Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Chai, L. Y. A. Articles by Netea, M. G. Search for Related Content PubMed PubMed Citation Articles by Chai, L. Y. A. Articles by Netea, M. G.

 Previous Article  |  Next Article 

Infection and Immunity, May 2009, p. 2184-2192, Vol. 77, No. 5
0019-9567/09/$08.00+0     doi:10.1128/IAI.01455-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Modulation of Toll-Like Receptor 2 (TLR2) and TLR4 Responses by Aspergillus fumigatus

Louis Y. A. Chai,^1,2,3 Bart Jan Kullberg,^1,2 Alieke G. Vonk,⁴ Adilia Warris,^2,5 Alessandra Cambi,⁶ Jean-Paul Latgé,⁷ Leo A. B. Joosten,^1,2 Jos W. M. van der Meer,^1,2 and Mihai G. Netea^1,2*

Departments of Medicine,¹ Pediatrics, Radboud University Nijmegen Medical Center, Nijmegen, The Netherlands,⁵ Nijmegen Institute for Infection, Inflammation and Immunity (N4i), P.O. Box 9101, Geert Grootplein, 6525 GA, Nijmegen, The Netherlands,² Department of Medicine, National University Hospital, 5 Lower Kent Ridge Road, Singapore 119074,³ Erasmus MC, University Medical Center Rotterdam, Department of Medical Microbiology and Infectious Diseases, s-Gravendijkwal 230, 3015 CE, Rotterdam, The Netherlands,⁴ Department of Tumour Immunology, Nijmegen Center for Molecular Life Sciences, Radboud University, Nijmegen, The Netherlands,⁶ Unite des Aspergillus, Institut Pasteur, 25, rue du Dr Roux, 75015 Paris, France⁷

Received 28 November 2008/ Returned for modification 13 December 2008/ Accepted 31 January 2009

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Toll-like receptor (TLR)-based signaling pathways in the host may be modulated by pathogens during the course of infection. We describe a novel immunomodulatory mechanism in which Aspergillus fumigatus conidia induce attenuation of TLR2- and TLR4-mediated interleukin (IL)-6 and IL-1β proinflammatory responses in human mononuclear cells with suppression of IL-1β mRNA transcription. Background TLR2 and TLR4 mRNA transcription was not influenced. A. fumigatus conidia induced TLR2 internalization and uptake into the phagosome with a resultant decrease in surface receptor expression. A. fumigatus hyphae, on the other hand, selectively downregulated the TLR4-mediated response. These novel immunosuppressive effects may facilitate the invasiveness of A. fumigatus.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Opportunistic fungal infections remain a significant cause of mortality and morbidity in immunocompromised patients. Aspergillus fumigatus is one of the most common infective molds worldwide (7). Acquisition of invasive aspergillosis results from inhalation of airborne conidia, which, in the absence of competent immune containment, is followed by germination, development of hyphae, and invasive disease.

Mononuclear phagocytes constitute an important component of host defense against A. fumigatus and also are the precursors of tissue macrophages involved in immune surveillance against invasive pulmonary aspergillosis (29, 31). Their ability to detect specific pathogen-associated molecular patterns of Aspergillus conidia involves expression of pathogen recognition receptors (PRRs), and the main families of these receptors are the Toll-like receptors (TLRs) and the lectin receptors. TLR2 and TLR4 have been reported to mediate recognition of various cell wall components of Aspergillus (2, 18, 19, 40), and dectin-1, a C-type lectin receptor, is the major PRR involved in the recognition of β-glucans (21, 29, 32). Although infection experiments with TLR-deficient mice have provided evidence for involvement of TLR2 and TLR4 in the host defense against A. fumigatus (1, 2), the relative importance of both these receptors and other TLRs remains to be determined. In addition, the inflammatory response triggered through TLR2 and TLR4 strongly depends on the Aspergillus morphotype. For example, while conidium recognition was mediated by both TLR2 and TLR4, TLR4-mediated signaling was lost in recognition of hyphae (24). This inability to recognize and fight the most dangerous morphotype could represent an immune evasion mechanism (23). On the other hand, very little is known about whether fungal pathogens can also modulate a TLR-mediated host defense by decreasing the capacity of host cells to respond to TLR2 and TLR4 ligands.

The aim of the present study was to study the capacity of A. fumigatus to modulate the host immune response triggered by TLRs. The effects of Aspergillus modulation of TLR2 and TLR4 activation were specifically examined, given that these receptors mediate the major pathways implicated in antifungal host defense.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Reagents. The TLR2 ligand tripalmitoyl-S-glycerol-Cys-(Lys)4 (Pam3Cys) was purchased from EMC Microcollections (Tübingen, Germany). The TLR4 ligand Escherichia coli lipopolysaccharide (LPS) (E. coli serotype O55:B5) was purchased from Sigma Chemical Co. (St. Louis, MO). An extra LPS purification step was performed as previously described (13). Cytochalasin B was purchased from BIOMOL International and dissolved at a concentration of 5 mg/ml in dimethyl sulfoxide. Laminarin, a specific inhibitor of dectin-1, and mannan, a competitive inhibitor of the mannose receptor (MR) pathway (38), were kindly provided by David Williams (University of Tennessee). Bartonella LPS (anti-TLR4) was obtained as previously described (27). 3-(1-Methyl-1H-indol-3yl-methylene)-2-oxo-2,3-dihydro-1H-indole-5-sulfonamide (Calbiochem) was used for pharmacological inhibition of the dectin-1-associated adaptor molecule Syk.

