation on Y2220 siaD than is fHbpH44/76.


Figure 7
View larger version (12K):
[in this window]
[in a new window]

  		FIG. 7. Y2220 siaD porF62 is more serum resistant than Y2220 siaD fHbpH44/76. Serum bactericidal assays were performed using Y2220 siaD, Y2220 siaD porF62, or Y2220 siaD fHbpH44/76 and 3.3 and 6.6% NHS as indicated. The x axis represents the strain, and the y axis represents the percent survival. Values represent average percent survival calculated from three or more independently performed experiments.


arrow
DISCUSSION
 
In this study, we have shown that fH SCR 6 contains a binding site for all three variants of fHbp. We utilized the available crystal structure of fH SCR 6-8402His and the species-specific binding of fH to meningococci to map the amino acids in fH SCR 6 that are important for binding to fHbp (15, 34, 38). Specifically, His 337 and His 371 were found to be important for the binding of fH to fHbp. The mutation of His 337 was sufficient to decrease the binding of fH to the variant 2 and 3 fHbp proteins, while mutations of both His 371 and His 337 together were required to abolish binding to the variant 1 fHbp on H44/76. Our findings provide further understanding of the molecular basis of human-specific binding of fH to meningococci. His 337 and His 371 were also identified by Prosser et al. as key residues of SCR 6 involved in coordinating binding of the polyanion SOS (38). The SCR 6 polyanion binding site contains a central positively charged arginine residue (Arg 341) flanked by two histidine side chains (His 337 and His 371) that directly coordinate sulfate groups in the ligand. Binding was pH dependent, implicating a crucial role for these histidine residues. Of note, heparin also binds to SCR 6, and the mutation of His 337 decreases the affinity of SCR 6 for heparin. His 337 not only plays an important role in mediating heparin binding to fH SCR 6 but also plays an important role in the fH SCR 6-fHbp interaction; the glycosaminoglycans heparin and SOS were able to inhibit the binding of fH to meningococci expressing all three variants of fHbp (see Fig. S1 in the supplemental material), suggesting that the points of contact between fH and fHbp are coincident with the SCR 6-polyanion interaction sites.

His 360 appears to play only a minor role in the binding of fH to fHbp. Although the mutation of His 360 in conjunction with the His 337 mutation further decreased the binding of fH to variant 3 fHbp compared to that of His 337 alone, the addition of the His 360 mutation to the His 337 mutation did not further impact the binding of fH SCR 6 to the variant 1 or 2 proteins. This result is also consistent with the studies of Prosser et al., who found that His 360 was important for the binding of polyanions only to the polymorphic disease-associated fH variant that contains His at position 402 (38). In that model, His 402 from SCR 7 and His 360 from SCR 6 formed a histidine clamp around the sulfate groups of SOS. Wild-type fH contains tyrosine at position 402 (Tyr 402) in SCR 7, and a polyanion binding site would not be predicted to form with Tyr 402 (38).

Schneider et al. recently solved the crystal structure of fH SCR 67 in complex with a variant 1 fHbp (47). Their findings are consistent with ours and corroborate that the variant 1 fHbp interacts with fH SCR 6. The SCR 6-fHbp complex is held together by numerous electrostatic interactions, including many hydrogen bonds and salt bridges; only minor contact with SCR 7 was noted (47). The fHbp binding site was found to overlap with the SOS binding site in fH SCR 6, and both SOS and heparin inhibited the interaction of SCR 67 with fHbp (47). In agreement with our findings, the fH-SCR 67 interaction was resistant to 1 M NaCl, a finding that may possibly reflect the high-affinity interaction (dissociation constant [Kd] of ~5 nM) reported by this group (47).

We found that both His 337 and His 371 were important for the binding of SCR 6 to the variant 1 fHbp. These two SCR 6 amino acids are located in the interaction surface described by Schneider et al. (47). His 371 is proposed to be involved in a salt bridge with fHbp, while His 337 is likely involved in a hydrogen bond with fHbp. Arg 341 of SCR 6, which is important for SOS binding (as described above), was also reported to form a salt bridge with fHbp (47). A double mutation (R341A and H337A) in SCR 6 abolished binding to the variant 1 fHbp (47). The phenotypes of H337A and R341A single mutations were not reported in the Schneider study; however, our data indicate that a His 337 single mutation is not sufficient to abolish binding of SCR 6 to the variant 1 fHbp. Taken together, these data suggest that Arg 341 also plays a key role in the binding of SCR 6 to variant 1 fHbp. These findings are in agreement with the polyanion binding site of SCR 6 as described by Prosser et al.

Three variant families of fHbp have been described. The three alleles elicit little immunologic cross-bactericidal response; sequence similarity ranges from 63% between variants 1 and 3 to 74% between variants 1 and 2 and 85% between variants 2 and 3 (29). Subtle differences in the amino acids of fH SCR 6 that interact with variant 1 fHbp versus variant 2 and variant 3 fHbps were apparent, which is seemingly consistent with the overall sequence variability among these proteins.

In this study, we also identified FHL-1 as a human complement regulatory protein that binds to N. meningitidis. Meningococcal strains bearing all three variants of fHbp bound to FHL-1. This observation is consistent with our finding that human fH SCR 6 is involved in the fH-fHbp interaction. Similarly, gonococcal strains bearing PorB.1A that bind fH via SCR 6 and SCR 18-20 bind to FHL-1, while gonococci with sialylated LOS expressing PorB.1B that bind fH via SCR 18-20 (but not SCR 6) do not bind FHL-1 (34). Although the binding of FHL-1 to PorB.1A-expressing gonococci is weak, FHL-1 can rescue PorB.1A gonococci from killing by primate sera; rescue requires an approximately fivefold molar excess of FHL-1 compared to fH (34). Binding of FHL-1 to surface ligands has been reported for several other pathogens, including Streptococcus pyogenes, Treponema pallidum, and numerous Borrelia species (25). Borrelia burgdorferi expresses a number of complement regulator-acquiring surface proteins, or CRASPs, that bind to members of the fH family of proteins. CRASP-1 and CRASP-2 bind both fH and FHL-1 and are associated with serum resistance; CRASP-1 preferentially binds fH, while CRASP-2 preferentially binds FHL-1 (16). It has been speculated that in Borrelia species, differential binding to host complement regulators such as fH and FHL-1 may modulate escape from host immune attack (16). Both N. meningitidis expressing fHbp and N. gonorrhoeae expressing PorB.1A interact with fH SCR 6; however, the binding of FHL-1 to meningococci is superior to that seen with PorB.1A-expressing gonococci (see Fig. S2 in the supplemental material). The role of FHL-1 in serum resistance and/or cell adhesion of meningococci and PorB.1A-expressing gonococci remains to be determined.

Using isogenic mutant strains, we have shown that differences in fH binding to bacterial surfaces are correlated with differences in protection against complement-mediated bacterial killing. Binding of fH to meningococci is mediated by the relatively low-density receptor fHbp and is independent of LOS sialylation. We have shown that SCR 6 of fH is involved in the binding of fH to fHbp. In the context of intact bacteria, meningococcal porins do not bind to fH (27, 28, 46). In contrast, gonococci bind to fH through an interaction with gonococcal porin, which is the most highly expressed protein in the gonococcal outer membrane. Binding of fH to one of the two main types of porin, PorB.1B, requires LOS sialylation and involves SCR 18 to 20 of fH (34, 42). It is not known if a ternary complex between fH SCR 18-20, PorB.1B, and sialylated LOS is formed or if LOS sialylation in some way facilitates an fH-PorB.1B interaction that cannot otherwise occur when LOS is not sialylated. Our studies indicate that fH binding to gonococci in this context is more efficient in thwarting complement-mediated killing than fH binding to meningococcal fHbp; this increased binding correlated with decreased C3 deposition and increased serum resistance.