A. fumigatus. Strain V05-27, a previously characterized clinical isolate of A. fumigatus (24), was grown on Sabouraud glucose agar supplemented with chloramphenicol for 4 to 7 days at 35°C. Abundant conidia were produced under these conditions. Conidia were harvested by gently scraping the surfaces of slants and suspending the conidia in phosphate-buffered saline (PBS) with 0.05% Tween 80. To remove hyphae and debris, the conidial suspension was filtered through four layers of sterile gauze. To obtain hyphal fragments, conidia were added to 5 ml of yeast nitrogen base (Difco Laboratories) at a final concentration of 10⁸ microorganisms/ml. After 18 h of incubation at 37°C, the tubes were centrifuged at 1,550 x g for 10 min, and the pellet, containing mycelia almost exclusively, was washed twice in Hanks' balanced salt solution without Ca²⁺ and Mg²⁺ and resuspended in PBS. Aliquots of the conidial suspension and mycelium were heat killed for 60 min at 56°C. Nonviable conidia and hyphal fragments were centrifuged at 4,000 x g for 15 min, resuspended, and vortexed vigorously. Finally, both suspensions were washed three times with Hanks' balanced salt solution without Ca²⁺ and Mg²⁺ to remove released A. fumigatus components and then kept frozen at –80°C until they were used. Viability was checked by culturing in Sabouraud glucose broth, and no growth was observed after heat treatment. The Aspergillus materials were prepared in an LPS-free fashion. For the experiments, 10⁷ microorganisms/ml of heat-killed A. fumigatus conidia or hyphae and 10⁶ microorganisms/ml of live A. fumigatus conidia were used for priming, unless otherwise indicated.

Stimulation assays. Venous blood was drawn into EDTA tubes from healthy volunteers after informed consent was obtained. Peripheral blood mononuclear cells (PBMC) were isolated by density centrifugation on Ficoll-Hypaque (Pharmacia Biotech, Uppsala, Sweden). Cells were washed twice in saline and counted, and the concentration was adjusted to 5 x 10⁶ cells/ml. A 100-µl volume of the PBMC preparation, suspended in culture medium (RPMI 1640 DM; ICN Biomedicals, Costa Mesa, CA) supplemented with 10 µg/ml gentamicin, 10 mM L-glutamine, and 10 mM pyruvate, was added to flat-bottom 96-well plates (Greiner, The Netherlands).

PBMC were preincubated with A. fumigatus conidia, hyphae, or RPMI 1640 (as an unprimed control). After 24 h of incubation at 37°C, the culture supernatants were replaced with fresh culture medium containing a secondary stimulus consisting of either the TLR2 ligand (10 µg/ml Pam3Cys) or the TLR4 ligand (1 ng/ml LPS). The supernatants were collected after 24 h of incubation at 37°C and stored at –20°C until the cytokine assay was performed. To block phagocytosis, PBMC were preincubated with 1 µg/ml of cytochalasin B for 30 min at 37°C before stimulation with A. fumigatus components as described above. For receptor-blocking experiments, mannan (200 µg/ml), laminarin (200 µg/ml), or Bartonella LPS (160 ng/ml) fractions were preincubated with PBMC for 1 h at 37°C prior to stimulation with Aspergillus. Dectin-1-mediated intracellular pathways were inhibited by preincubation of cells with a Syk inhibitor (50 nmol/liter) for 30 min before incubation with A. fumigatus. The experiments were performed in the absence or presence of inhibitors using PBMC from the same volunteers.

Differentiation of monocyte-derived macrophages (MDM) was performed as previously described (10). In brief, monocytes were isolated by adherence following PBMC isolation, washed, and resuspended in freshly prepared RPMI 1640 containing 10% pooled human serum supplemented with pyruvate, L-glutamine, and gentamicin. The cells were maintained in a humidified atmosphere (5% CO₂) at 37°C for 6 days to permit differentiation, and the medium was refreshed after 3 days. The procedure used for stimulation assays involving MDM was similar to the procedure used for PBMC.

Cytokine measurements. Interleukin-6 (IL-6) and IL-1β concentrations were measured by using commercial sandwich enzyme-linked immunosorbent assay kits (Pelikine Compact, CLB, Amsterdam, The Netherlands) according to the manufacturer's instructions. Human tumor necrosis factor alpha (TNF-) concentrations were determined by a specific enzyme-linked immunosorbent assay as described elsewhere (12).

Quantitative PCR. To determine TLR2 and TLR4 mRNA expression, RNA was extracted from PBMC primed with A. fumigatus conidia or hyphae for 24 h. For IL-1β and TNF- mRNA expression, PBMC were primed with A. fumigatus and then stimulated with Pam3Cys, LPS, or RPMI 1640 as described above for 4 h. RNA was extracted from 10⁷ PBMC by using 1 ml TRIzol reagent (Sigma, St. Louis, MO). Subsequently, 200 µl chloroform and 500 µl 2-propanol (Merck, Darmstadt, Germany) were used to separate the RNA from DNA and proteins. Finally, after the preparation was washed with 75% ethanol, the RNA was dissolved in 50 µl of diethylpyrocarbonate water.

To obtain cDNA, we reverse transcribed 1 µg DNase-treated total RNA with oligo(dT) primers (0.01 µg/ml) in a reverse transcription-PCR mixture (total volume, 20 µl). Quantitative real-time PCR to monitor DNA synthesis was performed using a Bio-Rad iCycler and SYBR green. The following primers were used (5'-3'): GAATCCTCCAATCAGGCTTCTCT (forward) and GCCCTGAGGGAATGGAGTTTA (reverse) for TLR2, GGCATGCCTGTGCTGAGTT (forward) and CTGCTACAACAGATACTACAAGCACACT (reverse) for TLR4, GCCCTAAACAGATGAAGTGCTC (forward) and GAACCAGCATCTTCCTCAG (reverse) for IL-1β, TGGCCCAGGCAGTCAGA (forward) and GGTTTGCTACAACATGGGCTACA (reverse) for TNF-, and ATGAGTATGCCTGCCGTGTG (forward) and CCAAATGCGGCATCTTCAAAC (reverse) for β₂ microglobulin (Biolegio, The Netherlands). Quantification of the PCR signals for each sample was performed by comparing the cycle threshold values in duplicate for the gene of interest with the cycle threshold values for the β₂ microglobulin housekeeping gene. The mean relative mRNA expression was calculated using the Pfaffl method. The results are expressed below as the ratio of the amount of increase to the mRNA level for unprimed cells.

TLR2 and TLR4 expression as determined by flow cytometry. From PBMC, CD14⁺ monocytes were isolated by positive selection with anti-CD14 microbeads according to the manufacturer's instructions (Miltenyi Biotec, Germany). Following incubation with A. fumigatus conidia or hyphae or an RPMI 1640 control for 24 h, cells were cooled to 4°C, washed two times in 0.5% bovine serum albumin-PBS, and incubated for 15 min with the following monoclonal antibodies (MAbs): anti-TLR2-fluorescein isothiocyanate and anti-TLR4-phycoerythrin (eBioscience, San Diego, CA). The cells were washed two more times and then analyzed with a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA).

Phagocytosis of Aspergillus conidia and TLR2 internalization. Blankophor staining (30) was used to differentiate phagocytosed Aspergillus conidia from bound conidia. A. fumigatus conidia were incubated with monocytes obtained via adherence from PBMC for 30 min at 37°C. To permit phagocytosis, monocytes were washed at 4°C, and Blankophor stain was added. The fresh mount was then visualized using a Leica fluorescence microscope. To visualize internalization of surface TLR2, monocytes were allowed to adhere to fibronectin, and the cells were preincubated with an Alexa 488-labeled TLR2-specific MAb (eBioscience, San Diego, CA) or its isotype control. A. fumigatus conidia were added, and phagocytosis was assessed after 30 min of incubation at 37°C. After this incubation the samples were washed, fixed in 4% paraformaldehyde, and visualized using an Olympus FV1000 confocal microscope.

Statistical analysis. Results from at least three sets of experiments were pooled and analyzed using SPSS 16.0 statistical software. The data are expressed below as means ± standard errors of the means, and the Wilcoxon signed-rank test was used to compare differences between groups (unless otherwise stated). The level of significance was defined as a P value of <0.05.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
A. fumigatus conidia and hyphae differentially modulate the host proinflammatory cytokine response induced by TLR2 and TLR4. Following preincubation of PBMC with heat-killed A. fumigatus conidia and hyphae, a dose-dependent cytokine response was observed following Pam3Cys (TLR2) or LPS (TLR4) stimulation, as indicated by IL-6 production. A differential and inverse dose-dependent cytokine response was observed following preincubation with A. fumigatus hyphae and subsequent TLR2 stimulation (Fig. 1a and 1b). As 10⁷ microorganisms/ml of A. fumigatus conidia and hyphae resulted in the strongest responses during most TLR stimulations, subsequent experiments were performed using 10⁷ microorganisms/ml of conidia and hyphae.

View larger version (25K): [in this window] [in a new window]

FIG. 1. Effects of preincubation of PBMC (a to h) or MDM (i and j) with heat-killed Aspergillus conidia (a to d, i, and j), hyphae (e and f), or live conidia (g and h) on the host TLR2 (Pam3Cys)- and TLR4 (LPS)-mediated proinflammatory response, compared to results obtained with the corresponding unprimed controls (RPMI 1640). (a and b) Dose-dependent IL-6 response to TLR2 agonist and TLR4 agonist. Live Aspergillus conidia (g and h) resulted in IL-6 attenuation similar to that obtained with heat-killed components, but the TLR4-induced TNF- response was attenuated with germination and hyphal development (as anticipated with heat-killed hyphae [f]). The data are the cumulative results of at least three sets of experiments and are means and standard errors of the means. *, P < 0.05 for a comparison with corresponding unprimed PBMC control. Asp, Aspergillus; HK, heat killed.

Overall, preincubation of PBMC with heat-killed A. fumigatus conidia significantly attenuated IL-6 production in response to TLR2 and TLR4 stimulation (Fig. 1c and 1d). Similarly, IL-1β production induced by TLR2 was also strongly inhibited by A. fumigatus conidia. In contrast, the TNF- response was not influenced after preincubation of cells with heat-killed A. fumigatus conidia.

On the other hand, preincubation with heat-killed A. fumigatus hyphae had a limited immunomodulatory effect. Preincubation with Aspergillus hyphae attenuated the TLR4-induced IL-6 and TNF- production but increased the TLR2-induced TNF- production (Fig. 1e and 1f). TLR4 stimulation with LPS did not induce detectable levels of secreted IL-1β in cells preincubated with either RPMI 1640 or Aspergillus. This failure to release IL-1β into the environment is a known phenomenon due to initiation of macrophage differentiation (22, 41).

There was no increase in lactate dehydrogenase levels in the samples containing the Aspergillus fractions compared to controls, indicating that cellular toxicity did not have a role in these effects (data not shown).

Live Aspergillus conidia had effects (Fig. 1g and 1h) similar to those of heat-killed conidia, with attenuation of TLR2- and TLR4-induced IL-6 responses. However, in contrast to heat-killed conidia, live conidia decreased TLR4-mediated TNF- production. This response was similar to that observed with heat-killed hyphae (Fig. 1f). This differential TNF- response following stimulation with heat-killed conidia and with live conidia may be explained by the hyphal development from the live conidia during the course of the experiment.

The modulatory effects of A. fumigatus conidia on MDM were similar to those on PBMC. Following preincubation with conidia, the IL-6 production in response to TLR2 and TLR4 stimulation was attenuated (Fig. 1i and 1j).

IL-1β and TNF- mRNA expression. IL-1β mRNA expression was utilized as a surrogate to assess IL-1β and IL-6 transcription as this process is known to be tightly regulated (9). Parallel with the attenuation of secreted IL-1β by PBMC, A. fumigatus conidia markedly reduced IL-1β mRNA transcription induced by TLR2 or TLR4 ligands (ratios of 0.34 and 0.42 relative to unprimed controls, respectively) (Fig. 2). Notably, PBMC incubated with conidia alone also displayed attenuation of IL-1β mRNA transcription. This strengthened the evidence for the immunomodulatory potential of Aspergillus conidia. Aspergillus hyphae also inhibited TLR4-induced IL-1β mRNA transcription, while TLR2-induced IL-1β mRNA transcription was not affected. Cytokine mRNA expression was consistent with trends observed for measured secreted cytokines.