These results underscore the importance of fH for the serum resistance of N. gonorrhoeae. Meningococci normally reside on the nasopharyngeal epithelium and enter the bloodstream to cause disease. Although the expression of fHbp contributes to the ability of meningococci to resist complement-dependent killing, it is not sufficient to confer serum resistance. Expression of capsular polysaccharide is necessary for high-level serum resistance and invasion of the bloodstream (24, 50). Unencapsulated meningococcal mutants are susceptible to killing by NHS despite the expression of fHbp and their ability to bind to fH via this interaction. In addition, sialylation of meningococcal LOS contributes only marginally to serum resistance (12, 49). In contrast, N. gonorrhoeae colonizes epithelial cells of the genital tract and LOS sialylation leads to serum resistance (32). Sialylation of LOS enhances the binding of fH and allows gonococci to effectively resist complement-dependent killing (42). fH bound to gonococci functions to increase the conversion of C3b to iC3b (inactive C3b) and to decrease C3 deposition by inactivating the AP C3 convertase. N. gonorrhoeae does not produce a capsule, and strains that invade the bloodstream are stably serum resistant (not dependent on LOS sialylation) by virtue of their ability to also bind C4BP and regulate the classical pathway (39).

A balance between complement activation and the efficiency of complement regulation determines whether a bacterium survives or is killed by serum. Our studies indicate that the differences in the interactions of these pathogens with fH and the localization of these organisms to specific niches may reflect their needs. The ability of meningococci to invade the bloodstream is dependent on the expression of a polysaccharide capsule. fH is abundant in the bloodstream (~550 µg/ml), and the fHbp-fH interaction may be optimized to meet the needs of a serum-resistant organism growing in an environment with high concentrations of fH. In contrast, gonococci must scavenge fH efficiently, as this may be critically important to keep C3 deposition to a minimum in the genitourinary tract, a niche where fH is less abundant.


arrow
ACKNOWLEDGMENTS
 
This work was supported by National Institutes of Health grants AI054544 and AI32725.

We thank Peter A. Rice for critical reading of the manuscript and Brian Monks for excellent technical assistance. We also thank Jo Anne Welsch (Children's Hospital Oakland Research Institute) for providing meningococcal strains RM1090 and M1239 and Ulrich Vogel (Universität Würzburg) for strain Y2220 siaD.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Division of Infectious Diseases and Immunology, University of Massachusetts Medical School, Lazare Research Building, Room 370I, Plantation Street, Worcester, MA 01605. Phone: (508) 856-587. Fax: (508) 856-5463. E-mail: lisa.lewis{at}umassmed.edu Back

{triangledown} Published ahead of print on 9 March 2009. Back

{dagger} Supplemental material for this article may be found at http://iai.asm.org/. Back