View larger version (18K): [in this window] [in a new window]

FIG. 2. IL-1β and TNF- mRNA expression in PBMC preincubated with A. fumigatus components for 24 h, followed by RPMI 1640, TLR2 ligand, or TLR4 ligand stimulation for 4 h. IL-1β mRNA expression was suppressed by Aspergillus conidia in the absence (RPMI 1640) and in the presence (Pam3Cys and LPS) of secondary stimulation. The data are the cumulative results of three sets of experiments and expressed as the means ± standard errors of the means. *, P < 0.05 relative to the ratio of the fold increase in the mRNA levels of unprimed cells. Asp, Aspergillus.

As observed for the cytokine stimulation pattern, the TNF- mRNA expression was distinct from IL-1β mRNA expression (Fig. 2). Aspergillus hyphae slightly amplified TNF- mRNA expression induced by TLR2 ligation, which eventually translated into elevated TNF- levels detectable in the supernatants (Fig. 1b).

Taken together, these results indicate that Aspergillus conidia alter TLR2- and TLR4-mediated signaling, resulting in downregulation of cytokine production, and this is corroborated by mRNA measurements. Aspergillus hyphae also induced attenuation of TLR4-mediated signaling, although there was a tendency toward an increase in the TLR2 response.

Role of Aspergillus conidia uptake for the immunomodulatory effects. In order to assess whether phagocytosis of conidia was involved in the modulation of TLR-induced activation, cytochalasin B, an inhibitor of actin polymerization, was added to PBMC prior to priming with conidia or hyphae. Cytochalasin B reversed the inhibition of TLR2-induced IL-6 levels (Fig. 3a) and IL-1β levels (data not shown). Interestingly, the effects of Aspergillus on TLR4-induced IL-6 were not influenced by cytochalasin B; i.e., these effects were independent of phagocytosis (Fig. 3b).

View larger version (14K): [in this window] [in a new window]

FIG. 3. IL-6 production after TLR2 or TLR4 stimulation by PBMC preincubated with A. fumigatus conidia or hyphae in the presence or absence (Control) of cytochalasin B (CytoB) compared to the results for corresponding unprimed PBMC (RPMI 1640). Inhibiting phagocytosis reversed TLR2-induced IL-6 attenuation (a) but not TLR4-induced IL-6 attenuation (b). The data are the cumulative results of three sets of experiments and are means and standard errors of the means. *, P < 0.05 compared to the corresponding unprimed PBMC following secondary stimulation.

Role of other PRRs in immunomodulation induced by A. fumigatus. In order to assess the role of the various PRRs involved in the recognition of A. fumigatus, we blocked the respective receptors prior to Aspergillus incubation using specific inhibitors. This was followed by TLR2 or TLR4 ligand stimulation as described above. IL-6 production was used as a representative read-out parameter.

Blockage of the MR by mannan had no effect on IL-6 attenuation by Aspergillus conidia, but it did have an effect on hyphal modulation of LPS-induced IL-6 expression (Fig. 4a and 4b). No effects of dectin-1 blockage with laminarin (Fig. 4c and 4d) or of TLR4 blockage with Bartonella LPS (Fig. 4e and 4f) were observed for Aspergillus-induced modulation of TLR responses. Chemical blockage of the dectin-1 adaptor molecule Syk using a specific chemical inhibitor did not have an effect on immunomodulation (data not shown).

View larger version (28K): [in this window] [in a new window]

FIG. 4. IL-6 production after TLR2 or TLR4 stimulation by PBMC preincubated with A. fumigatus conidia or hyphae in the presence or absence (Control) of the specified inhibitor compared to those for the corresponding unprimed PBMC (RPMI 1640). The inhibitors used were mannan (which blocks MR), laminarin (which blocks dectin-1), and Bartonella LPS (TLR4 antagonist). TLR4-mediated attenuation of IL-6 by A. fumigatus hyphae was reversed using mannan (b). Modulatory effects were not reversed by blocking the dectin-1 receptor or TLR4 (c to f). The data are the cumulative results of three sets of experiments and expressed as the means ± standard errors of the means. *, P < 0.05 compared to the respective unprimed PBMC. Bart, Bartonella.

Taken together, the results indicate that cytokine production following TLR2 and TLR4 stimulation is downregulated by Aspergillus conidia, an immunomodulatory process that is phagocytosis dependent via the TLR2-mediated pathway and largely independent of other PRRs, such as TLR4, MR, and dectin-1. A. fumigatus hyphae induced downregulation of TLR4-mediated signaling, which was MR dependent.

Modulation of TLR2 and TLR4 transcription and expression by A. fumigatus. One possible mechanism through which Aspergillus may modulate cytokine responses is by directly influencing TLR2 and TLR4 expression. We first assessed whether the amount of TLR mRNA transcription in PBMC was modulated after incubation with A. fumigatus conidia and hyphae. In the presence of A. fumigatus conidia, there was minimal reduction in TLR2 and TLR4 mRNA transcription compared to that in unprimed cells (Fig. 5). Likewise, in PBMC primed with hyphae, neither TLR2 expression nor TLR4 mRNA expression was significantly altered.

View larger version (12K): [in this window] [in a new window]

FIG. 5. Relative TLR2 and TLR4 mRNA expression in PBMC following incubation with Aspergillus conidia and hyphae. The data are the cumulative results of three sets of experiments and expressed as the means ± standard errors of the means. The values are not statistically significant. Asp, Aspergillus.

Flow cytometry was performed with positively selected CD14⁺ monocytes incubated with A. fumigatus conidia and hyphae. This methodology was employed because of binding of conidia to monocytes, which affected scatter characteristics and possibly altered CD14 expression upon exposure to Aspergillus (5). After stimulation with A. fumigatus conidia, surface TLR2 expression on the monocytes was significantly reduced compared to TLR4 expression (Table 1).

View this table: [in this window] [in a new window]

TABLE 1. Expression of surface TLR2 and TLR4 on CD14+ monocytes following incubation with A. fumigatus conidia or hyphae or with an unprimed control (RPMI 1640)

These data, together with the minimally influenced mRNA expression, suggest that A. fumigatus conidia induced depletion of surface TLR2 expression on PBMC by inducing receptor engagement and internalization rather than by inhibiting TLR transcription.

Internalization of TLR2 following phagocytosis of Aspergillus conidia. An alternative explanation to the decreased surface TLR2 expression described above could be that there was adherence of Aspergillus conidia to surface TLR2 binding sites, which blocked access to anti-TLR2 MAb (Table 1). Blankophor staining was utilized to distinguish between ingested and adherent conidia. As shown in Fig. 6a and 6b, following incubation of Aspergillus conidia with monocytes, all phagocytosed conidia remained unstained, in contrast to conidia in the external milieu. This indicates that interference of TLR2-bound conidia on the cell surface with an anti-TLR2 MAb is very unlikely. In addition, using confocal microscopy, we demonstrated that there was internalization of surface TLR2 into the phagosome together with the A. fumigatus conidia (Fig. 6c to f).

View larger version (66K): [in this window] [in a new window]

FIG. 6. (a) Direct microscopic view of a monocyte with three phagocytosed Aspergillus conidia and an adherent conidium in the external milieu (arrow). (b) Blankophor staining of the same field, except that the externalized conidium (arrow) was fluorescent. (c and d) Light and fluorescent views of a monocyte labeled with Alexa 488-TLR2 MAb obtained by confocal microscopy, showing localization of TLR2 on cell surface. (e and f) Following phagocytosis of Aspergillus conidia (asterisk), concurrent internalization of TLR2 with the phagosome was observed.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
In the present study, we show that A. fumigatus conidia have the modulatory potential to selectively attenuate TLR2- or TLR4-induced proinflammatory IL-1β and IL-6 cytokine production in mononuclear phagocytic cells. The modulatory effects were observed in PBMC and MDM and could be induced with both heat-killed and live conidia. The immunomodulatory effects of Aspergillus conidia on TLR responses are apparent at the transcriptional level due to inhibition of cytokine mRNA. Downregulation of the TLR2-mediated pathway involved internalization of the receptor together with Aspergillus conidia into the phagosome, resulting in decreased expression of TLR2 on the cell membrane. Aspergillus hyphae displayed a propensity to selectively downmodulate TLR4-mediated responses, an effect partially mediated by the MR. The TLR2- and TLR4-mediated phenomena described above were not attributable to altered receptor mRNA transcription.

As Aspergillus conidia are the primary morphotype infecting the host, it is possible that the conidial form, because of its ability to decrease the host proinflammatory response via TLR suppression, provides an early advantage to the fungus that enhances its chance of survival and compromises initial attempts by the host defense to contain germination. Hyphal development further induces a selective loss of TLR4-mediated proinflammatory response capacity. However, one has to acknowledge that these effects are most likely relevant only in immunocompromised patients, as host defenses in immunocompetent individuals are usually effective against invasive Aspergillus infection.

Conidial and hyphal forms of A. fumigatus are able to differentially modulate the host response and generate distinct cytokine responses. Notably, A. fumigatus conidia attenuated both TLR2- and TLR4-induced responses (IL-1β and IL-6 concentrations), but its hyphae resulted in retention or even accentuation of the TLR2-induced response (TNF- production and mRNA concentration) while they suppressed the TLR4 activity. The decreased extracellular cytokine levels were corroborated by mRNA measurements. Diminished hypha-induced TLR4-mediated proinflammatory signaling is consistent with our earlier observation that A. fumigatus hyphae could induce a loss of TLR4-mediated proinflammatory signals while sparing the TLR2-mediated proinflammatory signals (24). In light of this differential response, recent data have suggested that activation of TLR2 in the absence of TLR4 signals (as observed here with A. fumigatus hyphae) may favor a Th2-type response and provide an advantage to the pathogen (8, 28).

Nonetheless, while it might be tempting to speculate that the observations described above are means of an immune escape mechanism employed by the pathogen to evade the host innate defense, these data may need to be interpreted in the context of the other modulatory consequences of Aspergillus infection (5). For instance, we also noted a trend toward increased TNF- production induced by A. fumigatus hyphae via TLR2, which may be a compensatory response to the TLR4-associated attenuation. The immunomodulatory effects on cytokine production by A. fumigatus conidia are also not generalized but are significantly more profound for IL-1β and IL-6, while TNF- production remains largely unaffected. It appears that TNF- synthesis may be compensated for by alternative mechanisms, such as induction through lectin receptors like dectin-1 or MRs (20, 34). Our results also suggest that there are differences in the pathways leading to TNF- and IL-1β transcription and that these pathways are differentially regulated by the corresponding Aspergillus morphotypes. The concept that Aspergillus conidia and hyphae induce differential immune responses has recently been suggested (5, 31). Cortez et al. showed that conidia can induce differential expression of genes implicated in host defense and immunomodulation (5). The diminished IL-6 and IL-1β response reported in our study may be biologically significant as these cytokines orchestrate the host proinflammatory antimicrobial response, including neutrophil recruitment (14, 39). In addition, altered levels of these proinflammatory cytokines affect the Th1-Th2 equilibrium, which may result in an attenuated host phagocytic and cytotoxic response (33).