Editor: J. N. Weiser

{ddagger} These authors contributed equally to this work. Back


arrow
REFERENCES
 
    1
  1. Biedzka-Sarek, M., H. Jarva, H. Hyytiainen, S. Meri, and M. Skurnik. 2008. Characterization of complement factor H binding to Yersinia enterocolitica serotype O:3. Infect. Immun. 76:4100-4109.[Abstract/Free Full Text]
    2. 2
  2. Brissette, C. A., A. E. Cooley, L. H. Burns, S. P. Riley, A. Verma, M. E. Woodman, T. Bykowski, and B. Stevenson. 2008. Lyme borreliosis spirochete Erp proteins, their known host ligands, and potential roles in mammalian infection. Int. J. Med. Microbiol. 298(Suppl. 1):257-267.[CrossRef][Medline]
    3. 3
  3. Bykowski, T., M. E. Woodman, A. E. Cooley, C. A. Brissette, R. Wallich, V. Brade, P. Kraiczy, and B. Stevenson. 2008. Borrelia burgdorferi complement regulator-acquiring surface proteins (BbCRASPs): expression patterns during the mammal-tick infection cycle. Int. J. Med. Microbiol. 298(Suppl. 1):249-256.[CrossRef][Medline]
    4. 4
  4. China, B., M.-P. Sory, B. T. N'Guyen, M. De Bruyere, and G. R. Cornelis. 1993. Role of the YadA protein in prevention of opsonization of Yersinia enterocolitica by C3b molecules. Infect. Immun. 61:3129-3136.[Abstract/Free Full Text]
    5. 5
  5. Comanducci, M., S. Bambini, B. Brunelli, J. Adu-Bobie, B. Arico, B. Capecchi, M. M. Giuliani, V. Masignani, L. Santini, S. Savino, D. M. Granoff, D. A. Caugant, M. Pizza, R. Rappuoli, and M. Mora. 2002. NadA, a novel vaccine candidate of Neisseria meningitidis. J. Exp. Med. 195:1445-1454.[Abstract/Free Full Text]
    6. 6
  6. Dasari, S., L. Pereira, A. P. Reddy, J. E. Michaels, X. Lu, T. Jacob, A. Thomas, M. Rodland, C. T. Roberts, Jr., M. G. Gravett, and S. R. Nagalla. 2007. Comprehensive proteomic analysis of human cervical-vaginal fluid. J. Proteome Res. 6:1258-1268.[CrossRef][Medline]
    7. 7
  7. Fearon, D. T., and K. F. Austen. 1977. Activation of the alternative complement pathway due to resistance of zymosan-bound. Proc. Natl. Acad. Sci. USA 74:1683-1687.[Abstract/Free Full Text]
    8. 8
  8. Figueroa, J., J. Andreoni, and P. Densen. 1993. Complement deficiency states and meningococcal disease. Immunol. Res. 12:295-311.[Medline]
    9. 9
  9. Fijen, C. A., E. J. Kuijper, M. T. te Bulte, M. R. Daha, and J. Dankert. 1999. Assessment of complement deficiency in patients with meningococcal disease in The Netherlands. Clin. Infect. Dis. 28:98-105.[Medline]
    10. 10
  10. Findlow, H., U. Vogel, J. E. Mueller, A. Curry, B. M. Njanpop-Lafourcade, H. Claus, S. J. Gray, S. Yaro, Y. Traore, L. Sangare, P. Nicolas, B. D. Gessner, and R. Borrow. 2007. Three cases of invasive meningococcal disease caused by a capsule null locus strain circulating among healthy carriers in Burkina Faso. J. Infect. Dis. 195:1071-1077.[CrossRef][Medline]
    11. 11
  11. Fletcher, L. D., L. Bernfield, V. Barniak, J. E. Farley, A. Howell, M. Knauf, P. Ooi, R. P. Smith, P. Weise, M. Wetherell, X. Xie, R. Zagursky, Y. Zhang, and G. W. Zlotnick. 2004. Vaccine potential of the Neisseria meningitidis 2086 lipoprotein. Infect. Immun. 72:2088-2100.[Abstract/Free Full Text]
    12. 12
  12. Fox, A. J., D. M. Jones, S. M. Scotland, B. Rowe, A. Smith, M. R. Brown, R. G. Fitzgeorge, A. Baskerville, N. J. Parsons, J. A. Cole, et al. 1989. Serum killing of meningococci and several other gram-negative bacterial species is not decreased by incubating them with cytidine 5'-monophospho-N-acetyl neuraminic acid. Microb. Pathog. 7:317-318.[CrossRef][Medline]
    13. 13
  13. Frasch, C. E., W. D. Zollinger, and J. T. Poolman. 1985. Serotype antigens of Neisseria meningitidis and a proposed scheme for designation of serotypes. Rev. Infect. Dis. 7:504-510.[Medline]