We demonstrated that the inhibition of TLR2-mediated responses by Aspergillus conidia was due to induction of TLR2 engagement and internalization rather than to mediation via other PRRs, like MR, TLR4, or dectin-1. This conclusion is supported by recent studies which described TLR2 involvement in phagocytosis of A. fumigatus conidia, as well as internalization and recruitment of TLR2 in phagosomes (17, 36). However, contrary to the notion that phagocytosis is often coupled with elaboration of a proinflammatory cytokine response, as seen in Candida and gram-positive bacteria (37), our findings suggest that in the case of A. fumigatus conidia, phagocytosis may result in surface receptor depletion and consequently decreased receptor-mediated signaling. We also noted that use of laminarin (a dectin-1 receptor-specific inhibitor) did not reverse the inhibitory effect induced by conidial phagocytosis involving the TLR2 pathway. Our finding counters prior observations that the dectin-1 receptor is intrinsically involved in phagocytosis of A. fumigatus conidia and supports the notion that a dectin-1-independent mode of phagocytosis exists based on our experiments using heat-killed conidia (11, 17).

Our observations have also indicated that the MR, another C-type lectin receptor, has a possible immunomodulatory role. Despite its reported ability to recognize fungi like Candida albicans, Cryptococcus neoformans, and Pneumocystis, little is known about the role of MR as a PRR for A. fumigatus (3, 6, 26). This is intriguing given that terminal mannose, fucose, and N-acetylglucosamine are established ligands for MR (35) and such mannose-based moieties are a major component of the Aspergillus cell wall (15). Although MR has been implicated in the phagocytosis of fungi, it did not seem to play a significant role in the inhibitory effects on TLR2 signals that are mediated through phagocytosis of Aspergillus conidia (16, 42). However, we show that mannan reversed TLR4-mediated attenuation of IL-6 production following preincubation with A. fumigatus hyphae. It is thus very likely that a ligand of the MR on the Aspergillus cell wall is involved in the modulatory capability of the fungus. This is supported by emerging data suggesting that MR has an immunoregulatory role in curtailing the proinflammatory response (4, 43, 44).

A. fumigatus remains the most important filamentous fungal pathogen with significant attributable morbidity and mortality in at-risk patient cohorts (7, 25). We have attempted to show how A. fumigatus may alter the host response, in particular, the TLR-mediated host defense, during the course of infection. The observations reported here demonstrate how a pathogen may intrinsically induce downregulation of selective host proinflammatory responses to its advantage. However, the absence of invasive infection in healthy individuals, despite the ubiquitous presence of Aspergillus, attests to the effective antifungal mechanisms usually present in a healthy host. In addition to the modulatory effects induced by the pathogen reported above, further immune deficiencies in a compromised host provide the "second hit," leading to disease development. Although the latter factor undoubtedly is the major determining factor in acquisition of invasive disease, it is believed that the intrinsic immune modulatory potential of A. fumigatus contributes to the net deficit in the proinflammatory response that skews the Th1-Th2 equilibrium toward an advantage for the pathogen.

 
We thank Mdm Khoo Ai Leng for her secretarial assistance. We are also grateful to Matthew McCall and Richard Huijbens for their assistance with flow cytometry, Ben Joosten, Cor Jacobs, and Ton Rijs for their assistance with fluorescent microscopy, and Johanna van der Ven-Jongekrijg, Trees Jansen, Liesbeth Jacobs, and Evaline Hendriks for their technical assistance. L.Y.A.C. thanks P. Tambyah for his mentorship.

L.C. was supported by the Health Manpower Development Plan (HMDP) Fellowship, Ministry of Health, Singapore, and by the International Fellowship, Agency for Science, Technology and Research (A*STAR)/National Medical Research Council (NMRC), Singapore. M.G.N. was supported by a Vidi grant from The Netherlands Organization for Scientific Research.

We had no conflicts of interest.

 
* Corresponding author. Mailing address: Department of Medicine (463), Radboud University Nijmegen Medical Center, P.O. Box 9101, Geert Grootplein 8, 6525 GA Nijmegen, The Netherlands. Phone: 31-24-3618819. Fax: 31-24-3541734. E-mail: M.Netea{at}aig.umcn.nl

Published ahead of print on 9 February 2009.

Editor: A. Casadevall

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Balloy, V., M. Si-Tahar, O. Takeuchi, B. Philippe, M. A. Nahori, M. Tanguy, M. Huerre, S. Akira, J. P. Latge, and M. Chignard. 2005. Involvement of Toll-like receptor 2 in experimental invasive pulmonary aspergillosis. Infect. Immun. 73:5420-5425.[Abstract/Free Full Text]
2
2. Bellocchio, S., C. Montagnoli, S. Bozza, R. Gaziano, G. Rossi, S. S. Mambula, A. Vecchi, A. Mantovani, S. M. Levitz, and L. Romani. 2004. The contribution of the Toll-like/IL-1 receptor superfamily to innate and adaptive immunity to fungal pathogens in vivo. J. Immunol. 172:3059-3069.[Abstract/Free Full Text]
3
3. Bennett, J. E., M. M. Friedman, and B. Dupont. 1987. Receptor-mediated clearance of Aspergillus galactomannan. J. Infect. Dis. 155:1005-1010.[Medline]
4
4. Chieppa, M., G. Bianchi, A. Doni, A. Del Prete, M. Sironi, G. Laskarin, P. Monti, L. Piemonti, A. Biondi, A. Mantovani, M. Introna, and P. Allavena. 2003. Cross-linking of the mannose receptor on monocyte-derived dendritic cells activates an anti-inflammatory immunosuppressive program. J. Immunol. 171:4552-4560.[Abstract/Free Full Text]
5
5. Cortez, K. J., C. A. Lyman, S. Kottilil, H. S. Kim, E. Roilides, J. Yang, B. Fullmer, R. Lempicki, and T. J. Walsh. 2006. Functional genomics of innate host defense molecules in normal human monocytes in response to Aspergillus fumigatus. Infect. Immun. 74:2353-2365.[Abstract/Free Full Text]
6
6. Dan, J. M., R. M. Kelly, C. K. Lee, and S. M. Levitz. 2008. Role of the mannose receptor in a murine model of Cryptococcus neoformans infection. Infect. Immun. 76:2362-2367.[Abstract/Free Full Text]
7
7. Denning, D. W. 1998. Invasive aspergillosis. Clin. Infect. Dis. 26:781-803.[Medline]
8
8. Dillon, S., A. Agrawal, T. Van Dyke, G. Landreth, L. McCauley, A. Koh, C. Maliszewski, S. Akira, and B. Pulendran. 2004. A Toll-like receptor 2 ligand stimulates Th2 responses in vivo, via induction of extracellular signal-regulated kinase mitogen-activated protein kinase and c-Fos in dendritic cells. J. Immunol. 172:4733-4743.[Abstract/Free Full Text]
9
9. Dinarello, C. A. 1996. Biologic basis for interleukin-1 in disease. Blood 87:2095-2147.[Abstract/Free Full Text]
10
10. Ferwerda, G., F. Meyer-Wentrup, B. J. Kullberg, M. G. Netea, and G. J. Adema. 2008. Dectin-1 synergizes with TLR2 and TLR4 for cytokine production in human primary monocytes and macrophages. Cell. Microbiol. 10:2058-2066.[CrossRef][Medline]
11
11. Gersuk, G. M., D. M. Underhill, L. Zhu, and K. A. Marr. 2006. Dectin-1 and TLRs permit macrophages to distinguish between different Aspergillus fumigatus cellular states. J. Immunol. 176:3717-3724.[Abstract/Free Full Text]
12
12. Grebenchtchikov, N., J. van der Ven-Jongekrijg, G. J. Pesman, A. Geurts-Moespot, J. W. van der Meer, and F. C. Sweep. 2005. Development of a sensitive ELISA for the quantification of human tumour necrosis factor-alpha using 4 polyclonal antibodies. Eur. Cytokine Netw. 16:215-222.[Medline]
13
13. Hirschfeld, M., J. J. Weis, V. Toshchakov, C. A. Salkowski, M. J. Cody, D. C. Ward, N. Qureshi, S. M. Michalek, and S. N. Vogel. 2001. Signaling by Toll-like receptor 2 and 4 agonists results in differential gene expression in murine macrophages. Infect. Immun. 69:1477-1482.[Abstract/Free Full Text]
14
14. Kullberg, B. J., M. G. Netea, A. G. Vonk, and J. W. van der Meer. 1999. Modulation of neutrophil function in host defense against disseminated Candida albicans infection in mice. FEMS Immunol. Med. Microbiol. 26:299-307.[CrossRef][Medline]
15
15. Latge, J. P. 2008. Galactofuranose containing molecules in Aspergillus fumigatus. Med. Mycol. 5:1-6.
16
16. Le Cabec, V., L. J. Emorine, I. Toesca, C. Cougoule, and I. Maridonneau-Parini. 2005. The human macrophage mannose receptor is not a professional phagocytic receptor. J. Leukoc. Biol. 77:934-943.[Abstract/Free Full Text]
17
17. Luther, K., A. Torosantucci, A. A. Brakhage, J. Heesemann, and F. Ebel. 2007. Phagocytosis of Aspergillus fumigatus conidia by murine macrophages involves recognition by the dectin-1 beta-glucan receptor and Toll-like receptor 2. Cell. Microbiol. 9:368-381.[CrossRef][Medline]
18
18. Mambula, S. S., K. Sau, P. Henneke, D. T. Golenbock, and S. M. Levitz. 2002. Toll-like receptor (TLR) signaling in response to Aspergillus fumigatus. J. Biol. Chem. 277:39320-39326.[Abstract/Free Full Text]
19
19. Meier, A., C. J. Kirschning, T. Nikolaus, H. Wagner, J. Heesemann, and F. Ebel. 2003. Toll-like receptor (TLR) 2 and TLR4 are essential for Aspergillus-induced activation of murine macrophages. Cell. Microbiol. 5:561-570.[CrossRef][Medline]
20
20. Mytar, B., M. Gawlicka, R. Szatanek, M. Woloszyn, I. Ruggiero, B. Piekarska, and M. Zembala. 2004. Induction of intracellular cytokine production in human monocytes/macrophages stimulated with ligands of pattern recognition receptors. Inflamm. Res. 53:100-106.[CrossRef][Medline]
21
21. Netea, M. G., G. D. Brown, B. J. Kullberg, and N. A. Gow. 2008. An integrated model of the recognition of Candida albicans by the innate immune system. Nat. Rev. Microbiol. 6:67-78.[CrossRef][Medline]
22
22. Netea, M. G., C. Nold-Petry, M. F. Nold, L. A. Joosten, B. Opitz, J. H. van der Meer, F. L. van de Veerdonk, G. Ferwerda, B. Heinhuis, I. Devesa, C. J. Funk, R. J. Mason, B. J. Kullberg, A. Rubartelli, J. W. van der Meer, and C. A. Dinarello. 2009. Differential requirement for the activation of the inflammasome for processing and release of IL-1beta in monocytes and macrophages. Blood. 113:2324-2335.[Abstract/Free Full Text]
23