    14. 14
  14. Friberg, N., P. Carlson, E. Kentala, P. S. Mattila, P. Kuusela, S. Meri, and H. Jarva. 2008. Factor H binding as a complement evasion mechanism for an anaerobic pathogen, Fusobacterium necrophorum. J. Immunol. 181:8624-8632.[Abstract/Free Full Text]
    15. 15
  15. Granoff, D. M., J. A. Welsch, and S. Ram. 2009. Binding of complement factor H (FH) to Neisseria meningitidis is specific for human FH and inhibits complement activation by rat and rabbit sera. Infect. Immun. 77:764-769.[Abstract/Free Full Text]
    16. 16
  16. Haupt, K., P. Kraiczy, R. Wallich, V. Brade, C. Skerka, and P. F. Zipfel. 2007. Binding of human factor H-related protein 1 to serum-resistant Borrelia burgdorferi is mediated by borrelial complement regulator-acquiring surface proteins. J. Infect. Dis. 196:124-133.[CrossRef][Medline]
    17. 17
  17. Hellwage, J., S. Kuhn, and P. F. Zipfel. 1997. The human complement regulatory factor-H-like protein 1, which represents a truncated form of factor H, displays cell-attachment activity. Biochem. J. 326:321-327.[Medline]
    18. 18
  18. Horstmann, R. D., M. K. Pangburn, and H. J. Muller-Eberhard. 1985. Species specificity of recognition by the alternative pathway of complement. J. Immunol. 134:1101-1104.[Abstract]
    19. 19
  19. Hou, V. C., O. Koeberling, J. A. Welsch, and D. M. Granoff. 2005. Protective antibody responses elicited by a meningococcal outer membrane vesicle vaccine with overexpressed genome-derived neisserial antigen 1870. J. Infect. Dis. 192:580-590.[CrossRef][Medline]
    20. 20
  20. Jarva, H., J. Hellwage, T. S. Jokiranta, M. J. Lehtinen, P. F. Zipfel, and S. Meri. 2004. The group B streptococcal β and pneumococcal Hic proteins are structurally related immune evasion molecules that bind the complement inhibitor factor H in an analogous fashion. J. Immunol. 172:3111-3118.[Abstract/Free Full Text]
    21. 21
  21. Jarva, H., J. Ngampasutadol, S. Ram, P. A. Rice, B. O. Villoutreix, and A. M. Blom. 2007. Molecular characterization of the interaction between porins of Neisseria gonorrhoeae and C4b-binding protein. J. Immunol. 179:540-547.[Abstract/Free Full Text]
    22. 22
  22. Jarva, H., S. Ram, U. Vogel, A. M. Blom, and S. Meri. 2005. Binding of the complement inhibitor C4bp to serogroup B Neisseria meningitidis. J. Immunol. 174:6299-6307.[Abstract/Free Full Text]
    23. 23
  23. Judd, R. C. 1989. Protein I: structure, function, and genetics. Clin. Microbiol. Rev. 2(Suppl.):S41-S48.[Free Full Text]
    24. 24
  24. Kahler, C. M., L. E. Martin, G. C. Shih, M. M. Rahman, R. W. Carlson, and D. S. Stephens. 1998. The ({alpha}2->8)-linked polysialic acid capsule and lipooligosaccharide structure both contribute to the ability of serogroup B Neisseria meningitidis to resist the bactericidal activity of normal human serum. Infect. Immun. 66:5939-5947.[Abstract/Free Full Text]
    25. 25
  25. Kraiczy, P., and R. Wurzner. 2006. Complement escape of human pathogenic bacteria by acquisition of complement regulators. Mol. Immunol. 43:31-44.[CrossRef][Medline]
    26. 26
  26. Kühn, S., and P. F. Zipfel. 1996. Mapping of the domains required for decay acceleration activity of the human factor H-like protein 1 and factor H. Eur. J. Immunol. 26:2383-2387.[Medline]
    27. 27
  27. Madico, G., J. Ngampasutadol, S. Gulati, U. Vogel, P. A. Rice, and S. Ram. 2007. Factor H binding and function in sialylated pathogenic neisseriae is influenced by gonococcal, but not meningococcal, porin. J. Immunol. 178:4489-4497.[Abstract/Free Full Text]
    28. 28