23. Netea, M. G., J. W. Van der Meer, and B. J. Kullberg. 2004. Toll-like receptors as an escape mechanism from the host defense. Trends Microbiol. 12:484-488.[CrossRef][Medline]
24
24. Netea, M. G., A. Warris, J. W. Van der Meer, M. J. Fenton, T. J. Verver-Janssen, L. E. Jacobs, T. Andresen, P. E. Verweij, and B. J. Kullberg. 2003. Aspergillus fumigatus evades immune recognition during germination through loss of Toll-like receptor-4-mediated signal transduction. J. Infect. Dis. 188:320-326.[CrossRef][Medline]
25
25. Patterson, T. F., W. R. Kirkpatrick, M. White, J. W. Hiemenz, J. R. Wingard, B. Dupont, M. G. Rinaldi, D. A. Stevens, and J. R. Graybill. 2000. Invasive aspergillosis. Disease spectrum, treatment practices, and outcomes. I3 Aspergillus Study Group. Medicine (Baltimore) 79:250-260.[CrossRef][Medline]
26
26. Pop, S. M., J. K. Kolls, and C. Steele. 2006. Pneumocystis: immune recognition and evasion. Int. J. Biochem. Cell Biol. 38:17-22.[CrossRef][Medline]
27
27. Popa, C., S. Abdollahi-Roodsaz, L. A. Joosten, N. Takahashi, T. Sprong, G. Matera, M. C. Liberto, A. Foca, M. van Deuren, B. J. Kullberg, W. B. van den Berg, J. W. van der Meer, and M. G. Netea. 2007. Bartonella quintana lipopolysaccharide is a natural antagonist of Toll-like receptor 4. Infect. Immun. 75:4831-4837.[Abstract/Free Full Text]
28
28. Re, F., and J. L. Strominger. 2001. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells. J. Biol. Chem. 276:37692-37699.[Abstract/Free Full Text]
29
29. Romani, L. 2004. Immunity to fungal infections. Nat. Rev. Immunol. 4:1-23.[CrossRef][Medline]
30
30. Ruchel, R., and M. Schaffrinski. 1999. Versatile fluorescent staining of fungi in clinical specimens by using the optical brightener Blankophor. J. Clin. Microbiol. 37:2694-2696.[Abstract/Free Full Text]
31
31. Simitsopoulou, M., E. Roilides, F. Paliogianni, C. Likartsis, J. Ioannidis, K. Kanellou, and T. J. Walsh. 2008. Immunomodulatory effects of voriconazole on monocytes challenged with Aspergillus fumigatus: differential role of Toll-like receptors. Antimicrob. Agents Chemother. 52:3301-3306.[Abstract/Free Full Text]
32
32. Steele, C., R. R. Rapaka, A. Metz, S. M. Pop, D. L. Williams, S. Gordon, J. K. Kolls, and G. D. Brown. 2005. The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus. PLoS Pathog. 1:e42.[CrossRef][Medline]
33
33. Stevens, D. A. 2006. Th1/Th2 in aspergillosis. Med. Mycol. 44:229-235.[CrossRef]
34
34. Taylor, P. R., G. D. Brown, J. Herre, D. L. Williams, J. A. Willment, and S. Gordon. 2004. The role of SIGNR1 and the beta-glucan receptor (dectin-1) in the nonopsonic recognition of yeast by specific macrophages. J. Immunol. 172:1157-1162.[Abstract/Free Full Text]
35
35. Taylor, P. R., S. Gordon, and L. Martinez-Pomares. 2005. The mannose receptor: linking homeostasis and immunity through sugar recognition. Trends Immunol. 26:104-110.[CrossRef][Medline]
36
36. Underhill, D. M., and B. Gantner. 2004. Integration of Toll-like receptor and phagocytic signaling for tailored immunity. Microbes Infect. 6:1368-1373.[CrossRef][Medline]
37
37. Underhill, D. M., A. Ozinsky, A. M. Hajjar, A. Stevens, C. B. Wilson, M. Bassetti, and A. Aderem. 1999. The Toll-like receptor 2 is recruited to macrophage phagosomes and discriminates between pathogens. Nature 401:811-815.[CrossRef][Medline]
38
38. van de Veerdonk, F. L., L. A. B. Joosten, I. Devesa, H. M. Mora-Montes, T.-D. Kanneganti, C. A. Dinarello, J. W. M. van der Meer, N. A. R. Gow, B. J. Kullberg, and M. G. Netea. 2009. Bypassing pathogen-induced inflammasome activation for regulation of IL-1β production by the fungal pathogen Candida albicans. J. Infect. Dis. 199:1087-1096.[CrossRef][Medline]
39
39. Vonk, A. G., M. G. Netea, J. H. van Krieken, Y. Iwakura, J. W. van der Meer, and B. J. Kullberg. 2006. Endogenous interleukin (IL)-1 alpha and IL-1 beta are crucial for host defense against disseminated candidiasis. J. Infect. Dis. 193:1419-1426.[CrossRef][Medline]
40
40. Wang, J. E., A. Warris, E. A. Ellingsen, P. F. Jorgensen, T. H. Flo, T. Espevik, R. Solberg, P. E. Verweij, and A. O. Aasen. 2001. Involvement of CD14 and Toll-like receptors in activation of human monocytes by Aspergillus fumigatus hyphae. Infect. Immun. 69:2402-2406.[Abstract/Free Full Text]
41
41. Wewers, M. D., and D. J. Herzyk. 1989. Alveolar macrophages differ from blood monocytes in human IL-1 beta release. Quantitation by enzyme-linked immunoassay. J. Immunol. 143:1635-1641.[Abstract]
42
42. Willment, J. A., and G. D. Brown. 2008. C-type lectin receptors in antifungal immunity. Trends Microbiol. 16:27-32.[CrossRef][Medline]
43
43. Yamamoto, Y., T. W. Klein, and H. Friedman. 1997. Involvement of mannose receptor in cytokine interleukin-1beta (IL-1beta), IL-6, and granulocyte-macrophage colony-stimulating factor responses, but not in chemokine macrophage inflammatory protein 1beta (MIP-1beta), MIP-2, and KC responses, caused by attachment of Candida albicans to macrophages. Infect. Immun. 65:1077-1082.[Abstract]
44
44. Zhang, J., S. D. Tachado, N. Patel, J. Zhu, A. Imrich, P. Manfruelli, M. Cushion, T. B. Kinane, and H. Koziel. 2005. Negative regulatory role of mannose receptors on human alveolar macrophage proinflammatory cytokine release in vitro. J. Leukoc. Biol. 78:665-674.[Abstract/Free Full Text]

---

Infection and Immunity, May 2009, p. 2184-2192, Vol. 77, No. 5
0019-9567/09/$08.00+0     doi:10.1128/IAI.01455-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Chai, L. Y. A. Articles by Netea, M. G. Search for Related Content PubMed PubMed Citation Articles by Chai, L. Y. A. Articles by Netea, M. G.