  28. Madico, G., J. A. Welsch, L. A. Lewis, A. McNaughton, D. H. Perlman, C. E. Costello, J. Ngampasutadol, U. Vogel, D. M. Granoff, and S. Ram. 2006. The meningococcal vaccine candidate GNA1870 binds the complement regulatory protein factor H and enhances serum resistance. J. Immunol. 177:501-510.[Abstract/Free Full Text]
    29. 29
  29. Masignani, V., M. Comanducci, M. M. Giuliani, S. Bambini, J. Adu-Bobie, B. Arico, B. Brunelli, A. Pieri, L. Santini, S. Savino, D. Serruto, D. Litt, S. Kroll, J. A. Welsch, D. M. Granoff, R. Rappuoli, and M. Pizza. 2003. Vaccination against Neisseria meningitidis using three variants of the lipoprotein GNA1870. J. Exp. Med. 197:789-799.[Abstract/Free Full Text]
    30. 30
  30. McQuillen, D. P., S. Gulati, and P. A. Rice. 1994. Complement-mediated bacterial killing assays. Methods Enzymol. 236:137-147.[Medline]
    31. 31
  31. Meri, S., and M. K. Pangburn. 1994. Regulation of alternative pathway complement activation by glycosaminoglycans: specificity of the polyanion binding site on factor H. Biochem. Biophys. Res. Commun. 198:52-59.[CrossRef][Medline]
    32. 32
  32. Nairn, C. A., J. A. Cole, P. V. Patel, N. J. Parsons, J. E. Fox, and H. Smith. 1988. Cytidine 5'-monophospho-N-acetylneuraminic acid or a related compound is the low Mr factor from human red blood cells which induces gonococcal resistance to killing by human serum. J. Gen. Microbiol. 134:3295-3306.[Abstract/Free Full Text]
    33. 33
  33. Ngampasutadol, J., S. Ram, A. M. Blom, H. Jarva, A. E. Jerse, E. Lien, J. Goguen, S. Gulati, and P. A. Rice. 2005. Human C4b-binding protein selectively interacts with Neisseria gonorrhoeae and results in species-specific infection. Proc. Natl. Acad. Sci. USA 102:17142-17147.[Abstract/Free Full Text]
    34. 34
  34. Ngampasutadol, J., S. Ram, S. Gulati, S. Agarwal, C. Li, A. Visintin, B. Monks, G. Madico, and P. A. Rice. 2008. Human factor H interacts selectively with Neisseria gonorrhoeae and results in species-specific complement evasion. J. Immunol. 180:3426-3435.[Abstract/Free Full Text]
    35. 35
  35. Nikaido, H. 1992. Porins and specific channels of bacterial outer membranes. Mol. Microbiol. 6:435-442.[CrossRef][Medline]
    36. 36
  36. Pangburn, M. K., R. D. Schreiber, and H. J. Muller-Eberhard. 1977. Human complement C3b inactivator: isolation, characterization, and demonstration of an absolute requirement for the serum protein β1H for cleavage of C3b and C4b in solution. J. Exp. Med. 146:257-270.[Abstract/Free Full Text]
    37. 37
  37. Parsons, N. J., P. V. Patel, E. L. Tan, J. R. Andrade, C. A. Nairn, M. Goldner, J. A. Cole, and H. Smith. 1988. Cytidine 5'-monophospho-N-acetyl neuraminic acid and a low molecular weight factor from human blood cells induce lipopolysaccharide alteration in gonococci when conferring resistance to killing by human serum. Microb. Pathog. 5:303-309.[CrossRef][Medline]
    38. 38
  38. Prosser, B. E., S. Johnson, P. Roversi, A. P. Herbert, B. S. Blaum, J. Tyrrell, T. A. Jowitt, S. J. Clark, E. Tarelli, D. Uhrin, P. N. Barlow, R. B. Sim, A. J. Day, and S. M. Lea. 2007. Structural basis for complement factor H-linked age-related macular degeneration. J. Exp. Med. 204:2277-2283.[Abstract/Free Full Text]
    39. 39
  39. Ram, S., M. Cullinane, A. M. Blom, S. Gulati, D. P. McQuillen, R. Boden, B. G. Monks, C. O'Connell, C. Elkins, M. K. Pangburn, B. Dahlback, and P. A. Rice. 2001. C4bp binding to porin mediates stable serum resistance of Neisseria gonorrhoeae. Int. Immunopharmacol. 1:423-432.[CrossRef][Medline]
    40. 40
  40. Ram, S., M. Cullinane, A. M. Blom, S. Gulati, D. P. McQuillen, B. G. Monks, C. O'Connell, R. Boden, C. Elkins, M. K. Pangburn, B. Dahlback, and P. A. Rice. 2001. Binding of C4b-binding protein to porin: a molecular mechanism of serum resistance of Neisseria gonorrhoeae. J. Exp. Med. 193:281-295.[Abstract/Free Full Text]
    41. 41
  41. Ram, S., D. P. McQuillen, S. Gulati, C. Elkins, M. K. Pangburn, and P. A. Rice. 1998. Binding of complement factor H to loop 5 of porin protein 1A: a molecular mechanism of serum resistance of nonsialylated Neisseria gonorrhoeae. J. Exp. Med. 188:671-680.[Abstract/Free Full Text]
    42. 42
  42. Ram, S., A. K. Sharma, S. D. Simpson, S. Gulati, D. P. McQuillen, M. K. Pangburn, and P. A. Rice. 1998. A novel sialic acid binding site on factor H mediates serum resistance of sialylated Neisseria gonorrhoeae. J. Exp. Med. 187:743-752.[Abstract/Free Full Text]
    43. 43
  43. Ram, S., U. Vogel, S. Gulati, G. Heinze, L. Wetzler, H.-K. Guttormsen, M. Frosch, and P. A. Rice. 1999. The interaction between factor H and Neisseria meningitidis. Mol. Immunol. 36:297. (Abstract.)
    44. 44
  44. Ripoche, J., A. J. Day, T. J. Harris, and R. B. Sim. 1988. The complete amino acid sequence of human complement factor H. Biochem. J. 249:593-602.[Medline]
    45. 45
  45. Ross, S. C., and P. Densen. 1984. Complement deficiency states and infection: epidemiology, pathogenesis and consequences of neisserial and other infections in an immune deficiency. Medicine (Baltimore) 63:243-273.[Medline]
    46. 46
  46. Schneider, M. C., R. M. Exley, H. Chan, I. Feavers, Y. H. Kang, R. B. Sim, and C. M. Tang. 2006. Functional significance of factor H binding to Neisseria meningitidis. J. Immunol. 176:7566-7575.[Abstract/Free Full Text]
    47. 47
  47. Schneider, M. C., B. E. Prosser, J. J. Caesar, E. Kugelberg, S. Li, Q. Zhang, S. Quoraishi, J. E. Lovett, J. E. Deane, R. B. Sim, P. Roversi, S. Johnson, C. M. Tang, and S. M. Lea. 18 February 2009, posting date. Neisseria meningitidis recruits factor H using protein mimicry of host carbohydrates. Nature. doi:10.1038/nature07769.[CrossRef]
    48. 48
  48. Seiler, A., R. Reinhardt, J. Sarkari, D. A. Caugant, and M. Achtman. 1996. Allelic polymorphism and site-specific recombination in the opc locus of Neisseria meningitidis. Mol. Microbiol. 19:841-856.[CrossRef][Medline]
    49. 49
  49. Vogel, U., H. Claus, G. Heinze, and M. Frosch. 1999. Role of lipopolysaccharide sialylation in serum resistance of serogroup B and C meningococcal disease isolates. Infect. Immun. 67:954-957.[Abstract/Free Full Text]
    50. 50
  50. Vogel, U., A. Weinberger, R. Frank, A. Muller, J. Kohl, J. P. Atkinson, and M. Frosch. 1997. Complement factor C3 deposition and serum resistance in isogenic capsule and lipooligosaccharide sialic acid mutants of serogroup B Neisseria meningitidis. Infect. Immun. 65:4022-4029.[Abstract]
    51. 51
  51. Weiler, J. M., M. R. Daha, K. F. Austen, and D. T. Fearon. 1976. Control of the amplification convertase of complement by the plasma protein β1H. Proc. Natl. Acad. Sci. USA 73:3268-3272.[Abstract/Free Full Text]
    52. 52
  52. Whaley, K., and S. Ruddy. 1976. Modulation of the alternative complement pathways by β1H globulin. J. Exp. Med. 144:1147-1163.[Abstract/Free Full Text]
    53. 53
  53. Zipfel, P. F., C. Skerka, J. Hellwage, S. T. Jokiranta, S. Meri, V. Brade, P. Kraiczy, M. Noris, and G. Remuzzi. 2002. Factor H family proteins: on complement, microbes and human diseases. Biochem. Soc. Trans. 30:971-978.[CrossRef][Medline]

Infection and Immunity, May 2009, p. 2094-2103, Vol. 77, No. 5
0019-9567/09/$08.00+0     doi:10.1128/IAI.01561-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shaughnessy, J.
Right arrow Articles by Ram, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shaughnessy, J.
Right arrow Articles by Ram, S.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»